Bio 172 Exam 3 Review

Which sequences are protein coding genes?

- Computer programs are used to search a genome sequence to identify open reading frames (ORFs) . What is a reading frame? Animation for actual lecture -genes are functional unit -find genes with open reading frames, looks like it could code for a protein -can transcribe into RNA and look at RNa, but there's a shortcut -read codons (groups of three) -each strand of DNA can be read at 3 different frames by starting at dif letters T or C or second T in this. Then bottom strand has 3, so each double stranded DNA has 6 ORFs

What 3 essential things do plasmids in the lab contain?

- circular double stranded DNA that contains three essential things: an origin of replication an antibiotic resistance gene (e.g., ampicillin resistance (AmpR) a cloning site to insert foreign DNA -2. will kill off everything that isn't your plasmid 3. Typically there are multiple ways to put something in there (MCS-multiple cloning site)

Step 3

-"Grow" more plasmid Only a very small fraction of the treated bacterial cells will pick up a plasmid (become transformed) Need for selection: only cells that have picked up a plasmid can grow in the presence of antibiotics. -nothing is 100% efficient so only will get into some, not all -ampicillin will kill off everything except the bacteria with the plasmid, so then the plasmids will grow and divide

What are dideoxynucleotides and deoxynucleotides

-A dideoxynucleotide lacks the 3' hydroxyl group, and it cannot be elongated by DNA polymerase. (just an H) Each labeled with different fluorescent dye -A deoxynucleotide has a hydroxyl (-OH) group on the 3' carbon, allowing this end to be elongated.

DNA Fingerprinting

-Analyze repeat lengths of mini/microsatellite using PCR amplification of repeat region. -Analysis of a minisatellite from one individual on a gel: -look at PCR product which will get a banding pattern that is unique to everyone -use for finding parents, forensics

How can you introduce specific changes into DNA? What does CRISPR/Cas9 do?

-CRISPR/Cas9 -CRISPR RNA guides Cas9 protein to a specific site on DNA. -Cas9 cuts DNA. changing bio a ton -can be used to take any organism and alter the DNA sequence at will -just needs 2 components: CRISPR RNA and Cas9 protein -put them into cell, and CRISPR RNA will anneal to target DNA, when that happens the Cas9 protein will cut both strands (normally bad) -RNA needs homology to DNA that want to change *pic

What must the chromatin do before a gene can be transcribed?

-Chromatin must be opened up before a gene can be transcribed So RNA polymerase can find the promoter and bind to it

3. Chromatin remodeling

-Chromatin remodeling complexes use ATP to move nucleosome around to open up different stretches of DNA -many proteins get on compact DNA, use energy of ATP to push things around, and will loosen it up to open chromatin

1. Pre-transcription >> chromatin structure (Chromatin packing)

-Chromatin: DNA-associated proteins (histones) tightly package DNA into nucleosomes -Tight packing blocks RNA polymerase access to DNA -needs to happen before you even think about transcription -chromatin is what DNA is packaged into -DNA will be a lot shorter so it can fit into the nucleus -creates issue that now you have this tightly packed DNA, so how are you going to transcribe it all?

2 types of gene expression

-Constitutive expression = gene product made continuously -Regulated expression = gene product made on demand; expression can be induced or repressed -some genes you need all the time (constitutive expression) like in glycolysis

Overview of gene expression: 2. Transcription >> transcription factors Common theme between eukaryotic and and prokaryotic transcriptional regulation:

-DNA binding proteins bind to specific DNA sequences to regulate transcription. -light switches that turn on and off

The brilliant insight of Jacob & Monod How does E. coli turn genes on and off?

-DNA binding proteins binding to specific DNA sequences act as switches! -In regulatory mutants the gene (light bulb) is not mutant. The mutation is in the switch! -the mutation must be in the DNA of the light bulb -broken light switch must also be a DNA

What if you would like to amplify RNA? Can you use DNA polymerase?

-DNA polymerase can only use DNA as a template. -Need an enzyme that can make a DNA copy of an RNA( Reverse transcriptase) -can't use RNA as a template, bc polymerase wants DNA and a primer -there are some viruses (HIV f.e) have a different enzyme that have the ability to take a RNA template and convert to DNA copy (reverse transcriptase) -synthesis still 5' to 3' -first strand mRNA -one DNA copy, can be used in PCR look at drawing

How to fix both cut strands?

-DNA repair machinery seals DNA back together imperfectly introduce random mutations DNA repair machinery uses repair template to copy DNA sequencesreplace original sequence with custom designed sequence. -inprecise when DNA repair machinery by itself -need the other -put in custom DNA

Lactose metabolism in E. coli. What is preferred?

-E. coli use many sugars for metabolism -Glucose is the preferred source of carbon for E. coli -Why? -If glucose is not available, bacteria can break down lactose to generate glucose -protein is beta-galactosidase, not made all the time in e coli because it prefers to eat glucose, only will make when no glucose (because it can be converted to go into glycolysis) -can break down lactose to glucose, but it's less efficient than just digesting glucose first -lactose is a sugar which can be broken down into glucose or galactose-can be converted into glucose then glycolysis -gene is LacZ

DNA methylation and some types of histone modifications are ___________ following cell divisions

-Epigenetic inheritence: non-DNA sequence-based heritability -is this heritable: yes -will have stretch on un and of meth, after replicated the meth and un will be the same -how do you copy meth sections?- histone modification -want to copy meth DNA on new DNA, meth on both strands -DNA put in unmeth cytosines after replication, enzyme will -enzyme that adds methyl groups is attracted to hemi-methy DNA, one strand is meth the other is not, So when DNA methy trans sees this, it will methy the other strand -The methylation status of genes from the previous cell generation is remembered.

2. Example: Histone acetylation

-Histone acetylation opens up chromatin -Histone acetyl transferases (HATs) add acetyl groups to positively charged lysine residues; histone deacetylases (HDACs) remove acetyl groups -lysines are pos charged form strong interactions with neg charged DNA, if adding acetyl you're going to neutralize the charge and the interactions won't be as strong (btw DNA and histone) -looses chromatin then -HDAC will close chromatin

How can genes be identified in eukaryotes?

-In eukaryotic organisms, genes contain introns, and identification of ORFs is more difficult. One strategy is to use cDNA sequences and then locate the gene in the genome sequence. -introns interrupt ORFs -looking at both RNA and DNA. Convert mRNA to cDNA by reserve transcriptase and sequence them then can observe ORFs - look at where it came from in the genome by comparing genomic DNA to observed cDNA -first stretch came from here, sequence that isn't in RNA, so know intron comes next, then another exon etc. *slide 19

1. DNA methylation

-In most plants and some animals cytosines in DNA can be methylated -DNA methyltransferase (DNMT) adds methyl groups to cytosines -add methyl group -cytosine is the only one that methylated not G,A etc -DNA methylation is associated with condensed chromatin (and therefore inhibition of transcription). -chromatin becomes more compact, so will inhibit transcription

How are LacZ and LacY transcribed?

-LacZ and LacY are transcribed as a single polycistronic mRNA -coding sequences are right next to each other, just one promotor for both -ribosomes bind to binding sites and translates them into proteins, different ribosome for each coding sequence, so can make 2 proteins from one mRNA strand -not unusual for proks to make polycistronic mRNAs -multiple coding sequences on one RNA resulting in multiple proteins: polycistronic mRNA -when transcribing LacZ, you're also going to be transcribing LacY

Q: Under what conditions does E. coli produce -galactosidase?

-Lactose induces expression of b-galactosidase -Glucose inhibits production of b-galactosidase (Jacob and Monod) -only expressed on treatment 3 with lactose only, not glucose and lactose, or glucose only -so lactose is what turns beta galactosidase on

Mutations in repressor or operator

-Loss of function mutation in LacI, lactose present or absent no LacI made, RNA Pol binds to promoter -Mutation in operator, lactose present or absent LacI protein cannot bind to operator, RNA Pol binds to promoter -no operator binding, first protein mutation -doesn't matter because no functional operator, so if no operator, the RNA poI will bind, which leads to transcription all the time (light switch stuck on)

Short tandem repeats

-Microsatellites, or simple sequence repeats, are repeating sequences of 1 to 5 bases. -Minisatellites, or variable number terminal repeats (VNTRs), are repeating sequences of 6 to 500 bases. Repeat sequences are hypervariable (they vary among individuals), and each individual has a unique set. Can be used in DNA fingerprinting (crime scene, paternity tests etc) by analyzing repeat length. micro is v small -mini bigger -doesn't matter length, these combos are DNA fingerprinting

Transgenerational epigenetic inheritance?

-Most DNA methylations are "reset" during gametogenesis - wiping the slate clean -Transgenerational inheritance of phenotypic changes not due to DNA sequence clearly happen: Examples:-Some epimutations in plants-genomic imprinting in mammals -epi means not inherited -can you pass on things that aren't DNA from parent to child? Yes (transgenerational inheritance), can modify chromatin, but most things you can't -need to make sure DNA in cell won't make a cell for skin actually a liver -happens more in plants because wiping slate clean not as advanced

What are the 2 keys to PCR?

-Need to have sequence information to design primers -must have primers and what the exact sequence of the primer is, or else it won't work (need to know beginning and the end of the DNA sequence) -don't need to know the rest of the sequence -heat stable DNA polymerase -allows separation of double-stranded DNA by heat (without killing the enzyme) alternating with repeated cycles of DNA replication -need special DNA polymerase -if heated normal DNA polymerase, it would denature and not work -so isolate and use thermophile DNA polymerase

Dual Regulation of lac operon

-Negative control by lac repressor >> represses transcription unless lactose is present (lactose inactivates repressor) -Positive control by CRP >> activates transcription when [cAMP] levels are high (resulting from low [glucose]) -High levels of transcription only when repressor is not bound AND activator is bound (-both conditions must be favorable)

Major surprise #2 and why

-No relationship between genome size and organismal complexity C-value paradox Two explanations: Polyploidy Noncoding DNA -1.polyploidy: more than 2 copies of their genome, we have 2 copies one from mom and dad -2. not everything codes for protein

What are polymerase chain reactions used for?

-PCR makes use of the principles of DNA replication -PCR rapidly makes millions of copies of a specific DNA sequence in a few hours by a chain reaction amplification process -used to study DNA -used if want to amplify a specific gene (just one piece of DNA) and make many copies of it to study (to check and see if someone has the mutation for cystic fibrosis for example) -making a copy of a piece of DNA -using DNA polymerase to making a lot of copies

Are plasmids natural in bacteria?

-Plasmids occur naturally in bacteria -Small, circular molecules of DNA distinct from the chromosome -older than PCR, used to have to use tons of bacteria -tricked to grow tons of plasmids that can be altered

Promoter and enhancers or silencers

-Promoter - region of DNA where RNA polymerase binds and begins transcription -Regulatory DNA elements in eukaryotes are called enhancers or silencers. -enhancer turns on gene expression- most time this bc chromatin already turns off -silence turns off

Genes vs Genomes

-Protein-coding sequences constitute about 2.5 % of the human genome, and repeated sequences make up more than 50%. -In prokaryotic cells, usually 90% of the DNA sequences code for a product used by the cell. -repetitive sequences are not coding for proteins

What is the role of regulatory transcription factors?

-Regulatory Transcription Factors Bind Enhancers and Silencers -Enhancer/silencers can be located far from the gene, upstream or downstream or within introns; 5' > 3' orientation and exact location does not matter -not general, regulatory -can function in many locations

How many times does the PCR cycle normally repeat itself

-Repeat cycle 25-40 times -Each round of amplification doubles the number of molecules that have the same sequence as the template duplex. -make two copies in 5' to 3', want many copies so cycle happens many times -every time, 2 copies are produced after 2 cycles, you have 4, so 2 to the n power

What are transposable elements and how are they incorporated in a genome?

-Transposable elements (e.g. LINEs) are parasitic segments of DNA that are capable of moving from one location in a genome to another. Figure 20.5 Transposable Elements Spread within a Genome. -is a promoter is transcriped and translated 2 proteins are made -reverse transcriptase: goes to mRNA and makes DNA copy, integrase will incorporate this new copy somewhere else in 2 copies -insertion can be anywhere *slide 26

Epimutation in plants

-Several SUPERMAN mutant alleles, have NO CHANGE in DNA sequence. What they have is a genetically stable (heritable) increase in DNA methylation at the SUPERMAN gene. -mutant doesn't have carpel, has ton of stamens -inheritable -founds there's a deletion in many, but other DNA sequence is fine. Had changes in methlyation patterns, heavily methylated. Pattern inherited with DNA sequence. Not a mutation (behaves like a mutation, but not DNA passed-epimutation)

Major surprise #3

-The base sequences of human beings and chimpanzees are 98.8% identical. -The leading hypothesis focuses on the importance of regulation of gene expression. -just because we have the same genes, we can use and regulate them in different ways to be more complex and sophisticated

How did the mutant strains express LacZ and LacY even in the absence of lactose?

-The mutant strains express LacZ and LacY even in the absence of lactose. -do another genetic screen finding mutants not in lacz and lacY, (lightbulbs) but in the switch -found mutants where beta galac was made on, like light switch was stuck on all the time -wildtype it was off until lactose was on -what is a broken light switch

How can genes be identified in bacteria and archaea?

-There are no introns in bacteria and archaea, and genes can be identified by highly conserved promoter sequences associated with a distinct ORF. -in bacteria there is a promoter sequence at the beginning with specifc info (simpler than eukaryotes)

Step 2

-Transform plasmid into bacteria Genetic Transformation = genetic alteration in a cell as a result of uptake and expression of foreign genetic material Laboratory technique for efficient transformation is to increase permeability of bacterial cell membrane by chemical treatment or electrical shock

How do you get this in a cell?

-Transformation or microinjection is used to get CRISPR plasmid and repair template into the target cell. (one plasmid will hold each) 1. Plasmid DNA with sequences for CRISPR RNA and Cas9 2. Plasmid containing editing template DNA Cell with target DNA to be edited *picture -these can all be used to genetically modify organisms

Can you see the entire strand?

-We can only "see" the label. --all jumbled in the test tube -can only see the fluorescence and can align neatly by size in electrophoresis -match color to letter bc each has different color fluorescent gel -put reaction products at top, short will go faster, so short will be at the beginning of the 5' end, look at color to determine what letter it is -know colors

Negative regulation of LacZ and LacY

-Wild type LacI, no lactose LacI binds operator and prevents RNA Pol from binding to promoter -Wild type LacI, lactose present lactose prevents LacI from binding to operator, RNA Pol can bind to promoter -LAcI made all the time, can bind to operator and there's no transcription -in second, lactose will bing to lacI, prevent it from binding to the operator, when Pol binds to promoter, will get transcription

Why is decondensed chromatin important?

-allows access to RNA polymerase -when open -can start transcription

Promoter sequences are common to many genes and are bound by the ....

-basal transcription complex -what binds at promoter is not just RNA polymerase, more helper proteins (general transc factors) whole complex is basal trans complex -basal is same at any promoter

How does the sequencing work?

-don't know middle part of template -have all 4 kinds of each dideo and deoxy floating in test tube, fluorescent will show dideo -Polymerase will add nucleotids to 3' end, but 2 types of C, sometimes with incorporate dideooxy or deoxy -if dCTP is added, chain can be elongated, but if ddCTP is added, chain is terminated -End result: synthesis of DNA chains with a range of sizes, each labeled with a fluorescent dye.

What are restriction enzymes?

-endonucleases that cut DNA at specific sequences -Hundreds of restriction enzymes, each cut at a different sequence, often a palindrome = reads the same in either direction -Example: EcoRI - only cuts at a specific 6 bp sequence (GAATTC), between G and A -endonucleases cut somewhere specific in the middle of the sequence -not always palindromic -creates either sticky ends or blunt ends -4 nucleotides sticking out on ecroRI -no sticky ends with ecoRV look at slide 23

How do you creating complementary DNA (cDNA) by reverse transcription of mRNA

-ex. Want a copy of genes with no introns -cDNA can trick bacteria into making human protein so can treat patients (I'm guessing because the bacteria don't have introns?) -when RNA is dif from DNA, can be useful -splicing mRNA adds cap and poly A tail, and takes out introns and splices together extrons, so when DNA is copied, you get an intronless version of the DNA (cDNA)

Genomic imprinting example: Angelman syndrome

-gene that causes mutation looks dif in mother and father -in father the gene is tightly packed and will stay that way, can't be used bc tightly packed when passed on, fine if mom's is normal -mothers gene is loosley packed, when passed on can only be used, which is fine unless it's mutant

Discovering genes involved in lactose metabolism in E. coli Technique used for gene discovery

-genetic screen -Find mutant E. coli that has a defect in a gene necessary for metabolism of lactose. -before they knew what beta galactosidase was -try to find genes by genetic screens -look for mutants that can't digest, then once have mutant we'll know which gene is defective and cannot digest, so therefore is the one that is necessary for metabolism

what are the Genes E. coli needs to utilize lactose

-lacZ (encodes b-Galactosidase) -lacY (encodes Galactoside permease) -permease allows lactose into the cell, once in cell the beta can break it down so needs to be in cell -mutants in lacZ or lacY

2. Modifications of histones

-little tails are modified -chain of amino acid- middle folds up into globuar structure that forms the core of the nucleosome structure, then ends are sticking out (white are the little tails) -most often lysine pos charge- add methyl group/groups, stick actyl group have dif consequences depending on what histine and which lysine you are modifying (inhibiting or activating)

Positive regulation by the activator

-low glucose, high cAMP -high glucose low cAMP -activator protein will bind cAMP near promotor which will help more transcription -not enough cAMP, so no binding low transcription

What is the issue with glucose?

-moving on to how glucose inhibits production and inhibits expression of enzymes

How do we turn genes on and off?

-negative regulation: -normally the repressor is binding to the DNA to keep off -positive regulation: -to turn the protein on, the repressor protein must leave the DNA, and an activator will then bind to turn on

How does this work?

-plate transformed bacteria on plate -select for selectable marker on plasmid -plasmid containing bacterial cells will grow to form "colonies" -when start, cells everywhere, but after ampillicin, everything died except the plasmid so each white dot is a colony of the plasmid containing bacteria

step 3 of PCR

3: Extension -DNA polymerase synthesizes new DNA strands by extending the primers. -DNA Polymerase will go to 3' primer and will start making DNA by adding nucleotides to both strands -now have 2 copies of DNA

How does gel electrophoresis work?

-put all fragments into electrophoresis machine and DNA will go to the positive end because DNA is negatively charges then cut out piece of DNA that you want on the gel -have to separate your piece from the rest of them -cut DNA into many pieces then use electrophoresis to separate the fragments according to their size -smaller will run faster -the take the cut isolated DNA fragment from electrophoresis -cut plasmid, ligase will put back together *look at slide -Now have recombinant plasmid, but needs to get into bacteria

How to perform genetic screening

-slide 6 -will have different mutations, so need to find the mutant that cannot digest lactose and pick it out -can't put it on a plate with lactose, because mutant will die -tons of cells, add some mutagen, then mutations will be random across the cells so need to find a way that the mutant we want is different from the other mutants -we need mutant that can't digest, but not going to be able to survive if lactose is present -instead use replica plating

Practice question -In order to sequence a strand of DNA, all four dNTPs, ddGTP, DNA polymerase and primers are added to a test tube. A template strand of DNA with a primer attached is shown below. How many fragments of different lengths would you have at the end of the sequencing process? 3' TGACTCTAGCCTAGGACTATATCG 5' 5' ACTGA 1 2 3 4 5

-start adding after A and count the G's E dd__TP indicates what letter you're looking for

What are the components needed for PCR

-template DNA, -primers, -abundant supply of the four dNTPs, -Taq DNA polymerase -buffer -dNTP: nucleotides that DNA uses to build the strains -Taq polymerase is the polymerase that can withstand heat

Epigenetic inheritance during mitotic cell divisions

-when make new cells in body, they will need to know what cells they were, patterns that were in old cell must be passed on to new -loosely packed confirmation for the ones you need to transcribe, the ones that don't need to be used will be tightly condensed -will remember which parts of DNA will need to be loosely and tightly watch slide

Shotgun sequencing steps

1. Cut genome into small fragments 2. Sequence each fragment. 3. Assemble sequence -not reading genome from one continuous line how it's done on a computer: Illumina sequencing allows you to get billions of bases on something the size of a microscope slide. -take many pieces of dNA fragments and putting on microscope slide and sequence all -similar to dideoxy sequencing, but those terminating nucleosides will be reversing so it can continue -flush slides with terminating nucleotides, then take picture, then reverse termination and add nucleotide then take picture then do again. By looking at colors at order, you can read the sequence *slide 12 Use sequence overlaps to assembly whole genome sequence - requires heavy computing Then need to assemble fragments and finds sequences that work

Replica-plating to find mutants

1. Plate mutagenized cells 2. "Copy" onto second plate 3. Identify mutant colony -use "stamp" to stick bacteria on the cloth -find which one won't grow on the copy lactose only plate, then come back to the original and pick it out -put on glucose, stamp onto second plate with glucose, see which colony is missing

Overview of Eukaryotic Gene Expression

1. Pre-transcription >> chromatin structure 2. Transcription >> transcription factors 3. Post-transcriptional >> alternative mRNA splicing, editing and stability 4. Translation >> RNA bound proteins, ribosomes 5. Post-translational >> folding, chemical modification, transport, activation, degradation -every step that occurs in prok can be regulated in euk, euk just have additional steps, which can also be regulated

How does glucose regulate the Lac operon?

1. When glucose levels are high, cAMP levels are low. 2. cAMP receptor protein (CRP), aka CAP, binds cAMP 2. cAMP-CRP acts as an activator of the operon -lots of glucose inhibits a smol molecule called cAMP (don't know structure) -CRP and CAP are the same -helping RNA poI bind -cAMP binds to CRP/CAP, changes conformation in a way that both are now able to bind DNA, right next to RNA pol and will help bind to promoter, RNA pol can't do by itself

Repetitive sequences in eukaryotes

1. transposable elements (~45% of the genome) 2. short tandem repeats (~3% of the genome)

3 steps of standard cloning of bacteria

1: Create recombinant plasmid 2: Transform plasmid into bacteria 3: Bacterium will make copies of plasmid -trick bacteria into growing our DNA -purple is recombinant -when bacteria grows, will make copies of plasmid when it divides

Step one of PCR

1: Denaturation -A solution containing double-stranded template DNA is heated to separate the DNA into two individual strands. -PCR based on principals of DNA replication -don't use helicase bc too complicated, just heat to high energy to break the hydrogen bonds between the bases

Step 2 of PCR

2: Annealing -The solution is cooled, and the two primers anneal to their complementary sequence on the DNA template strands. -needs a primer by chemically synthesizing PCR primers that are exactly what we want them to be -DNA will add nucleotides only on the 3' end -annealing (find complementary sequence and make hydrogen bonds with them -DNA polymerase needs a primer, no primase -need to have one primer and one end, and another at the other end, make sure polarities are right

Why is it important that histone proteins are positively charged? A. So the negatively charged phosphate groups on DNA are attracted to them B. So the positively charged phosphate groups on DNA are attracted to them C. So the negatively charged deoxyribose sugars are attracted to them D. So the positively charged deoxyribose sugars are attracted to them

A -sugars aren't charged

Practice question: Mark the following list with "A" if it correlated with gene activation and "I" if it correlates with gene repression.__ histone acetylation__ DNA methylation__ histone methylation__ chromatin remodeling to expose promoter region__ HDAC activity

A B inactivating transcription Either (won't be asked) A B revomes actyl groups

How to sequence the whole genome

A single sequence reaction will yield few hundred- thousand bp of sequence. The human genome contains 3 billion bp. How do we sequence an entire genome? -Shotgun sequencing

Which of the following enzymes can perform reverse transcription (i.e. can make a DNA copy of an RNA)? DNA polymerase RNA polymerase Telomerase Topoisomerase A and B are both correct

A- use DNA to make DNA B- Use DNA to make RNA C- telomerase extends the end of DNA. RNA serves as a template Have RNA to make DNA yes D- can't make any DNA

Practice question. What will be the result of mutation that makes LacI unable to bind lactose? LacZ and LacY will not be transcribed, regardless of lactose levels LacZ and LacY will always be transcribed, regardless of lactose levels LacZ and LacY will be transcribed in the presence of lactose, but not in the absence

A. If can't bind lactose, can't bind to what? can't change conformation to bind to something other than DNA -protein will be stuck on DNA and can't come off

A student cloned a piece of DNA into a plasmid, transformed bacteria with the plasmid, and plated the bacteria on agar plates. The next day, the bacteria completely covered the agar; no individual colonies were seen. What could explain this result? A. The student forgot to add the appropriate antibiotic to their agar plates. B. The student did not use the proper restriction enzymes in their cloning procedure. C. The student forgot to use ligase. D. The cloning plasmid did not have an origin of replication.

A. If don't add, every bacteria will grow If don't have the others, nothing will grow

Which of the following statements is consistent with the results? a. C is the child of A and B. b. B is the child of A and C. c. D is the child of B and C. d. A is the child of B and C.

A. Use lines to cross bc has to come from either one of the parents

Practice question: Praeder-Willi syndrome patients inherit the mutant allele from the father. The same mutation inherited from the mother causes no phenotype. Based on this information, we can conclude that: The paternal allele of this gene is expressed The maternal allele of this gene is expressed Both alleles are expressed Neither allele is expressed

A.Only use copy used from dad, so if mutant bad things

What has the sequence of genomes told us?

Bioinformatics, computational biology, computational genomics, biological data mining, genome annotation (many names for the same idea) can be used to "mine" genomes for information Need computing, mathematical and statistical methods to analyze large data sets

Practice exam question - Full induction of b-galactosidase and permease occurs when: Lactose levels are low and glucose levels are low Lactose levels are low and glucose are high Lactose levels are high and glucose levels are low Lactose levels are high and glucose levels are high C and D are both correct

C

Under which condition(s) does it "make sense" for E. coli to express b-galactosidase and Galactosidase permease? Lactose levels are low and glucose levels are low Lactose levels are low and glucose are high Lactose levels are high and glucose levels are low Lactose levels are high and glucose levels are high C and D are both correct

C. -lactose is spinach, glucose is cake. Will only be eating spinach if cake isn't around

Practice Question: In comparing a nerve cell and a liver cell in the same person, you will find that these cells contain Different chromosomes Different genes Different proteins All of the above

C. Different proteins -DNA is the same,

Which one of the following is a DIFFERENCE between PCR and cellular DNA replication? DNA synthesis in the 3'-5' versus in the 5'-3' direction Need for primers Need for helicase enzyme Need for nucleotides

C. PCR doesn't need helicase, but DNA replication you do

Step one

Cutting and pasting DNA -cut both plasmid and the piece of DNA we want -ligase puts together -restriction enzymes cut

During the extension step of PCR, DNA synthesis takes place in the ... 3'-5' direction on top strand, 5'-3' direction on the bottom strand B. 3'-5' direction on bottom strand, 5'-3' direction on the top strand C. Always in the 3'-5' direction D. Always in the 5'-3' direction

D always

Let 23: Size of genome, multicellularity, and regulation of gene expression?

Eukaryotes have very large genomes Multicellularity implies a need for differentiation = different cells with different functions Regulation of gene expression is the mechanism used during development to accomplish differentiation -prok have smaller genomes, euk will need extra steps -lots of diff cells (muscle cells need dif proteins than skin cells) -lots of cell diversity

Lecture 22: Which levels can gene expression be regulated at?

Gene expression can be regulated at the level of: -transcription efficient, but can be slow -translation -posttranslational fast, but waste energy -gene is transcribed into an RNA then translated into a protein. Any of the steps can be regulated -regulating transcription is very efficient. Won't use it until you need it, but slow; -if quick response is essential, use posttranslational, will waste energy -translation in the middle -most of regulation in proks is done at transcriptional level -sometimes protein needs sometime to function

More proteins without more genes explanation?

One explanation involves the alternative splicing of RNA transcripts. Different proteins can be made from a single gene, depending upon how the RNA transcript is spliced together. -can take a gene and splice it then put back together in many different ways to make many proteins 2. More functions for each protein -Combine proteins into different complexes -Posttranslational modification of proteins to alter function -can put proteins together and partner them with other things to do different function -proteins can be modifed, which will change function

What is an open reading frame (ORF)

ORF = AUG-(codon-codon-codon)n-STOP Number of codons/protein: a few dozen-several hundred -need to look for AUG followed by codons then ends with stop codon

OPERON SUMMARY

Operon: Portion of DNA including a set of genes involved in a specific metabolic pathway Single regulatory region (operator + promoter) Generates single polycistronic RNA Repressor is the product of a separate regulatory gene Repressor binds the operator and blocks RNA polymerase Allosteric regulation of repressor -has coding regions for multiple genes, but only one promoter, operator -whole thing is operon ^ -will be able to make multiple proteins -repressor not on RNA

Let 21: What is DNA sequencing used for?

Sequencing is used to determine the nucleotide sequence of an unknown stretch of DNA, nucleotide by nucleotide. The most widely used method (Sanger sequencing) relies on dideoxynucleotides or ddNTPs, i.e, ddATP, ddTTP, ddGTP and ddCTP . Reaction mix: -template DNA -primer -DNA polymerase -deoxynucleotides -dideoxynucleotides -very similar to PCR -dNTP: deoxynucleotides used to make DNA -ddNTP: dideoxynucleotides

Genomic imprinting in mammals

Some mutations only cause disease when inherited from either the mother or the father. Inheritance of the same mutation from the other parent does not cause disease. Examples: Angelman syndrome Prader-Willi syndrome -most wiped clean when making germ cells, but not all -certain mutations that caused disease only when inherited by one parent

You are using shotgun sequencing to sequence a long strand of DNA. After breaking up the DNA strand, you get these three fragments (all listed 5'-3'). Fragment A CATCGATTC Fragment B TACGGCTAG Fragment C TTCAGTAC Which of the following represents the order of the fragments in the original DNA strand? a. ABC b. ACB c. BCA d. CBA

TTC's are the same -Tac's here B -find sequence at the end of one fragment that is the same as the beginning of another

What is the product of the LacI gene?

The Lac repressor is the product of the LacI gene Lactose binding changes LacI conformation so that it can no longer bind DNA: allosteric regulation Lactose is an inducer. -Active form: Can bind DNA -Inactive form: Cannot bind DNA -serves function of light switch: Lac repressor will bind to operater -when lactase not around, repressor is active -lactose will bind to the protein and change its conformation, so not repressing anymore. Small molecule that binds to the repressor is called the inducer. induce expression by preventing repressor from binding to oporater

Catabolite Repression

The product of the reaction inhibits making more enzyme. -B gal will be enzyme breaking down -if you already have glucose, don't waste energy by making more enzyme b gal to make glucose glucose will stop this

How does the cell regulate the tightness of chromatin packaging?

There are mechanisms eukaryotic cells use to open or close chromatin, including: 1. DNA methylation 2. Modification of histones 3. Chromatin remodeling 1. Modify DNA itself 3. move nucleosomes around themselves

what happens with A lightswitch that cannot be turn off: (2 types)

Type 1: Mutant repressor protein Type 2: Mutant operator (binding site for the repressor) -binding site of DNA or repressor protein itself was broken

Examples of PCR applications

ancient frozen woolly mammoth to study evolutionary relationships fingerprints, tiny amounts of blood, tissue, semen at crime scenes to identify the 'perp' single embryonic cells for prenatal diagnosis of genetic disorders or sex of the baby viral genes from cells to diagnose HIV infection brain of a 7,000 year old mummy to understand human migration patterns rhinoceros DNA in aphrodisiac products uncovering illegal use of horns corpse in Jesse Jame's grave to enable positive identification .......

look at slide 28

lol k

What is the basic unit of chromatin?

the nucleosome -nucleosome: histone proteins plus DNA wrapped around them 2 -fiber you create from having these beads on your DNA is the chromatin fiber (is the chromatin fiber composed of nucleosomes?)

Major surprise 1

there is not a clear increase in gene number as biological complexity increases.