BIO 1A Midterm 2 (Lectures 14-26)
DNA replication occurs in _ to _ direction. We are adding new nucleotides in the _ direction
5' to 3', 3'
Most eukaryotic DNA methylation is _____
5'-CmeG-3'
How long is the completed primer for DNA polymerase to add nucleotides?
5-10 nucleotides long
DNA methylation of cytosine generations _______. This means that at the number __ carbon, there is a ____ placed there
5-methylcytosine. 5, methyl
Rate of elongation is ____ per second in bacteria and ___ per second in human cells
500, 50
Maintenace DNA methyltransferase recognizes the ____ in CG dinucleotides and adds a ___ group to the _____in the CG on the ____ ____ _____
5meC, cystosine, complementary daughter strand
About ___ of human repetitive DNA is made up of transposable elements and sequences related to them
75%
Sequencing of human genome revealed that ____ of it doesn't code for proteins, rRNA, tRNAs
98.5%
Bacteria and _____ typically have ___ condesned chromsomes, which are ____ inside of the ___ and NOT in _____
Archaea, 1-2, free, cytoplasm, organelles
Centromere
Area where the chromatids of a chromosome are attached
What ploidy are the daughter cells after meiosis I and meiosis II? (Hint. Consider n state.)
At the start of metaphase I, the cells are 2n. After meiosis I, cells are n. Cells are n after meiosis II.
If lysine H3K9 is mutated and can't be acetylated, what happens to the resultant chromatin?
Can't be acetylated = can't be euchromatin, has to be heterochromatin
Acetylated means? Can DNAase act?
Acetylated = euchromatin, DNAase can act bc euchromatin has space to allow DNA cut
If amino acid can be acetylated but not methylated, what happens if DNAase is added? Will the DNAse be cut or uncut
Acetylated = euchromatin, DNAase can act bc euchromatin has space to allow DNA cut
Nucleases called __ proteins can identify and cut phage ___ protecting bacterium against phage infection
Cas, DNA
What is the basis of epigenic inheritance?
Chromatin modifications, specifically DNA methylation and histone acetylation/methylation
Chromosomes --> ________ --> _______-
Chromatin, Nucleosomes
How can we prevent passing along mitochondrial disorders?
Chromosomes from egg of affected mother could be transferred into an egg of a healthy donor. This egg can be fertilized by father and transplanted into womb of prospective mother
Chromatids are associated with the amount of ___ aka C. Centromeres are associated with the amount of _____ aka N.
DNA, chromosomes
Proteins bind ___ in bacteria, archaea, viruses, and eukaryotes. The differences are in the _____, ____, ____ formed
DNA, protein, amount, complex
Group 1 and 2 viruses have ___ whether __ ____ or ___ ____ and can use DNA polymerase to replicate and are straightforward with the host.
DNA, single stranded, double stranded
When a phage infects a bacterial cell that has the CRISPR Cas system, the ____ of the invading phage is ____, integrated into the genome between two repeat sequences. If the cell survives the infection, any further attempt by the same type of phage to infect this cell (or its offspring) triggers transcription of the ____ ____ into RNA molecules. These RNAs are cut into pieces and then bound by Cas proteins, such as the Cas9 protein. The Cas protein uses a portion of the phage-related RNA as a homing device to identify the invading phage DNA and ___ ___, leading to its destruction.
DNA, stored, CRISPR region, cut it
Chromatin can be digested by ____ which cleaves aka ____ phosphodiester bonds in DNA
DNAse, hydrolyzes
De novo methylation: In mammals, a speciric DNA methyltransferase called ___ finds an unmethylated CG dinucleotide and methylates it
Dnmt3
Do a pedigree problem, in Worksheet 7, Q6
Done
How does gel electrophoresis work?
Each sample, a mixture of different DNA molecules, is placed in a separate well near one end of a thin slab of agarose gel. The gel is set into a small plastic support and immersed in an aqueous, buffered solution in a tray with electrodes at each end. The current is then turned on, causing the negatively charged DNA molecules to move toward the positive electrode.
In a Gal80 mutant, ___, ___, ____ enzymes are constitutively/always made
Gal1, Gal7, Gal10
When Gal3 binds galactose, it sequesters ____ in the cytoplasm. This prevents Gal80 from binding to ___ and so Gal4 can activate the transcription of ___, ___, ___
Gal80, Gal4, Gal1, Gal7, Gal10
Domestic cats have the sex chromosomes, X and Y, and 18 autosomal pairs. What is the n for gametes and separately for somatic cells?
Gametes: n, 19 chromosomes Somatic: 2n, 38 chromsomes
Multigene families are?
Genes w similar DNA sequences that encode similar proteins that often perform similar but not identical functions
Alterations of chromosome structure example with humans and chimpanzees
Humans have 23 pairs of chromosomes, while chimpanzees have 24. Following the divergence of humans and chimpanzees from a common ancestor, 2 ancestral chromosmes fused in the human line
What kind of bond holds DNA tgt?
Hydrogen bonds
3 mechanisms that contribute to genetic variation in sexual life cycles?
Independent assortment of Chromsomes - crossing over - random fertilization
Difference in transcription in bacteria and archaea vs eukaryotes
Information processing and protein building happen tgt in cytoplasm for bactiera and archaea Compartments separate information processing (transcription) from protein building
Genes that are near each other on the same chromosome deviate from? These genes are?
Law of independent assortment, linekd genes
What happens for proteins encoded in mitochondria
Mitochondria independently perform transcription and translation in lumen. No evidence of crosstalk btwn mitochondria and nuclear envelope transcription and ribosome translation
If nondisjunction happens in Meiosis I what happens? What about Meiosis II?
Meiosis I: n+1, n+1, n-1, n-1 Meiosis II: n+1, n-1, n, n
________ species are predominant in life and eukaryotes diverged from ________.
Microbial, Archaea
Forensic scientists use genotyping of multiple (e.g., 13) STRs using ____ and ___ ______ to develop a genetic profile or “DNA fingerprint” of individuals.
PCR, gel electrophoresis
Genotyping of a SNP can be performed by ___ _____ and sequencing of the DNA region containing the ___
PCR amplification, SNP
miRNA gene is located between what kind of genes?
Protein coding genes
Chromosome structure is maintained by
Proteins
Tobacco mosaic virus encodes an ___ _____ ___ ____ that it uses for replication of its genome. A movement protein facilitates movement of virus from cell to cell via _____. The ___ _____ binds the replicated RNA genome and assembles it into the virus particle
RNA dependent RNA polymerase, plasmodesmata, capsid protein
miRNA is assembled into a ___ ___ ____ ____ where it can base pair with its ____ ____
RNA induced silencing complex, mRNA target
dsRNA vs ssRNA viruses Double-stranded RNA viruses carry their own ____ _____ _____ within their virions. Once inside a cell, the enzymes transcribe one of the RNA strands of the dsRNA genome to ____ _____within the virion, which upon release into the cytoplasm (through channels in the virion) is translated by the host cell machinery.
RNA synthesizing enzymes, positive ssRNA
mRNA
RNA that carries genetic message from DNA to protein synthesizing machinery of cell
There are two key variables used to classify viruses that infect animals: – An ____ or _____ genome, either single-stranded or double-stranded – The presence or absence of a ____ _____
RNA, DNA membraneous envelope
If a virus has a mutation in the ____ or ____ polymerase, it can/can not replicate
RNA, DNA, can not
Cells make several types of ____ all of which are encoded on genomic DNA. Larger RNA transcripts cam be processed into ____ ____
RNA, functional components
RNAi is linked w siRNA and miRNA in what way?
RNAi is a gene silencing process that is triggered by double stranded RNA, which is converted into small interfering RNA. miRNA is a RNAi molecule. miRNA regulates expression of multiple mRNAs while siRNA targets 1 mRNA
CRISPR associated (Cas) proteins process CRISPR transcripts into short ___ that direct __ to cut phage DNA
RNAs, Cas9
Random Fertilization
Random sperm meets w random egg
HIV is a _____ it infects ___ cells needed for our immune response. HIV causes AIDS
Retrovirus, T
Inversion Mutation
Reverses a segment within a chromosome
Deletion Mutation
Removal of a chromosomal segment
The Gal4 binding site is what recruits the ___ _____ and the other ____ _____ to the TATA box upstream which drives the expression of ___
RNA polymerase, transcription factors, mRNA
Transcription factors help guide binding of ___ _____. It also _____ transcription
RNA polymerase. initiates
Structural Annotation of genes can be confirmed by __ _____
RNA sequencing
Noncoding regions in RNA transcripts and euk genes are removed through?
RNA splicing
DNA polymerase I
Removes RNA nucleotides of primer from 5′ end and replaces them with DNA nucleotides added to 3′ end of adjacent fragment
Duplication Mutation
Repeats a chromosomal segment
Why is the antiparallel structure of DNA important in DNA replication?
Replicates leading strand one way and lagging strand the other way
Two types of negative gene regulation
Repressible and inducible operons
If there was a loss of function mutation in the repressor, what would happen to the lac operon?
Repressor = represses transcription, so if the repressor was mutated, transcription would occur continuously EVEN when inducer (lactose) is absent
If lac operon has no glucose and lactose, what happens to? - Repressor bound? - cAMP? -cAMP-CRP bound? - transcription?
Repressor bound? No - cAMP? High -cAMP-CRP bound? Yes - transcription? High
If lac operon has glucose and lactose, what happens to? - Repressor bound? - cAMP? -cAMP-CRP bound? - transcription?
Repressor bound? No - cAMP? Low -cAMP-CRP bound? No - transcription? Low
If lac operon has no glucose and no lactose, what happens to? - Repressor bound? - cAMP? -cAMP-CRP bound? - transcription?
Repressor bound? Yes - cAMP? High -cAMP-CRP bound? Yes - transcription? Low
If lac operon has glucose and no lactose, what happens to? - Repressor bound? - cAMP? -cAMP-CRP bound? - transcription?
Repressor bound? Yes - cAMP? Low -cAMP-CRP bound? No - transcription? Low
Mitochondria and chloroplasts and other plant plastids carry?
Small circular DNA molecules
Over evolutionary time, gene family members diverge and take on ___ _____. Promoters and enhancers upstream evolve to give different ____ patterns
Specialized functions, expression patterns
How do phosphate groups stabilize DNA?
The phosphate group provides structure. Protein DNA ligase fuses sugar phosphate groups of adjcent nucleotides to create DNA backbone. Fusion is phosphodiester bonds
What does replication prior to mitosis and meiosis ensure?
Transmission of genetic info from parent cell to 2 daughter cells
Stop codons
UAA, UAG, UGA
if tRNA anticodon loop codes for AUG, what is the codon sequence for the amino acid it codes?
UAC
Virus
Very small infectious particles consisting of nucleic acid enclosed in a protein coat and, in some cases, a membranous envelope
_______ ________ who has sickle cell disease volunteered for the first attempt to use _______ to treat a genetic disorder in the US
Victoria Gray, CRISPR
Morgan crossed recessive white eyed mutant to WT, what did he see in F1 generation?
WT was dominant
In yeast, the GAL1, GAL7, and GAL10 genes are all under the control of the same transcription factor, GAL4. Which of the genetic manipulations would most effectively prevent the expression of GAL1, GAL7, and GAL10 but not affect the production of the GAL 4 protein? A. Introduce silent mutations to the coding region of GAL4. B. Introduce inhibitory mutations to the TATA box upstream of GAL4. C. Introduce inhibitory mutations to the enhancer sequences found upstream of GAL1, GAL7, GAL10. D. Introduce nonsense mutations to the coding region of GAL.
When Gal80 concentrations go up in cytoplasm, Gal4 activates Gal1,7,10 transcription. If we block Gal 1,7,10 then Gal4 is unaffected. C
How do cells know when glucose is present or absent?
When glucose is absent, cAMP is made
How does one then ensure that a puppy will succeed in competition?
There is no guarantee that a puppy will succeed. Screening puppies after birth, training, and environment are some of the variables that can influence success in competitions.
What is the hypothesis for the evolution of globin genes?
There was an ancestral globin gene and it was duplicated. It had mutations that diverted it from the normal ancestral globin gene (aka had 1 or several SNPs). This results from 2 distinct alleles and further duplications and mutations separates these 2 genes more which has resulted in alpha globin gene family and beta globin gene family
Pleiotropy
a single gene affects more than 1 character think: 1 gene affects hair AND eyes
Transposition
a transposable element moves from one site in a cell's DNA to a different target site by a type of recombination (original and new DNA sites are brought very close together by enzymes and other proteins that bend the DNA), can occur during DNA replication
What is the purpose of Sanger sequencing
determine whether a point mutation/small deletion/duplication is present, gives high quality sequence for long stretches of DNA, allows sequencing of DNA of organisms
DNA sequencing
determining a gene's complete nucleotide sequence
Variation
differences in appearance offspring show from parents and siblings
When mapping SNPs, vertical lines denote the magntiude of _____ between genomes aka every time a ___ is different
differences, letter
Relative concentration of transcription factors in differential amounts that lead to ____ ____ ____
differing cell types
SNPs are associated with genes for ____ since they are located close to those genes on a chromosome
disease
The recombination frequency depends on the _____ btwn genes on a chromosome
distance
SNPs: Nucleotide sequences between species can be _____ but the amino acid sequence can be closer because several codons code for the same ___ ____
divergent, amino acid
Each spacer sequence between the CRISPR repeats corresponded to the ___ from the phage that had infected the cell
dna
Linked genes do/do not assort independently? Unlinked genes do/do not assort independently?
do not, do
Genes on the same chromosome whose alleles are close together do/do not assort independently. They are said to be genetically linked/unlinked
do not, linked
RNA polymerase does/does not need a primer
does not
Do a practice Punnett Square Problem
done
Many eukaryotes but not __ have DNA methylation. For example Drosophila do/do not ahve DNA methylation?
all, do not
Mutations create different versions of genes known as _____. Reshuffling of alleles produces ____ _____. Genetic variation allows for ______ ______ which results in _____
alleles, genetic variation, natural selection, evolution
A small proportion of lactose is converted into an isomer called _____. This isomer induces production of?
allolactose, beta galactosidase
Amino-acyl tRNA synthetases provides specificity in joining ____ _____ to their _____. This is an ____ process and is at the expense of ___ which loses _ phosphate groups becoming AMP
amino acids, tRNAs, endergonic, ATP, 2
Genome wide association study
an approach used in genetics research to associate specific genetic variations with particular diseases.
A plasmid used to express a gene is called?
an expression plasmid
Small portion of primary transcript of miRNA is ____ ____
double stranded
Group 7 viruses
double stranded DNA pararetroviruses that tend to affect plants
Group 3 Viruses have?
double stranded RNA
Agrobacterium tumefaciens
causes crown gall disease, plant sends out a small molecule when in distress and bacteria injects DNA into plant cell to force it to make bacterial genes
Chromatin undergoes changes in packing during?
cell cycle
DNA methylation also occurs in bacteria: ___ ____ ___ (important in distinguishing parent and daughter cell chromosomes) and ___ _____
cell cycle regulation, viral defense
Condensation of DNA is necessary to fit it inside a ___ or ____
cell, virus
The number of ____ represents the number of chromosomes. The ploidy of a cell does/does not change after replication?
centromeres, does not
Missense mutation
change 1 amino acid to another, could have little effect if the new amino acid has propertiies similar to the amino acid it replaces or if the amino acid isn't essential to protein's function
Nonsense mutation
change a codon for an amino acid into a stop codon
Point mutation
changes in a single nucleotide pair of genes - nonsense - missense - silent
Deletion
changes number of DNA bases by removing a piece of DNA
Pathways and transformations of energy and matter: biological systems grow and change by processes determined by ______ ______ _____ and are governed by the laws of _________
chemical transformation pathways, thermodynamics
Histones can undergo chemical modifications that result in changes in
chromatin condesnsation
In a eukaryotic cell, DNA is combined with proteins in a complex called ____ and is densely packed into the ____
chromatin, nucleus
Eukaryotic Gene Expression: 1. Signal goes into _____ where DNA is unpacked 2. Genes are then available for _____ 3. From transcription, ___ _____ occurs. Leads to mRNA in nucleus 4. mRNA is transported to the _____
chromatin, transcription, RNA processing, cytoplasm
Most genomic DNA is packaged into?
chromosomes
For asexual reproduction, the cells that are produced are ____ and haploid cells have __ copy of each chromsome and generally ___ copy of any gene
clonal, 1 1
In asexual reproduction, the cells can have ______. The cells go from ___ to ____ like in mitosis and the chromosome's mass is kept the _____
clonality, 1, 2, same
A plasmid used to clone a foreign gene is called a
cloning vector
Bacterial plasmids are widely used as ___ ___ bc they're readily obtained, easily manipulated, easily introduced to bacterial cells, and once in the bacteria, it multiples rapidly
cloning vector
H3K9 deacetylation is associated w _____ heterochromatin
closed
H3K9 methylation is associated w ____ heterochromatin
closed heterochromatin
The amino acids coded could be different but if it ____ the same, it can be ______
codes, homolgous
As a molecule of mRNA is moved through a ribosome, _____ are translated into amino acids, one by one. The translators, or interpreters, are _____ molecules, each type with a specific anticodon at one end and a corresponding amino acid at the other end. A tRNA adds its ____ ____ cargo to a growing _____ chain when the anticodon _____ _____ to the complementary codon on the mRNA.
codons, tRNA, amino acid, polypeptide, hydrogen bonds
Sex linked diseases
color blindness - hemophilia - duchenne muscular dystrophy
Reverse transcriptase polymerase chain reaction
combines reverse transcription of RNA into DNA (called complementary DNA in this context) and amplifies specific DNA targets using PCR. used to measure amt of a specific RNA.make many copies of a specific genetic sequence for analysis.
Deacetylated K(lysine) 9 R group means that the chromatin is ____ aka _____
compacted, heterochromatin
tRNA's anticodon loop gives the ______ sequence of mRNA
complementary
Precursor molecule
compound that participates in a chemical reaction that produces another compound
siRNAs also function in _________ of chromatin at the centromere
condensation
Nucleoid
condensed chromosome that contains genetic material of prokaryotes, located in cytoplasm
Sequence comparisons of previously unknown genes with known genes in other species may help identify _____ _____ ______ that provide clues about their function
conserved protein domains
Quorum sensing allows bacterial populations to _____ the behavior of all cells in a population in activities that require a given density of cells acting at the same time. One example is formation of a biofilm, an aggregation of bacterial cells attached to a surface by molecules secreted by the cells, but only after the cells have reached a certain density
coordinate
In repressible operons, there is an inactive repressor, which means that no ______ is present
corepressor
The farther 2 genes are, the higher the probability a ____ will occur btwn them
crossover
Transposable elements can provide sites for ____ between nonsister chromatids
crossover
For a RNA virus, once its genome enters the ____, its own __ ____ ___ _____ will cause its own replication. For a DNA virus, it enters the _____ and uses __ ____ to replicate and transcribes mRNA using ___ ____
cytoplasm, RNA dependent RNA polymerase, nucleus, DNA polymerases, RNA polymerases
DNA Methylation
cytosine modified by additional methyl group by methyltransferase enzymes
dATP vs ATP?
dATP has deoxyribose and ATP has ribose
In the cytoplasm, mRNA is _____ and translated into a _____. The polypeptide goes through ____ ____ to become an ____ _____. The active protein is transported to its ____ _____ or _____
degraded, polypeptide, protein processing, active protein, cellular destination, degraded
Unequal crossing over prophase I of meiosis can result in 1 chromosome with a ____ and another one w a ____ in a particular region
deletion, duplication
Nucleotide bases consist of a _______ ____, a _____, and a ____ ____
deoxyribose sugar, nitrogenous base, phosphate
small interfering RNAs (siRNAs) are produced from viral _____. siRNAs are loaded into RISC which targets viral RNAs for _____ or ___ _____. This leads to the direct targeting of viral RNA
double stranded RNAs, degradation, blocking translation
Many bacterial chromosomes are ______, ____ DNA molecules. Some genomes are ____
double stranded, circular, linear
Helicase unwinds the ____ ____ and inserts a ____ ____ RNA into RISC w multiple proteins
double stranded, single stranded
Positive sense mRNA includes
ds DNA, ss DNA, + ss RNA, retrovirus
Transcription factors target _____ ______/change in the sequence of cells and their activity
editing site
Gal4 DNA binding site aka the _____ is upstream of the ____, ____, and ___ genes
enhancer, Gal1, Gal7, Gal 10
A site for translation
entry site for new trna charged w amino acid or amino acyl tRNA
RNA Dependent RNA polymerase's function
enzyme that catalyzes the replication of RNA from an RNA template
Helicases
enzymes that untwist double helix at replication forks
Loosely packed chromatin is
euchromatin
Histone modification can open chromatin up into _____ which is accessible to ____ _____ and ___ _____
euchromatin, transcription factors, RNA polymerase
_________ Promoters signal the transcription start point and usually extend ______ of start point
eukaryote, upstream
Telomeres are only found in?
eukaryotes
Chromatin structure affects _____ gene expression
eukaryotic
In alternative RNA splicing, a primary transcript is made from a _____ ____. This RNA can be processed by alternative splicing to make multiple _____ that are translated to make multiple proteins from _ gene. Alternative splicing is common in _____ cells
eukaryotic gene, mRNAs, 1, mammalian
Initiation of transcription in eukaryotes require a ____ _____, _____ ____ binding to dna and results in ____ _____ ____ forming
eukaryotic promoter, transcription factors, transcription initiation complex
What can we learn from nucleotide sequences
evolutionary history - disease causes - new chemistries - disease transmission and evolution
E site in translation
exit site for tRNA after it's done delivering amino acid
Different ____ code for the different domains of a protein. The presence of introns may facilitate the _____ of new and potentially beneficial proteins as a result of ____ ____
exons, evolution, exon shuffling
Dense packing of heterochromatin makes it difficult for the cell to?
express genetic info coded in these regions
Exons
expressed coding segments, usually translated into amino acids
cAMP bound CRP induces _____
expression
Nondisjunction
failure for homologous chromosomes or sister chromatids to separate normally during nuclear division. leads to abnormal distribution of chromosomes
Sanger sequencing aka dideoxy/chain termination sequencing
first automated procedure of DNA sequencing
Trombone Model: replication machinery exploits the _____ of DNA, allows formation of a ____ on lagging strand. Basically, leading strand is synthesized continuously while the lagging strand and the DNA polymerase on lagging strand synthesizes _____ ______. Then the DNA polymerase falls off and a new sliding clamp is loaded onto DNA polymerase by _____ which allows for the Okazaki fragment/DNA to get _____ ___
flexibility, loop, Okazaki fragments, looping, pushed out
In In situ hybridization, we take DNA probe with ____ ____ and use complementary binding to find mRNA that is present in individual cells. This reveals the ___ of specific nucleic acid sequences on chromsomes, which is crucial for understanding the organization, regulation, and ___ of cells
fluorscent marker, location, function
To synthesize leading strand, DNA polymerase moves ___ the replicaiton fork
toward
Histone post translational modifications can regulate the accessibility of DNA to be ____ or ____
transcribed or replicated
RNA Polymerase II
transcribes genes encoding mRNAs and some noncoding mRNAs
RNA polymerase I
transcribes rRNA genes except 5S rRNA genes
RNA polymerase III
transcribes tRNA, snRNA, and 5S rRna
Gal4 binds to the enhancer upstream of the Gal1, Gal7, Gal10 genes and activates ____
transcription
Hemaglobin components shift during development due to _______ ______
transcription factors
The Gal4 protein is needed for ____ _____ and is a ____ _____
transcription induction, positive regulator
Repressible operon: transcription is usually __ but is inhibited when?
transcription is usually on but can be inhibited when a specific small molecule binds allosterically to regulatory protein
Lac I aka repressor represses ______ in the presence of _____. When the inducer molecule aka ____ is present, does the represor still repress?
transcription, glucose. lactose, no
Gram positive bacteria transform DNA using a _____ complex
transformasome
The plasmid is introduced into bacterial cells by?
transformation
Heredity
transmission of traits from 1 generation to next
________ __________ and other _____ _______ can contribute to the generation of new genes
transposable elements, repetitive sequences
Antiviral drugs help ___ not cure viral infections by inhibiting synthesis of viral ___ and ____ by interfering w viral assembly
treat, RNA, DNA
Trombone Model of DNA replication complex
two molecules of DNA polymerase III work together in a complex, one on each strand, with helicase and other proteins. The lagging strand template DNA loops through the complex, resembling the slide of a trombone.
Why is yeast a good model organism for eukaryotes
unicellular, haploid, can do crosses and test phenotypes in diploid phase - small geenome - collection of knocout mutations in every nonessential gene is available
greater than 50% recombination frequency is
unlinked
LacI
upstream, controls expression of lactose emtabolic genes
Retroviruses
use reverse transcriptase to copy ssRNA genome into dsDNA
Multiplication Rule
used for this and that - only can be used for Independent events (unlinked genes)
DNA polymerase III
uses parental DNA as template, synthesizes new DNA strand by adding nucleotides to an RNA primer or preexisting DNA strand (leading strand)
Restriction modification defense
using restriction enzymes, if a bacteria sees a phage, it will destroy it. bacterial DNA is methylated so that itself is protected by the restriction enzyme
RNA seq purpose
usually making copies of all RNA molecules, would be able to go and see the effects RNA has on gene expression
How do retrotransposons move?
via an RNA intermediate and reverse transcriptase
RNA Dependent RNA polymerase is found in ____ cells and is either ____ ____ or ___ ____
viral, single stranded, double stranded
Quorum sensing can be used for _____ and ______. Gram positive bacteria transform DNA using a _______ complex and import DNA from the outside as _____. When gram positive bacteria are in high concentrations, they can turn on machinery via ____ _____ to eat up DNA
virulence, survivial, transformasome, nutrients, quorum sensing
Tobacco mosaic plant
viruses in plants were discovered in this plant 1. extract sap from plant w tmd 2. passed sap through filter known to trap bacteria 3. rubbed filtered bacteria sap onto healthy plant 4. healthy plant became infected
Pseudogenes
former genes that have accumulated mutations and are nonfunctional
Structure and function: basic units of structure define the ______ of all living things
function
Gel electrophoresis
gel made up of a polymer acts as a molecular sieve to separate nucleic acids or proteins differing in size, electric charge, or other physical properties as they move in an electric field
Reverse genetics
gene --> phenotype starts with an interesting gene and finds out its function and tries to identify its function by studying phenotype of mutants in gene ex: find the gene, figure out its function
Genes are _______ units of _____ that parents transmit to offispring
hereditary, DNA
Epigenetics
heritable changes in phenotype/gene expression that don't involve altertions in the dna SEQUENCE
Closed regions aka ______ with __ H3K9 acetylated histones or with H3K9 ____ histones are ___ to digestion by DNAse
heterchromatin, no, methylated, resistant
DNA methylation is associated w ________ that is not transcribed
heterochromatin
Eukaryotes use proteins called ____ that are responsible for main level of DNA packing in ____ _____
histones, interphase, chromatin
Some archaea have ____ and simplified _____
histones, nucleosomes
Crossing over only occurs in ____ chromosomes
homologous
Meiosis I separates _____ _______ while Meiosis II separates ______ _______
homologous chromosomes, sister chromatids
Functional annotation of genes begins with the comparison of their sequences with genes of known function in other species (esp model organisms) to determine _____
homologs
PCR amplification and sequencing of DNA region containing the SNP can distinguish _____ and _____ for different alleles
homozygotes, heterozygotes
Traditionally, vaccines used double stranded DNA viruses to give the ____ _____ genomic information. With mRNA vaccines, we bring ___ directly to the host cell which allows for the proteins to trigger the immune response to be made without touching the host DNA. There is a non infectious element and shorter manufacturing time
host cells, mRNA
Viruses exist naturally within ___ ____ in complex ecosystems, environmental changes can lead to the emergence of viruses in regions where the virus could not have ___ before, and viruses have implications on ___ and ____
host organisms, spread, health, agriculture
Viral envelopes (derived from membranes of __ cells) surround the ____ of influenza viruses and many other viruses found in animals. These envelopes contain a combination of ___ and ___ cell molecules
host, capsids, viral, host
Base pairing in DNA is due to
hydrogen bonds
DNA cloning produces well defined DNA segments in multiple ___ ____
identical copies
Gene Annotation
identification of protein coding genes within genome sequences in a database
Positive-sense viral RNA is similar to mRNA and thus can be i______ translated by the host cell. Negative-sense viral RNA is complementary to mRNA and thus must be converted to ______ RNA by an RNA-dependent RNA polymerase before translation.
immediately, positive
To analyze RNA expression in 1 or a few genes at a time, we can use __ ___ ____ or __ _____
in situ hybridization, reverse transcription-PCR
Size of genomes has ___ over evolutionary time, with extra genetic material providing material for ___ _____
increased, gene diversification
RNA-sequencing
indicating which of the genes encoded in our DNA are turned on or off and to what extentanalyzes RNA expression of many genes in 1 experiment, examines the quantity and sequences of RNA in a sample using next generation sequencing (method that produces large amounts of sequence)
When allolactose (an ___ molecule) is present at high enough concentration, ____ binds the inducer and is the released from the DNA (due to ____ ______ changes). This allows RNA polymerase to move forward and make ____
inducer, LacI, conformational changes, mRNA
The presence of lactose _____ expression of the lac operon
induces
Sex linked inheritance
inheritance of a certain gene depends on offspring sex
Chromatin modifications (epigentics) can be _____
inherited
In the pathway for tryptophan synthesis, an abundance of tryptophan can both (a) _____ the activity of the first enzyme in the pathway (feedback inhibition), a rapid response, and (b) ____ expression of the genes encoding all subunits of the enzymes in the pathway, a longer-term response.
inhibit, repress
Frameshift mutation can be caused by ____ and ___
insertions, deletions
Key insight from production of human insulin
instead of putting the entire gene for insulin in 1 plasmid, recombinant DNA allows us to make changes to domain A and domain B of insulin separately and express it separately without impacting each other. then can combine them outside of the organism as well as add the disulfide bonds to connect them outside the organism
HIV virus uses an ____ to insert DNA into the host genome as a ____
integrase, provirus
Systems: living systems are _______ and _______
interconnected, interacting
Transcription in Euk vs Bact
intersertion of uracil in mRNA in bacteria
Multicellular eukaryotes have many ______ within genes and a large amount of _______ _______
introns, noncoding DNA
Lac operon becomes activated with lactose, so when there's CRP (which occurs with low glucose), lac operon is/is not expressed?
is
To find SNPs in large numbers of people, it ___ necessary to sequence their DNA; SNPs can be detected by very sensitive microarray assays, ____, or ___.
isn't, RNA-seq, PCR
Histones have many positively charged amino acids (such as ___ and ___) that ____ bind to the negatively charged _____ backbone. This is how DNA gets?
lys, arg, non-covalently, phosphodiester. wrapped around histone proteins to form nucleosomes
In addition to a lytic cycle, some phages have an alternative reproductive mechanism called the ____ cycle.
lysogenic
Viruses cause 2 types of infection: - ____ or ____ - ____ or ____
lytic (bacterial) OR acute (animal) - lysogenic (bacterial) OR latent (animal)
Certain factors determine whether the ___ ____ is induced or the ___ ____ is entered in viruses
lytic cycle, lysogenic cycle
Double stranded RNA molecules matching the sequence of a particular gene are used to silence expression of a gene's ___
mRNA
Each tRNA molecule enables translation of a given ____ codon into a certain amino acid
mRNA
Alternative gene splicing: 1 gene segment can give many different outputs of ____ . This isn't seen in _____ or ____
mRNA, bacteria, archaea
The RNA molecules function as both ____ for synthesis of viral proteins and as ____ for new virus particles released from the cell
mRNA, genomes
Methylation of histone 3 lysine 4 (H3K4) is strongly associated with proper cognition and the formation of new memories. What do you predict to see in mice where the main H3K4 methyltransferases are deleted? A. No change in behavior B. No change in chromosome structure C. More of the chromosome in the euchromatin state D. More of the chromosome in the heterochromatin state E. More methylated H3K4
main methytransferases deleted = demethylated = demethylation is associated w euchromatin = C
Once methylation is established, the pattern of DNA methylation is maintained by another DNA methyltransferase during DNA replication as cells grow and divide. This is called?
maintenance methylation
The first evidence of mobile elements came from Barbara McClintock's breeding experiments w ______
maize
Many organisms exhibit uniparental inheritance of organelle genomes (aka ____ or _____) but it's not strictly ____
mitochondria, chloroplast, maternal
For any SNP that comes out of GWAS, you need to go back and do the _______ _______ such as through RT-PCR to see how the SNP affects _______
molecular work, expression
If a female is heterozygous for a particular gene located on the X chromosome, she'll be a ____ for that character
mosaic
Wild type
most common phenotype in wild
Transposons
move by means of a DNA intermediate and require a transposase enzyme
Retrotransposons
move by means of an RNA intermediate using a reverse transcriptase. Thus, retrotransposons always leave a copy at the original site during transposition
More than half of the genes in animals and plants occur in ____ _____
multigene families
Human alpha and beta globin gene families are ____ _____. This means that they encode similar proteins that perform similar but not identical functions. The alpha globin gene family is on chromosome 16 and codes for ___ and ___ globins while the beta globin family is on chromosome 11 and codes for ___ globins
multigene families, fetus, adult, adult
Knockout mutation
mutate DNA so that it stops gene's expression permanently
The basis of change at the genomic level is ___ which underlies much of genome evolution
mutation
Repeat expansion
mutation that increases number of times short DNA sequence is repeated, causes resulting protein to not function properly
Silent mutation
mutation w no observable effect on phenotype
Evolution: the diversity of life evolved over time by the processes of _____, ______, and _____ ______
mutation, selection, genetic change
methylation =
mute, genes are closed, heterochromatin
Chaperone proteins are needed for the folding of ___ proteins
nascent (protein that is being formed by ribosome before it folds into its active shape)
Group 5 Viruses are
negative single stranded RNA viruses
Gal80 is a ____ regulator and Gal3 is another ____ regulator like Gal4
negative, positive
Gal80 binds to Gal4 and covers the ____ _____ activation domain when galactose is present
negatively charged
Incomplete dominance
neither allele is completely dominant, think black and white cats making a gray cat
Hemizygous
only 1 member of chromosome pair instead of normal 2
Euchromatin is more ____ and accessible for transcription factors and RNA polymerase
open
H3K9 acetylation is associated w _____ heterochromatin
open
Gene annotation is largely an automated process of locating start and stop codons (to define ___ ____ ____), 5’ and 3’ untranslated regions (UTRs), splice sites, etc.
open reading frames
Acetylated K(lysine) 9 R group means that the chromatin is ____ aka _____
open, euchromatin
Genes in Archaea are organized in ____ but genes in eukaryotes rarely are
operons
Plasmodium falciparum
parasite that lives in red blood cells and causes malaria
Conservative model
parental molecule directs synthesis of an entirely new double-stranded molecule, such that after one round of replication, one molecule is conserved as two old strands. We are left w 1 old/parent molecule and 1 new daughter molecule.
A ____ ____ forms with amino acid and ____ at the A site (in the tRNA)
peptide bond, tRNA
Sequence changes may become ____ and passed on to next generation
permanent
Temperate phages
phages capable of both lysogenic and lytic modes
Lysogenic Cycle
phages coexist w host cells and allows replication of phage genome without detroying host
Knocking a gene function out (like using CRISPR Cas 9) can show how ____ is altered
phenotype
Forward genetics
phenotype --> gene what type of phenotype results from a certain gene ex: Mendel, what causes purple flowers vs white
The viral envelope is usually derived from the host cell’s ____ _____ as the viral capsids exit.
plasma membrane
n
ploidy aka pairs of chromosomes
Plants handle ______ better than animals and it is important for diversification
polyplodization
The genes in 1 or more of extra sets from _____ can diverge by accumulating ____
polyploidy, mutations
Group Four viruses are
positive single stranded RNA viruses
Watson and Crick noted that specific base pairing suggested?
possible copying mechanism for genetic material
Punnet squares represent?
potential outcomes from matings
Enzymes in eukaryotic nucleus modify ______ aka RNA processing before genetic messages are dispatched to cytoplasm
pre-mRNA
Repetitive DNA
present in multiple copies in the genome
Maintenance methylation activity is necessary to ___ ____ _____ after every cellular DNA replication cycle. Without the DNA methyltransferase (DNMT), the replication machinery itself would produce daughter strands that are unmethylated and, over time, would lead to passive demethylation.
preseve DNA methylation
Telomeres do not ____ the shortening of DNA molecules, but they do _____ the erosion of genes near the ends of DNA molecules
prevent, postpone
Transduction
process in which bacteriophages carry host DNA from 1 cell to another
Alternative RNA splicing
process that selectively removes introns or exons
Polyadenylation happens when mRNA is _____ and _____. Then, a ____ ___ tail is added
processed, cleaved, poly A
Histone
protein molecule around which DNA is tightly coiled in chromatin (aka clusters of nucleic acids)
Sigma factor
protein needed for initation of transcription in bacteria, enables specific binding of RNA polymerase to gene promoters (homologous to transcription factors in euk)
Capsid
protein shell that encloses the viral genome. made from protein subunits called capsomeres
rRNAs are coated with ____ and are surrounded by _____
proteins, ribosomes
3' of tRNA ____ out and 5' ___
protrudes, doesn't
Prophage vs provirus
provirus remains a permanent resident of host cell
Noncoding DNA found between genes include _______ and ______ _______
pseudogenes and repetitive DNA
RNAi is ___ than CRISPR but is _____
quicker, temporary
Crop engineering is based on ____ _____: using bacteria to move genes inside themselves into the ____ _____. The plant secretes a small molecule which is understood by bacterium. The bacterium makes a small molecule that turns up _____ ______ and attaches to the plant. Then the bacteria shoves in DNA via ____
quorum sensing, crop plant, quorum sensing, plasmid
Examples of multigene families: ___ ___, ___ ___ ____
rDNA arrays, globin gene families
Viral glycoproteins on the envelope bind to specific ____ _____ on the surface of a host cell.
receptor molecules
Researchers can insert DNA into a plasmid to produce a ___ ____ molecule which contains DNA from 2 different sources
recombinant DNA
Unlinked genes may be on different chromosomes, or so far apart on the same chromosome that they are often separated by ______
recombination
What's the relationship btwn crossover and linkage? Crossing over generates ______ between genes located on the same chromosome, and thus reduces the amount of _____.
recombination, linkage
siRNAs in a RISC-like complex are involved in _______ ______ ______ to the centromeric repeats, leads to ________
recruiting histone methyltransferases, heterochromatin
Inducer
regulates on and off of operon
activator proteins
regulator protein that turns genes on when DNA binds
Repressor proteins are encoded for by _____ _____. These genes are expressed ______ so that the cell always has a supply of repressor molecules on hand and allow repressor proteins to bind DNA
regulatory genes, continuously
Topoisomerase
relieves strain of twisting of double helix by breaking, swiveling, and rejoining DNA strands
Mismatch repair
repair enzymes replace incorrectly paired nucleotides that have evaded proofreading process
Nucleotide-pair substitution
replacement of 1 nucleotide and its partner w another pair of nucleotides
Leading strand
replicating strand going from 5' (tail) to 3' (head)
Mutations are fixed permanently through ____ and ______
replication, transmission
Gametes: - are _______ cells aka _____ and _____. they pass _____ between generations - produced by? - are _____ aka __ copy of a gene/__ chromsome - n is?
reproductive, sperm, egg, genes meiosis haploid, 1, 1 1n
Once you have a reference genome for a species, you can do _____ of different individuals to gain insights into ____ ______ – in humans, this could enable advances in personalized medicine.
resequencing, genetic variation
Interphase chromsomes occupy specific ______ regions of the nucleus. This is so that the fibers of different chromosmes do not get _____
restricted, entangled
Group 6 viruses are
retroviruses, such as HIV (have a special type of positive strand RNA that comes with its own replication machinery)
What's the advantage retroviruses have by using reverse transcriptase
reverse transcriptase makes viral RNA genome less susceptible to degradation by RNA degrading enzymes
Viruses in the reverse transcriptase family need the enzyme ___ ____ to first make the positive strand ___ into a duplex with DNA
reverse transcriptase, mRNA
Dicer is a _____ that cleaves both strands and generates a 22 base pair ____ ____ which is exported to the ____
ribonuclease, double stranded RNA, cytoplasm
_____ ______ induce formation of heterochromatin to silence transposable elements in animals and plants
small RNAs
Corepressor
small molecule that cooperates w repressor protein to switch an operon off
Histones
small positively charged proteins that bind DNA
Plasmids
small, circular, DNA molecules that replicate separately from bacterial chromosome
In animals, there are 2 major cell types: _____ and _____
somatic, gametes
Telomeres
special nucleotide sequences w multiple repetitions of 1 short nucleotide sequence
Once causation is found, treatments _______ to a DNA mutation can be developed
specific
De novo methylation
specific DNA methyltransferase finds an unmethylated CG dinucleotide and methylates it
Sequence specific DNA binding proteins: each base pair has a _____ _____ and ____ ______. Different DNA sequences have different shapes and charge distributions. DNA binding proteins have distinct shapes determined by ____ ____ _____. Only when ____ and ____ are complementary we get specific and tight bonding
specific shape, charge distribution, amino acid sequences, shapes, charges
Regulatory proteins in different domains of life are similar: need to have ____ of binding w DNA and ____ in gene control. Gene control in these 3 domains are always in _ of start sequence of gene
specificity, flexbility, 5'
SARS CoV coronavirus contains ___ ____ that binds to host
spike proteins
For SARS-CoV-2, the genes that encode the ___ ____ have the highest magnitude of differences between genomes found through mapping ___
spike proteins, SNPs
RNA of spliceosome also catalyzes
splicing reaction
During interphase, a few regions of chromatin (the _____ and _____) are highly condensed into ______
telomeres, centromeres, heterochromatin
Since 2 strands of DNA are complementary, each strand acts as a ____ for building a new strand in replication. This results in?
template, 2 exact replicas of the parental molecule
Promoters signal transcription ____ ____ and extend several dozen nucleotide pairs ____ of start point
start point, upstream
What constitutes an operon?
stretch of DNA required for a pathway (includes operator, promoter, and genes they control)
Transposable elements
stretches of DNA that can move from one location to another within the genome in both euk and prokaryotes
What's the purpose of plasmid cloning?
studying structure, function, evolution of genes. plasmids are used as vectors for the purpose of replication
DNA has a ____ ____ backbond
sugar phosphate
Each new nucleotide (which consists of a ____ attached to a ___ and __ phosphate groups) binds to its complementary base
sugar, base, 3
In a bacterial or archaeal cell, circular DNA is _____ and in the _____. The condensed chromosome is called a ____
supercoiled, cytoplasm, nucleoid
Variations from an organism's mutation can persist if the organism ____ and ____. This way genes w novel functions can evolve
survives, reproducing
Both DNA strands are methylated ____. This means that 5' end must have a ___ methylated and the 3' should have a __ unmethylated 5’-ACCTCGGCAATCC-3’ 3’-TGGAGCCGTTAGG-5’ C -methylated C - unmethylated
symmetrically, C, G
The steady state of an mRNA is determined by its rate of _____ aka transcription and processing and rate of _____
synthesis, degradation
P site in translation
tRNA w growing polypeptide and methionine
What is the connection btwn plasmodium and sickle cell disease
those homozygous w sickle cell disease gene don't allow the parasite to interact with the actin while those heterozygous only allow some remodeling of the parasite (aka the parasite is still sort of there). those without the sickle cell gene have the parasite adhering to cell surface and actin filaments
Enhancers can be _____ of base pairs away from core promoter
thousands
When lactose is not available, the lac repressor binds ____ to operator
tightly, this prevents transcription by RNA polymerase
Negative sense mRNA includes
- ssRNA, dsRNA
True or false, eukaryotic genomes tend to be larger
TRUE
True or false, viral genomes are more similar to bacteria
TRUE
RNA-dependent RNA polymerase is one target unique to _______ ______ _______ and ____ viruses
(+/-) ssRNA viruses and dsRNA viruses
Wild type is denoated by a
+
Telophase I and Cytokinesis
- Cytokinesis = division of cytoplasm, forms 2 haploid daughter cells - Clevage furrow forms in animal cells, cell plate forms in plant cells - No chromosome duplication occurs btwn Meiosis I and Meiosis II
Why choose fruit flies?
- short generation time - lots of offspring - mating can be controlled - 4 chromosomes, can be seen w microscope - wild type has been isolated from mutants
Metaphase I
- Homologous chromosomes arrange at metaphse plate - Independent assortment - both chromatids of 1 homolog attached to kinetochore microtubule from 1 pole and other homolog attached to microtubules from opposite pole
How do we use genetics to understand populations?
- Model systems - linkage mapping (seeing how close 2 genes are) - genome wide association studies - analysis of short tandem repeats or single nucleotide polymorphisms
Three processes contribute to emergence of new viral diseases
- RNA viruses have high rate of mutation - disease and be spread fast - about 3/4 of new human diseases originate from spreading from animals
Sanger sequencing Points
- specific DNA primers + DNA polymerase - allows for highly accurate analysis of DNA sequences - reads are usually 700-1500 bp - used for confirming a gene sequence
DNA regulation is shared across life, what are some principles that are shared
- condensation and relaxation of chromosme - looping of DNA - DNA proteins working w other proteins - regulation of expression (trancription) is encoded in 5' sequences - mRNA is in steady state of stability or degradation - differences in level of contro
Independent assortment
- alleles for 2 different genes are independent - 1 allele doesn't influence the other allele received for another gene
Metaphase II
- chromsomes positioned at metaphse plate - two sister chromatids at each chromsome aren't identical bc of crossing over in meiosis I - Kinectochores of sister chromatids attached to microtubules extending from opposite poles
Therapeutic approaches to sickle cell disease and beta-thalassemia + effects
- gene addition (using viral vectors and hematopoietic stem cells, results are inconsistent - gene correction (some preliminary success w CRISPR but efficiency is a hurdle bc not all of the cells get edited properly) - induction of HbF (fetal hemaglobin), works HbF can replace HbS (sickle hemoglobin) and prevent sickling HbF can replace low HbA (adult hemoglobin) level in beta thalassemia (blood disorder that results in low production of hemoglobin)
X inactivation in female mammals
- inactive X condenses into Barr body - 1 of 2 X chromosomes in each cell is randomly inactivated bc having both causes disorders
Telophase II and Cytokinesis
- nuclei form - chromsomes decondense - cytokinesis occurs - results in 4 daughter cells w haploid chromsomes - 4 daughter cells are genetically distinct from each other and parents
Insertion sequence
- part of transposons, are used to insert into genomes, contains a transposase gene, flanked by short inverted repeat sequences - are targets for the transposase enzyme
Epistasis
- phenotypic expression of 1 gene affects another - think: if someone has green eyes, they must have black hair
What are the 2 types of eukaryotic transposable elements?
- transposons - retrotransposons
How do transposons move?
- via a DNA intermediate and a transposon enzyme - other transposons move by a copy paste mechanism
GWAS requirements
-large sample size, statistical analysis - illustrates polygenic inheritance most - loci identified can be as small as 10 kb to 100 kb - associated SNPs aren't necessarily causative mutations - rare and low freq variants can have moderate to large effects on polygenic characters
Sister chromatids vs homologous/nonsister chromatids
1 homologous chromosome has 2 sister chromatids
1 map unit =
1% recombination frequency
Origin of replication in E. coli: the circular chromosome of E. coli and other bacteria has ___ origin of replication. The parental strands separate there, forming a replication bubble with ___ ____ (red arrows). Replication proceeds in both directions until the forks ___ on the other side, resulting in ____ _____ ____ ______.
1, two forks, meet, 2 daughter DNA molecules
Punnett squares are ideal for __ to __ alleles and ____ alleles. Any other, use probabilities
1,2, unlinked
Lytic Cycle Steps
1. Attatchment: phage uses tail fibers to bind to specific surface proteins on a host cell 2. Entry of phage DNA and degradation of host DNA, phage injects DNA into cell and leaves an empty capsid outside and the cell's DNA is hydrolyzed 3. Synthesis of viral genomes and proteins: phage DNA directs production of phage proteins and copies phage genome 4. Self assembly: Three sets of proteins self assemble to form phage heads, tails, tail fibers 5. Release: phage directs production of enzyme that damages host cell wall and allows fluid to enter. The cell swells and bursts, releasing phages
Knocking Out or Gene Editing Using CRISPR Cas 9
1. Cas 9 protein and guide RNA engineered to guide Cas 9 protein to a target gene to turn off, bind and are introduced to a cell 2. In the nucleus, the complementary sequence of the guide RNA binds to part of the target gene that is wanted to be turned off 3. Active sites of the Cas9 protein target the gene and cut the DNA on both strands and change the nucleotides in it 4. The broken strands of DNA result in 2 ways: - knock out (disable the target gene and repair enzymes insert/delete random nucelotides making the gene nonfunctional). scientists can study its normal function once it got knocked out - if target gene has a mutation (it can be repaired by providing a normal copy of gene, repair enzymes use the normal gene as a template and synthesize correct sequence)
Chagraff's Rules
1. DNA base composition varies btwn specieis 2. in any species number of A and T bases equal and C and G bases equal
Steps in binary fission
1. Replication of circular prokaryotic chromosome begins at the origin of replication and continues in both directions at once (this leads to cell elongation) 2. Cell elongates and proteins migrate to the midpoint of cell. 3. Duplicated chromosomes separate and move away from each other toward opposite ends of cell. Cleavage furrow forms 4. Septum forms and plasma membrane and cell wall forms between the 1 cell splitting into 2 5. After septum forms, cell pinches into 2 = 2 daughter cells. proteins are dispersed throughout cytoplasm
Lysogenic Cycle Steps
1. Daughter cell has a prophage (viral DNA) 2. Prophage codes for protein that prevents transcription of other prophage genes 3. Phage genome is mostly silent so it remains undetected 4. Cell divisions produce large population of bacteria infected w the prophage 5. Viruses propagate without killing host cells 6. If induced in a temperate phage, the phages will change from lysogenic to lytic mode
Amplification of DNA using PCR General Steps
1. Denaturation (melt DNA strands apart) 2. Annealing (ssDNA primer aneals to part of template DNA, cool to allow primers to form H bonds at ends of target sequence) 3. extension (using a thermostable DNA polymerase Taq or Pfu, DNA polymerase adds nucleotides to 3' end of each primer), cycle 1 yields 2 molecules 4. Cycle 2 yields 4 molecules 5. Cycle 3 (2 of the 8 molecules) match the target sequence and are the right length 6. After 30 more cycles, over 1 billion molecules (10^9) match the target sequence
Crossing over steps
1. During prophase I, 2 homologous pairs associate and are held tgt loosely 2. The synaptonemal complex holds 1 homologous pair to another tightly 3. Synapsis aka fusion and crossing over occurs and the DNA breaks are closed up. Each broken strand is joined to a corresponding segment of nonsister chromatid = crossover 4. Synaptonemal complex disassembles, homologs move slightly apart but remain attached bc of sister chromatid cohesion
Termination of Translation
1. Elongation continues until a stop codon is reached in the A site and sensed by release facotr 2. Release factor promotes hydrolysis which frees the polypeptide and tRNA in P site 3. Polypeptide is released from ribosome and Ribosomal subunits and other components dissociate due to input of GTP
Initiation in Euk
1. Eukaryotic promoter (includes a TATA box about 25 nucleotides upstream from transcriptional start point) 2. Several transcription factors, one recognizing TATA box binds to DNA before RNA polymerase II can bind in the correct way 3. Additional transcription factors bind to DNA along w RNA polymerase II 4. RNA polymerase II unwinds DNA double helix, RNA synthesis beginsat start point on template strand
Sanger Sequence Steps
1. Extract piece of DNA to sequence, heat it to get DNA to unwind into single strands 2. lower temperature and add a DNA primer to begin sequencing 3. raise temperature slightly add free nucleotides and DNA polymerase which builds a complementary DNA strand 4. 4 different sequencing reactions need to take place (1 for each of the 4 different nucleotides, to do this, chain terminating versions of the nucleotides are added to the mix of free nucleotides and labeled with a different color dye) 5. when DNA polymerase reaches a chain terminating nucleotide, it stops DNA sequence it was building and DNA polymerase adds modified nucleotides randomly = sequences of DNA of diff lengths are produced 6. DNA segments undergo gel electrophoresis
Recombination frequency steps
1. Find parental types (the highest number results) 2. Add up the recombinants 3. divide by total offspring 4. times by 100%
Meselson and Stahl's Semiconservative Model Experiment
1. Grew E. coli in medium w heavy isotope of nitrogen (N15) 2. bacteria used N15 to synthesize new biological molecules 3. After generations of growing in N15, nitrogenous bases of this bacteria's DNA were labeled w N15 4. After switching bacteria to a medium w a light N14 isotope and allowed it to grow for generations, expected that DNA made after switch would have to be made up of N14 since that's the only nitrogen available for DNA synthesis 5. Used density gradient centrifguation (separates DNA molecules into bands) which showed that there was DNA that was between N15 and N14, which shows hybrid
HIV Replication Steps
1. HIV infects T helper cells 2. Virus fuses w host cell's plasma membrane 3. Caspid proteins are removed, which releases viral proteins, RNA, and reverse transcriptase 4. Reverse transcriptase catalyzes the synthesis of a DNA strand, using the viral RNA as a template then hydrolyzing it 5. Reverse transcriptase catalyzes the synthesis of a second DNA strand complementary to the first 6. ds DNA is incorporated as a provirus into the cell's DNA 7. Proviral genes are transcribed into RNA molecules, which serve as genomes for progeny viruses as mRNAs for translation into viral protein 8. Viral envelope glycoproteins are made in the ER 9. Viral capsid proteins and reverse transcriptase are made in the cytosol 10. Vesicles transport the glycoproteins to the cell's plasma membrane 11. Capsids are assembled around viral genomes and reverse transcriptase molecules 12. New viruses, w viral envelope glycoproteins bud off of host cell
Maintenance of Histone Modifications Steps
1. Histones first removed by helicase then recycled back to parental strand 2. Reader and writer coupled act on new histones and methylate them as well as help assemble new nucleosomes on daughter strand 3. This is how we pass on methylation events during DNA replication
CRISPR Cas System General Steps
1. Infection by phage triggers transcription of the CRISPR region of bacterial DNA 2. RNA transcript that is complementary to DNA of invading phage previously stored in the bacterial DNA is processed into short RNA strands 3. Each short RNA strand binds to a Cas protein forming a complex 4. Complementary RNA binds to DNA and Cas protein cuts the phage DNA 5. Phage DNA can no longer replicate
Generalized Transduction Steps
1. Viral capsid made and infects host cell 2. DNA is packaged into capsid heads, some capsids package host DNA/pick up portion of host's genome 3. New phage assembly is complete with some capsids with host DNA 4. Cell lyses and phage is released 5. If DNA of phage matches the new host cell, it can be integrated and part of the host
How was insulin made from plasmids/recombinant dna?
1. Insulin human DNA (2 polypeptides) inserted into plasmid 2. Plasmid returned to bacteria 3. Recombinant bacteria (recombinant bc it has the plasmid w human DNA) produces the 2 human insulin polypeptides separately 4. Make fusion proteins and then purify, chemical reaction happens where the insulin polypeptide is removed from beta gal 4. Insulin can be harvested when the 2 polypeptides for functional insulin are combined
What are some reasons why Mendel was successful?
1. Methodical 2. Integrated multiple fields 3. Tested a null hypothesis that was well defined (blending) 4. Chose right model system (pea plants have gametes that can be separated) 5. Chose right traits that could be studied (separate and readily identifiable)
Transcription is conserved on the _ major branches of life, last common ancesotr had ___ _____ style of making mRNA
3, RNA polymerase
DNA Replication Steps
1. Origin of replication on specific area of molecule. Origin of replication denotes area of active replication aka replication fork 2. Helicase separates DNA strands of the double helix 3. Single stranded binding proteins stabilize the newly single stranded regions 4. Topoisomerase makes sure that the double stranded areas outisde of replication fork do not super coil 5. Before DNA polymerase can add new nucleotides, short sequences of RNA aka primers have to be inserted by primase at the 5' end to let DNA polymerase know where to add nucleotides 6. Once replication fork is stable, DNA polymerase catalyzes addition of new nucleotides to growing daughter strand. 7. Continuous and discontinous synthesis occurs at same time. 8. Continuous occurs on the 3' to 5' parent strand/leading strand (above). New nucleotides are added from 3' OH end and move towards replication fork (going 5' to 3') 9. Discontinuous synthesis occurs on lagging strand/5' to 3' parent strand. It is completed in Okazaki fragments. Primers are added by primase ahead of the lagging strand at 3'. DNA polymerase III adds nucleotides/Okazaki fragments to primer. DNA polymerase I replaces primers w DNA nucleotides. DNA ligase used to ensure bonding btwn fragments and replaced nucleotides (seals nicks) 10. Once leading and lagging strands complete replication, we have 2 identical copies of DNA molecules result
Replication of a positive strand RNA virus Steps
1. RNA dependent RNA polymerase needed for replication 2. Positive strand mRNA virus has to have a negative strand sense made 3. from that duplex, a new positive strand mRNA virus is made 4. the genomic RNA is released back to the cytoplasm and then encapsulated again through the plasmodesmata or egress
General Transcription Steps
1. RNA polymerase binds to promoter 2. Initiation: RNA polymerase unwinds DNA strands and initiates RNA synthesis at start point on template strand 3. Elongation: Polymerase moves downstream, unwinds DNA and elongates RNA transcript 5' to 3' 4. After transcription occurs, DNA strands reform a double helix 5. Termination: eventually the RNA transcript is released, polymerase detatches from DNA
Initiation in Bacteria
1. RNA polymerase holoenzyme (RNAP + sigma factor) scans DNA for promoter sequences 2. Binding to promoter sequence forms closed complex 3. RNA polymerase unwinds DNA and beings transcribing RNA from rNTPs 4. sigma factor leaves complex, only there to find initiation binding site
Elongation
1. RNA polymerase moves along DNA, untwists double helix which exposes 10-20 DNA nucleotides at a time to pair w RNA nucleotides 2. RNA polymerase adds nucleotides to 3' end of growing RNA molecule as it moves along double helix as bases pair up 3. As transcription proceeds, newly synthesized RNA molecule behind RNA polymerase peels away from DNA template and DNA double helix reforms 4. Trancription progresses at a rate of 40 nucleotides per sec in euk 5. Single gene can be transcribed simultaneously by several molecules of RNA polymerase
Replication Cycle of positive sense ssRNA virus like TMV)
1. RNA virus enters cell 2. capsid gets uncoated 3. release of positive strand RNA virus 4. positive strand RNA virus translated by ribosomes and is replicated by RNA dependent RNA polymerase 5. RNA dependent RNA polymerase gets packaged w the virus and capsid is assembled around it
Plasmid Cloning Steps
1. Take gene of interest from cell, pull it out by PCR or a restriction enzyme (cut genes that aren't of interest) 2. Take gene of interest from organism and put it into a plasmid and move it into another organism (this is recombinant DNA since it cuts and pastes DNA sequences of interest tgt) 3. The bacterium will continue to make plasmids as long as DNA is there 4. We can make a protein from the plasmid and analyze it
General Viral Replicative Cycle Steps
1. Virus enters cell and is uncoated, releases viral DNA and capsid proteins 2. Host enzymes replicate viral genome 3. Host enzymes transcribe viral genome into viral mRNA, Viral mRNA is used by host ribosomes to make more capsid proteins 4. Viral genomes and capsid proteins self assemble into new virus particles which exit the cell
After DNA polymerase __ forms an Okazaki fragment, DNA polymerase _ replaces the ___ _____ with ___ _____. DNA ligase then joins the final nucleotide of this replacement DNA segment to the ___ DNA ____ of the adjacent Okazaki fragment.
3, 1, RNA primers, DNA primers, first, nucleotide
Reverse transcriptase PCR sTEPS
1. Turns sample sets of mRNAs into double stranded DNAs 2. Enzyme reverse transcriptase (from a retrovirus) synthesizes a complementary DNA copy (aka a reverse transcript) of each mRNA in sample 3. mRNA is degraded by the addition of a specific enzyme. The second DNA strand complementary to the first is synthesized by the DNA polymerase to become cDNA 4. PCR occurs and amplifies the mRNA from the gene studied, this shows whether the mRNA is present
Mendel's Model: 4 Concepts
1. alternative versions of genes account for variation in inheritance 2. each organism inherits 2 alleles for each character (one from each parent) 3. If 2 alleles at locus differ, the dominant one determines phenotype 4. law of segregation
Consequences of lack of compartments in transcription for bacteria and archaea
1. concurrent transcription and translation limits expression controls 2. less complexity in bacterial mRNA
Depending on the type of RNA siliencing complex, what could happen? - When bases are more complementary vs less)
1. enzyme in RISC complex cleaves mRNA (bases more complementary 2. RISC complex blocks ribosomes from translating mRNA (bases less complementary)
Modifications of eukaryotic transcription share what 3 functions?
1. facilitate export of mRNA to cytoplasm 2. protect mRNA from hydrolytic enzymes 3. help ribosomes attach to 5' end
How to solve nontemplate strand to resulting transcript question?
1. get the template strand 2. then transcribe it (include uracil)
2 diifferences in euk and bacteria in transcription
1. initiation (bacteria doesn't have a TATA box and uses RNA holoenzyme while euk has TATA box and uses transcription factors) 2. termination (bacteria polymerase stops bc of terminator but in euk it's bc of RNA polymerase II's polyA signal sequence)
3 stages of transcription
1. initiation 2. elongation 3. termination
Initiation of Translation
1. mRNA, tRNA, and 2 subunits of a ribosome are brought together 2. Small ribosomal subunit binds to both mRNA and tRNA. the tRNA carries the amino acid methionine - (in bacteria the small subunit can bind to mRNA and tRNA in either order and it binds mRNA at a specific RNA sequence upstream of start codon) - (in euk: small subunit w initiator tRNA already bound binds to the 5' cap of mRNA and then scans downstream along mRNA until it reaches start codon) 3. tRNA is bound to mRNA through catalysis of GTP, brings large ribosomal unit to mRNA (aka completing the translation initation complex through initiation factors that bring them tgt) 4. At completion of initiation, initiator tRNA sits in P site of ribosome and the A site isready for next aminoacyl tRNA
Steps of miRNA regulating protein expression
1. miRNA coded for by RNAP II (exclusive to eukaryotes) 2. mRNA processed by Dicer 3. SS mRNA fed into RISC 4. RISC binds to mRNA through complementary base pairing 5. When bound, RISC either cleaves mRNA or blocks ribosome from translation - less complementary blocks translation - more complementary: cleaves mRNA
Elongation in Translation
1. new tRNA carrying an AA enters A site of ribosome 2. on ribosome, the anticodon of the incoming tRNA is matched against the mRNA codon positioned in the A site 3. during this proof reading, tRNA w incorrect anticodons are rejected and replaced w new tRNA that are checked again 4. when the right aminoacyl-tRNA enters the A site, a peptide bond is made w the 2 now adjacent amino acids (1 aminoacyl-tRNA that has just entered the A site and the amino acid in P site) 5. as peptide bond is formed, tRNA in P site releases the amino acids onto the tRNA in the A site and becomes empty 6. at the same time, the ribosome moves 1 triplet forward on mRNA, as a result the empty site is now the A site and is ready to accept a new tRNA
Metagenomics Steps
1. obtain sample from a microbial community 2. DNA extraction (fragments generated by restriction enzymes/mechanical methods) 3. Metagenomic sequencing libraries (library of recombinant vectors) 5. Sequencing (insights into taxonomic assignation and functional assignation) 4. Single read analysis, sequencing data from 1 end 6. dissect and analyze genes and grouping them/binning them into individual genomes
Coronavirus (positive strand RNA virus) entry, replication, exit
1. occurs in cytoplasm 2. binds to receptor 3. uncoats 4. unloads viral genome which is translated by host cell 5. viral genome processed into multiple mRNAs that encode for different proteins 6. repackages self after replication and spreads
Cytosine forms __ H bonds w Guanine. Adenine forms __ H bonds w Thymine
3, 2
How would cloning a dog work?
1. soft tissue taken from dog 2. using a fertilized egg from a donor where the original DNA is removed, insert the dog that is supposed to be cloned's DNA 3. Place egg in surrogate
Telomeres: 2 protective functions
1. specific proteins associated w telomeric DNA prevent staggered ends of daughter molecule from activating cell's systems for monitoring DNA damage 2. telomeric DNA acts as a buffer zone, provides protection against organism's genes shortening
How to do a gut microbiome test
1. take fecal sample and pop open the cells in it 2. use whole genome shot gun which shows that there's several organisms living tgt in the sample 3. sequence the DNA (metagenomics) and this data is computationally heavy so after sequencing it, it has to be separated based on function or type present
Rare individuals have __ to __ HbF as heterozygotes. This is due to deletions within the ________ gene cluster and ____ and ___ _____ in the gamma globin gene promoter. This was found through a _______ study
10-30, Beta globins, SNPs, small deletions, GWAS
Human Genome Project
1990-2003, ~3.1 billion base pairs genome was completed using sequencing machines
Group 1 Group 2 Group 3 Group 4 Group 5 Group 6 Group 7
1: ds DNA 2: ss DNA 3: ds RNA 4: + ssRNA 5: - ssRNA 6: retrovirus (makes dsDNA) 7: ds pararetovirus
RNA polymerase 1 vs 2
1: transcribes rRNA genes, used to bind to a promoter sequence at the beginning of a gene and uses DNA strands as a template to make complementary RNA molecule for bacteria 2. transcribes mRNA genes, transcription factors bind onto it, lacks ability to start transcription, elongates RNA strand and creates polyA signal for termination
At the end of Meiosis I, the cells are ___. Only at the end of Meiosis II the cells are __
1n, 1n
Law of segregation
2 alleles for a heritable character separate during gamete formation and end up in different gametes
Codominance
2 dominant alleles affect phenotype in separate distinguishable ways think: black and white cat making a cat with white and black splotches
___ chromatids make up __ chromosome
2, 1
For a recessive X linked trait to be expressed, a female needs __ copies of the allele aka _____ and a male needs ___ copy/copies of the allele aka ____
2, homozygous, 1, hemizygous
As each monomer joins DNA strand via a dehydration reaction, it loses __ phosphate groups as a molecule of ______
2, pyrophosphate
DNA polymerase III starts DNA synthesis at __ end of primer and continues in ___ to __ direction
3', 5' to 3'
Viruses have between __ to ____ genes in their genome.
3, 2,000
DNA polymerase catalyzes addition of nucleotide to 3' end of a growing DNA strand and releases _ phosphates (aka ______) through a _____ reaction. Subsequent _____ of the pyrophosphate to 2 molecules of inorganic phosphate is a coupled ____ reaction that helps drive the ____ ____.
2, pyrophosphate, condensation, hydrolysis, exergonic, polymerization reaction
For humans, haploid number of chromsomes is ___. This means that humans have ___ autosomes and __ sex chromsome
23, 22, 1
When sigma factor scan along DNA and gets to a series of nucleotides spaced ___ nucleotides apart, it stops and ____ which results in DNA _____ which results in RNA polymerase being _____
25, binds, bending, recruited
Somatic rice cells have 12 pairs of homologous chromosomes. Members of each pair are genetically different. Ignoring possible crossing over, how many genetically different rice gametes are generated by independent assortment of homologous chromosomes in meiosis? A. 2^12 B. 12 C. 2^24 D. 12^2 E. 24
2^n, 2^12 A
What formula to use for number of combinations possible for independent assortment of chromsomes into gametes?
2^n, where n is the haploid number
DNA polymerase _ synthesizes leading strand
3
During transcription and elongation, nucleotides are added to the _ ends of the growing RNA molecule
3'
E. coli uses ____ enzymes to take up and metabolize lactose, the genes for which are clustered in the lac operon. The first gene, lacZ, codes for _______, which hydrolyzes lactose to glucose and galactose. The second, lacY, codes for a _____, the membrane protein that transports lactose into the cell. The third, lacA, codes for ______, an enzyme that detoxifies other molecules entering the cell via the permease. Unusually, the gene for the lac repressor, lac I, is adjacent to the lac operon.
3, β-galactosidase, permease, transacetylase,
Gene regulatory sequences and introns account for ____ and ______ respectively of the human genome
5%, 20%
mRNA emerges from the spliceosome, which has a ___ ____ and _____ ____
5' cap, poly-A tail
Each end of pre-mRNA molecule is modified in what way?
5' end receives modified nucleotide 5' cap 3' end gets poly A tail
Aminoacyl-tRNA synthetase is an enzyme whose function is to _____. A. link tRNA to corresponding amino acid B. remove introns from pre-RNA transcript C. cause RNA polymerase to detatch from dna D. join RNA nucleotides complemnentary to DNA template strand
A
Histone acetylases are enzymes that add acetyl groups to histone proteins. In what way do histone acetylases affect transcription? A. Activate transcription by opening chromatin. B. Activate transcription by condensing chromatin. C. Repress transcription by opening chromatin. D. Repress transcription by condensing chromatin.
A
How do the leading and the lagging strands differ? a) The leading strand is synthesized in the same direction as the movement of the replication fork, whereas the lagging strand is synthesized in the opposite direction. b) The leading strand is synthesized at twice the rate of the lagging strand. c) The lagging strand is synthesized continuously, whereas the leading strand is synthesized in short fragments that are ultimately stitched together. d) The leading strand is synthesized by adding nucleotides to the 3′ end of the growing strand, whereas the lagging strand is synthesized by adding nucleotides to the 5′ end.
A
How does allolactose, an isomer of lactose, induce expression of the lac gene in Escherichia coli? A. Allolactose binds to the lac repressor, thereby releasing it from operator sequence. This binding interaction allows the promoter to recruit sigma factor and RNA polymerase, leading to transcription of the lac genes. B. Allolactose binds to the lac repressor. Together, they bind which then binds to the operator. This binding interaction allows the promoter to recruit sigma factor and RNA polymerase, leading to transcription of the lac genes. C. Allolactose binds sigma factor and recruits it to the promoter region. This binding interaction allows the promoter to recruit sigma factor and RNA polymerase, leading to transcription of the lac genes
A
In cats, an X-linked gene affects coat color. The O allele produces an enzyme that converts eumelanin, a black or brown pigment, into phaeomelanin, an orange pigment. The o allele is recessive to O and produces a defective enzyme, one that does not convert eumelanin into phaeomelanin. Which of the following statements is accurate? a) The phenotype of o-Y males is black/brown because the nonfunctional allele o does not convert eumelanin into phaeomelanin. b) The phenotype of OO and Oo males is orange because the functional allele O converts eumelanin into phaeomelanin. c) The phenotype of Oo males is mixed orange and black/brown because the functional allele O converts eumelanin into phaeomelanin in some cell groups (orange) and because in other cell groups the nonfunctional allele o does not convert eumelanin into phaeomelanin. d) The phenotype of O-Y males is orange because the nonfunctional allele O does not convert eumelanin into phaeomelanin, while the phenotype of o-Y males is black/brown because the functional allele o converts eumelanin into phaeomelanin.
A
Mitochondrial DNA in humans is only inherited from the ______ and is found ______ the nucleus of the cell? Fill in the blanks in appropriate order. A. Maternal lineage (biological female), outside. B. Paternal lineage (biological male), outside. C. Paternal lineage (biological male), inside. D. Maternal lineage (biological female), inside
A
Which of the following about archaea and eukaryotes are true? A. Archaea and eukaryotes share some aspects of the transcription machinery, e.g., transcription initiation. B. Genes in archaea and eukaryotes are organized in operons. C. Histones are unique to eukaryotes. D. Sigma factors are generally found in archaea and eukaryotes.
A
What makes up the eukaryotic transcription initiation complex?
A completed assembly of transcription factors and RNA polymerase II bound to a promoter
Karyotype
A display of the chromosome pairs of a cell arranged by size and shape.
How is a recombinant DNA plasmid made (steps)?
A restriction enzyme and DNA ligase is used 1. Restriction enzyme recognizes restriction site in plasmid 2. Restriction enzyme makes staggered cuts in the sugar phosphate backbones, producing fragments w sticky ends 3. Foreign DNA fragments w complementary sticky ends can base pair w plasmid ends, ligated product is a recokmbinant plasmid
What is a method that scientists can use to determine the effect that acetylation of H3K4 has on gene expression? (All experiments would be performed in the presence and absence of acetylation.) Select any that apply. A. Reverse transcription polymerase chain reaction (RT-PCR) of specific genes B. RNA-Seq C. Whole genome sequencing D. Metagenomic (DNA) sequencing E. PCR cloning (alone)
A, B
Which of the following are correctly identified in this illustration of a tRNA? This is Lecture 19 slide 463 a) 5′and 3′ends b) hydrogen bond c) amino acid attachment site d) anticodon loop
A,B,D
Some defects in mitochondrial genes prevent cells from making enough ____ and result in diseases that affect ____ and ____ systems
ATP, muscular, nervous
______, an isomer of lactose, binds to the repressor, inactivating it and repressing the operon. The inactive repressor cannot bind to the operator, and so the genes of the lac operon are ______, and the enzymes for using lactose are made.
Allolactose, transcribed
What is the difference between 1 chromosome with 1 chromatid and 1 chromosome with 2 chromatids?
Amount of DNA doubles w 2 chromatids
Polymerase Chain Reaction (PCR)
Amplify DNA sequences using primers, can produce billion copies of target sequence in just a few hours
Bioinformatics
Application of computational methods to the storage and analysis of biological data
In presence of glucose, ___ is low and the lac operon is/is not expressed
CRP, is not
Consider the end of meiosis II. How does the amount of DNA in each produced daughter cell as compared to the amount in the cell at the beginning of prophase I? A. It is the same. B. It is reduced by 3/4. C. It is reduced by 1/2. D. It has doubled.
B
Considering Moderna/NIH or Pfizer/BioNTech vaccines to work, which of the following would lead to failure during quality control checks? Choose 1. (NB: codon refers to each three nucleotides code.) A. A mutation occurs where AGC is now UCG. B. A mutation occurs where the 8th codon on the mRNA becomes UGA. C. There is a mutation to the 5’ of the ribosomal binding site. D. Droplets varying amounts of mRNA particles, but still within a narrow range. E. A mutation occurs where GUU is now GUA.
B
Given the following 39-nt gene sequence, how long is the predicted polypeptide? Assume no post-processing. 5’- ATGAGCAAAGGAGAAGAACTTTTCACTGGAGTTGTCTAG -3’ A. 11 B. 12 C. 13 D. 14
B
How are genome-encoded DNA mutations inherited from generation to generation in bacteria, archaea, and mammals? A. Each uses cell division of any cell. Mutations are inherited through DNA replication and subsequent division. B. Mutations are inherited through DNA replication and subsequent division for bacteria and archaea. Mammals inherit through production of gametes (germline cells), followed by sexual fertilization. C. I’m not sure.
B
How does a single nucleotide insertion before UAG impact polypeptide synthesis? a) No impact. b) The stop codon moves out of frame, leading to a mutant protein (translation continues until the next stop codon). c) The polypeptide contains one additional codon.
B
In some species of Drosophila, there are genes on the Y chromosome that are not on the X chromosome. Imagine that a new allele arises on the Y chromosome and reduces the size by half of individuals with the new allele. Which of the following statements is accurate with regard to this situation? a) This allele is passed to all offspring of a male with the allele. b) This allele is passed to all male but no female offspring of a male with the allele. c) This allele is passed to all offspring of a female with the allele. d) This allele is passed to all male but no female offspring of a female with the allele. e) This allele is passed to all offspring of both males and females with the allele.
B
In tomatoes, a heterozygous plant with green leaves and red fruit is crossed with a recessive plant having mottled leaves and yellow fruit. The following distribution of offspring is observed: green leaves, red fruit 25% green leaves, yellow fruit 25% mottled leaves, red fruit 25% mottled leaves, yellow fruit 25% What conclusion can be made regarding the loci for The loci are on the same chromosome at an unknown distance from each other. B. The loci may be on the same chromosome more than 50 map units apart, or they may be on separate chromosomes. C. The loci are on separate chromosomes. D. The loci are on the same chromosome 25 map units apart.
B
In tomatoes, a heterozygous plant with normal fruit and purple stems is crossed with a recessive plant having fasciated fruit and green stems. The following distribution of offspring is observed: normal fruit, purple stems 38.5% fasciated fruit, green stems 38.5% normal fruit, green stems 11.5% fasciated fruit, purple stems 11.5% What conclusion can be made regarding the loci for fruit shape and stem color? a) The loci may be on the same chromosome more than 50 map units apart, or they may be on separate chromosomes. b) The loci are on the same chromosome 23 map units apart. c) The loci are on separate chromosomes. d) The loci are on the same chromosome at an unknown distance from each other.
B
Which element(s) from the following list is/are part(s) of a bacterial operon? A. repressor gene B. promoter C. inducer D. repressor protein E. all of the above
B
Which of the following is a unique feature of eukaryotic mRNA and differentiates it from bacterial mRNA? A. 5′ end B. poly-A tail C. start codon D. stop codon E. 3′ end
B
Which of the following phenomena or processes does not contribute to the high fidelity of DNA replication? a) base pairing b) telomerase c) proofreading d) mismatch repair
B
Imagine a bacterial replication fork. Synthesis of which new strand(s) would be affected by mutations in the enzyme DNA ligase? A. leading strand B. lagging strand C. both leading and lagging strands D. neither leading nor lagging strand
B, bc DNA ligase fills in the gaps on lagging strand
Nitrogenous bases are paired in specific combinations. Which of the following does not provide evidence to support this conclusion? a) A purine-purine pair is too wide to account for the 2-nm diameter of the double helix. b) The pairs of nitrogenous bases are held together by hydrogen bonds. c) A pyrimidine-pyrimidine pair is too narrow to account for the 2-nm diameter of the double helix. d) The X-ray data suggested that the double helix had a uniform diameter. e) Whenever one strand of DNA has an A, the partner strand has a T.
B, doesn't tell us about the specific combinations
Imagine you are using a microscope to observe a cell undergoing cell division. How can you be sure that the cell in this figure is undergoing meiosis rather than mitosis? More than one answer is possible; select all that apply. A. Kinetochore microtubules are attached to the centromeres of the chromosomes. B. Homologous chromosomes are arranged at the metaphase plate. C. Crossing over is occurring between non-sister chromatids. D. Sister chromatids are physically connected by proteins called cohesins. E. There are two centrosomes, each comprised of a centriole pair, at opposite poles of the cell.
B,C
In terms of gene expression, which of the following types of regulation are found in eukaryotic cells and generally NOT in bacteria? A. Binding of transcription factors to a gene’s promoter region. B. Remodeling of chromatin to allow contact between RNA polymerase and a gene’s promoter region. C. Alternative splicing of introns from a primary RNA transcript to produce mature, processed mRNA molecules. D. The binding of allosteric regulators to transcription factors, which can modify how strongly the transcription factors bind to the gene’s promoter regions.
B,C
Which of the following types of gene regulation are found in eukaryotic cells and generally NOT in bacteria? A. Binding of transcription factors to a gene’s promoter region. B. Processing of microRNAs to modify polypeptide production in the cytosol. C. Remodeling of chromatin to allow contact between RNA polymerase and a gene’s promoter region. D. The binding of allosteric regulators to transcription factors, which can modify how strongly the transcription factors bind to the gene’s promoter regions.
B,C
When a mutation caused by a nucleotide-pair insertion occurs in a protein-coding region, which of the following types of mutations can occur? Select all that apply. A. silent B. frameshift C. missense D. nonsense E. none of the above
B,C,D
A eukaryotic gene has a pre-mRNA with exons in this 5’ - 3’ order: 1, 2, 3, 4. Select the arrangement(s) that could not occur in the alternative splicing of a pre-mRNA into a mature mRNA molecule A. 1, 2, 3, 4 B. 2, 4, 3 C. 1, 3, 4 D. 2, 3, 3, 4
B,D
Termination in Bacteria vs Eukaryotes
Bacteria 1. transcription proceeds through a terminator sequence in DNA 2. terminator causes RNA polymerase to detatch from DNA transcript Euk 1. RNA polymerase II transcribes a sequence on DNA called the polyadenylation signal sequence 2. Polyadenylation signal of 6 nucleotides (AAUAAA) gets bound by proteins in nucleus 3. these proteins cut RNA transcript free from polymerase, releasing pre-mRNA 4. pre-mRNA under goes processing and cleavage marks the ending of mRNA 5. even though cleavage occurs, RNA polymerase II continues to transcribe and enzymes begin to degrade RNA until the enzymes catch up to the RNA polymerase which dissociates it from the DNA
Repressor
Binds to operator and prevents RNA polymerase from transcribing a gene
Another defense against phages is the _____ ____
CRISPR Cas system
A mutation during DNA replication causes a G to be inserted after the first base of the codon for leucine. How will this affect the growing polypeptide chain? A. Elongation will stop prematurely. B. There will be a single amino acid substitution. C. The reading frame will be shifted, and the wrong amino acids will be added from this point on. D. An extra amino acid will be added, but the reading frame will not be affected.
C
Imagine a bacterial replication fork. Synthesis of which new strand(s) would be affected by mutations in the enzyme primase? a) leading strand b) lagging strand c) both leading and lagging strands d) neither leading nor lagging strand
C
If there is glucose, ___ is inactive and the lac operon is not expressed
CRP
cAMP binds to
CRP
The nontemplate strand of a portion of a gene reads 5′-TTC ACT GGT TCA -3’. What is the sequence of the resulting transcript for this portion? a) 5′-AAG UGA CCA AGU-3’ b) 5′-UGA ACC AGU GAA-3’ c) 5′-UUC ACU GGU UCA-3’ d) 5′-ACU UGG UCA CTT-3’
C
What is the predicted percentage of F2 offspring that will show the recessive phenotype (trait) after a testcross between a F1 hybrid and the parental recessive F0 generation. Assume a single-gene trait with Mendelian inheritance and complete dominance. NB: consider drawing out the cross. A. 100% B. 25% C. 50% D. 0% E. 75%
C
Which of the following statements comparing bacterial and eukaryotic transcription is not true? a) Part of the RNA polymerase specifically recognizes and binds to the promoter in bacteria. In eukaryotes, transcription factors mediate the binding of polymerase. b) The RNA transcript is immediately usable as mRNA in bacteria; however, in eukaryotes, the RNA transcript is processed. c) RNA polymerase requires a primer in bacteria; however, in eukaryotes, it does not. d) Eukaryotic transcription has a polyadenylation signal sequence. However, in bacteria, a transcription terminator causes the polymerase to detach and release the transcript.
C
Some repeats assemble special nucleosomes with a variant histone called _________ instead of the usual histone H3. These special nucleosomes form the foundation for the _______
CENP-A, kinetochore
Most methylation occurs at ___ dinucleotides because of the specificity of ___ _____. __ of CG dinucleotides are methylated in mammals vs __ in plants
CG, DNA methyltransfease , 70%, 25%
Role of heterochromatin in centromere function
Centromeres are specialized domains of heterochromatin that provide the foundation for the kinetochore. Centromeric heterochromatin is characterized by specific histone modifications (specifically H3K9)
Prophase I
Centrosome movement (occur in mitosis too during prophase) - Spindle formation (occur in mitosis too during prophase) - nuclear envelope breakdown (occur in mitosis too during prophase) - Chromsomes condense - crossing over occurs at chiasmata - microtubules attach to kinetochores (one at the centromeres of each homolog) which move homologous pairs to metaphase plate
Mutations
Changes in an organism's DNA
Looking at a GWAS for Crohn's Disease, we see the chromosome IL23R. Is it the causation of Crohn's Disease or is it correlated?
Correlated, it's highly correlated but we don't know there's a definitive causation, have to follow up and do molecular work to show causation
Gal 80 is needed to inhibit transcription of __ genes when ____ isn't present
Gal, galactose
Consider mitosis and meiosis. Which of the following statements is false? A. Mitosis results in two daughter cells. Meiosis results in four daughter cells. B. Many mammals reproduced via sexual reproduction. For example, dogs produce gametes through meiosis. C. DNA replication does not occur in metaphase and metaphase I D. All single-celled organisms, including algae and fungi, only reproduce through binary fission or asexual reproduction. E. Bacteria are not capable of meiosis.
D
Nondisjunction can happen in either meiosis I or meiosis II. Consider n + 1 and n – 1 gametes involving chromosome 21 that are formed from nondisjunction in meiosis I and meiosis II. Select the best comparative statement. a) n + 1 and n – 1 gametes are the same whether they result from nondisjunction in meiosis I or meiosis II. b) n + 1 and n – 1 gametes are necessarily different whether they result from nondisjunction in meiosis I or meiosis II. c) A n – 1 gamete can be different depending on whether nondisjunction happened in meiosis I or meiosis II. d) A n + 1 gamete can be different depending on whether nondisjunction happened in meiosis I or meiosis II.
D
The two strands of duplex DNA are complementary in sequence and are arranged in an antiparallel fashion. What is the 3’ to 5’ sequence of the complementary strand to the following: 5’- ATG AGT ATT CAA CAT TTC CGT –3’ A. 3’- ACG GAA ATG TTG AAT ACT CAT –5’ B. 3’- TAG TGA TAA GTT GTA AAG GGA –5’ C. 3’- TTG TGT TTT GTT GTT TTG GGT –5’ D. 3’- TAC TCA TAA GTT GTA AAG GCA -5’
D
the addition of the poly-A tail is:. A. encoded as a series of ”T” nucleotides at the end of the gene sequence (on the chromosome) B. performed by protein factors in the cytosol after mRNA export from the nucleus C. not required for maturation of eukaryotic mRNA D. Accomplished by a set of proteins at the poly(A) site on the pre-mRNA
D
For which amino acid does this tRNA code? Anticodon Loop: AAG a) Glu (E) b) Leu (L) c) Lys (K) d) Phe (F)
D, UUC --> Phe
Duplication
DNA piece that is abnormally copied one or more times
Central dogma of of biology
DNA --> RNA --> Protein --> Cell/Organism (Phenotype)
A transcription factor protein that activates transcription consists of a ___ ____ ____ and one or more ____ _____
DNA binding domains, activiation domains
Chromatin
DNA combined w proteins, located within chromosome of euk cell
During what phase of meiosis, if any, does DNA replication occur? Comparing the cell in prophase I to a daughter cell at the end of cytokinesis I, is there a change in the amount of DNA per cell?
DNA is replicated before entry into meiosis. After meiosis I, the two daughter cells at the completion of cytokinesis I contain half the amount of DNA as the cell as prophase I.
Whole genome shot gun points
DNA is sheared and processed w engineered caps - resulting data covers million of bp (computationally heavy) - sequencing data has to be pieced tgt afterwards (computationally heavy) - used for an unbiased look at what DNA is going into machine
In mammals and plants, ____ ______ and ____ _____ work tgt to make DNA inaccessible. w
DNA methylation, histone methylation
A maintenance ___ ______ is associated with DNA replication
DNA methyltransferase
Mutations in _____ _________ genes or _______ result in transposable element transcription and movement
DNA methytransferase, acetylation
____ _____ proofread newly made DNA and replace incorrect nucleotides
DNA polymerases
How does DNA replication intersect w inheritance
DNA replication allows for genetic info to be inherited from parent cell to daughter cell and from generation to generation
Promoter
DNA sequence where RNA polymerase attatches
Canine somatic cells have 39 pairs of homologous chromosomes. Ignoring possible crossing over, how many genetically different dog gametes are generated by independent assortment of homologous chromosomes in meiosis? A. 78 B. 12 C. 39 D. 39^2 E. 2^39
E
What can generate diversity in sexually reproducing organisms? Choose the most accurate answer. A. Crossing over B. Random fertilization C. Independent assortment of chromosomes D. Mutations during DNA replication E. All of the named mechanisms F. None of the named mechanisms
E
What is the predicted percentage of F2 offspring that will show the Dominant phenotype (trait) caused by a cross of the F1 offspring of a F0 cross between two traits (i.e., F0 cross is Dominant/Dominant x Recessive/Recessive). Assume a single- gene trait with Mendelian inheritance with incomplete dominance. NB: consider drawing out the cross. A. 100% B. 25% C. 50% D. 0% E. 75%
E
Which of the following cannot contribute to behaviors being passed from the parental (P0) to F1 generation? A. Epigenetic modification of chromosomes B. Inheritance of maternal mitochondria C. Parental imprinting of gametes D. Proviral integration into a parental chromosome E. None of the above.
E
Termination in Euk vs Bacteria
Euk: - RNA polymerase II transcribes poly A sequence Bacteria: - RNA polymerase stops transcription at end of terminator
What are the domains that can do asexual reproduction/binary fission?
Eukaryotes, Archaea, Bacteria
How does LacI aka repressor bind to operator
Forms a tetramer that binds tightly to the duplicated DNA sequence in the operator and repressor a-helicies places amino acids in the major groove where they noncovalently bind to DNA. This blocks RNA polymerase from going through
What organisms were linked genes observed in?
Fruit flies by Morgan
Synapsis
Fusion of chromosomes at start of meiosis
____ ____ _____ act at the promoters of all protein coding eukaryotic genes
General transcription factors
What is the relationship btwn genes and chromosomes
Genes are located on chromosome and each chromosome has 1 version of a gene (aka allele)
Why is that genes that are farther away are more likely to crossover?
Genes that are farther away are less likely to be inherited together and have a greater chance of crossing over
Tortoriseshell cats are a common example of what in female mammals?
Genetic mosaiacism, this is bc the gene for hair color is on X chromosome
Grasshoppers and chickens have other chromosomal systems of sex determination. Grasshoppers use? Chickens use?
Grasshopper: X-0 Chicken: ZW
The four histone proteins are?
H2A, H2B, H3, H4
Retroviral proviruses can be silenced by ____, this helps to condense regulatory regions of the provirus into heterochromatin which inhibits transcription
H3K9
What was Mendel's general experiment?
He looked at true breeding parents and asked what happens when you mix 2 pea plants with different phenotypes. What would offspring look like and how would grandchild generation look like
Transcription factors in euk and RNA polymerase holoenzyme and sigma factor in bacteria both do what?
Help guide the binding of RNA polymerase
Why does heterochromatin protect genomes from pathogenic viruses?
Heterchromatin is the result of methyltransferase acting on regulatory regions of the provirus and condensing it which inhibits transcription of this genomic region
Imagine an E. coli cell with a mutation that renders its lac repressor protein completely inactive. Which of the following would be true of that cell? A. Synthesize β-galactosidase only when lactose is absent. B. Synthesize β-galactosidase only when lactose is present. C. Never synthesize β-galactosidase. D. Always synthesize β-galactosidase.
If lac represor is inactive, this means that when there's glucose, it'll still repress. Beta gal is needed for lactose metabolization and it is only mildly affected by glucose. D bc lac repressor doesn't affect beta gal synthesis
Each of a group of E. coli bacterial cells has a different disabling mutation in its lac operon. Which of the following will make it impossible for the cell to metabolize lactose? A. mutation in lacZ (gene for b-galactosidase) B. mutation in lacI (cannot bind to operator) C. mutation in operator (cannot bind to repressor) D. mutation in lacI(cannot bind to inducer)
Impossible to metabolize lactose = Beta gal is not here, Beta gal needed to metabolize lactose
The TATA box is crucial in forming what in eukaryotes?
Initiation complex
Noncoding segments in a gene are called ____. Coding segments are called?
Introns, exons
DNA ligase
Joins Okazaki fragments of lagging strand; on leading strand, joins 3′ end of DNA that replaces primer to rest of leading strand DNA
Two important roles of viruses in ecosystems: 1. ____ ____ ____ ____ - Without extinction of the host 2. ____ ___ ____ ____ - Prevent dominance of any one species
Limiting host population density, Selecting for host diversity
Shortening of telomeres might protect cells from cancerous growth by?
Limiting number of cell divisions
How do linear DNA molecules get shorter and shorter w each replication?
Linear DNA molecules get shorter and shorter w each replication because there are 5' ends on the chromosomes. DNA at ends of chromosomes can't be fully copied in each round of replication. This results in no 3' OH of preexisting polynucleotide for DNA polymerase to add onto so DNA ets shorter
Reverse transcriptase's role
Makes and packages retrovirus before it leaves the cell
number of divisions, Mitosis vs Meiosis
Mitosis: 1 Meiosis: 2
number of daughter cells and genetic composition, Mitosis vs Meiosis
Mitosis: 2, 2n cells, genetically identical to parent w same number of chromsomes Meiosis: 4, each haploid (n), genetically different
Synapsis of homologous chromsomes, Mitosis vs Meiosis
Mitosis: doesn't occur Meiosis: occurs during prophase I
Role in animals, fungi, plants, Mitosis vs Meiosis
Mitosis: enables multicellular organism to grow Meiosis: produces gametes and introduces genetic variability
DNA Replication, Mitosis vs Meiosis
Mitosis: occurs in interphase before mitosis begins Meiosis: occurs in interphase before meiosis I begins but not meiosis II
Heterochromatin
More highly condensed chromatin, generally not expressed
Why is shortening of DNA ends not an issue for prokaryotes?
Most of them have circular chromosomes
Large blocks of genes on human chromosome 16 are found on 4 ____ chromosomes. This indicates?
Mouse, genes in each block stayed together in both human and mouse lineages
Translocation Mutation
Moves a segment from 1 chromosome to a nonhomologous chromsome (switching a portion of a chromosome to another chromsome)
How does N and C change in Meiosis 1 and 2?
N: - Meiosis 1: we go from having 2N in prophase I to 2N in metaphase 1 to 1N in Anaphase and Telophase 1 - Meiosis 2: from prophase 2 we have 1N, metaphase 2 we have 1N, anaphase 1 and telophase 1 we have 1N C: -Meiosis 1: we go from 2C in interphase to 4c in prophase 1. in metaphase 1, we have 4C and in anaphase and telophase 1 we have 2C - Meiosis 2: we go from having 2C in prophase 2 to 2C in metphase 2, anaphase and telophase 2 we have 1C
Are transposable elements good or bad?
Neither but insertions into genes can be harmful
Yes lactose, __ repressor
No
Does methylation of histone H3 lysine 9 and lysine 27 result in transcription?
No, it is associated w heterchromatin, prevents transcription
Nucleotide excision repair
Nuclease cuts out and replaces damaged stretches of DNA
________ ________, specifically ____ or _____ is the blueprint for organisms and viruses
Nucleic acids, DNA, RNA
HbF higher capacity to carry?
O2
3' __ and 5' ____
OH, phosphate
How are mitochondrial genes inherited?
Passed onto offspring through cytoplasm of egg BEFORE fertilization
Heterochromatin protects genomes from?
Pathogenic viruses
Semiconservative model
Predicts when a double helix replicates, each daughter molecule will have 1 old strand from parent molecule and 1 newly made strand
Positive sense mRNA vs Negative sense mRNA
Positive sense mRNA can be translated into ribosomes and proteins right away (needs a reverse trancriptase or an RNA polymerase). Negative sense mRNA needs RNA dependent RNA polymerase (so ssRNA or dsRNA viruses)
siRNAs generated from a locus target a ____-like complex to that locus to recruit a __ ____ DNA methyltransferase
RISC, de novo
Not all __ is translated
RNA
RNA polymerase transcribes proviral DNA into ____ which is packaged into virons
RNA
miRNAs are expressed from their own genes by ____ ____ ____ and then are processed by an enzyme called ____ to ~22 nucleotides
RNA polymerase II, Dicer
DNA is replicated in the ____ phase for mitosis and not separated until _____
S, mitosis
Remdesivir acts as a nucleoside analog, inhibits RNA dependent RNA polymerase, including SARS COV-2 (a positive sense ssRNA virus). Elongation is halted. Describe how this works
SARS COV-2 is transcribed by RdRp. If remedesivir inhibits RdRp, it'll cause a break and stalling
How is Sanger sequencing different from PCR
Sanger sequencing uses only 1 primer in the reaction, PCR uses 2 primers (one for forward strand and one for the reverse strand)
Two competing approaches helped obtain Human Genome Project, they were ___ ____ and ___ ___ ____
Sanger sequencing, whole-genome shotgun approach
Why are puppies in a litter from selective breeding not clonal?
Selective breeding entails sexual reproduction from two parents, both of which use meiosis to produce gametes. Specifically, during meiosis, diversity in the offspring’s genome sequence can result from crossing over, random fertilization, and the independent assortment of chromosomes.
Prophase II
Spindle apparatus forms - Late prophase II, Chromsomes are moved to metaphase II plate
Removal of introns is done through?
Spliceosomes
Transcription unit
Stretch of DNA that's transcribed
Genomics
Study of whole sets of genes and their interactions
______ mutations are usually missense mutations
Substitution
Phosphodiester backbone consists of alternating?
Sugar and phosphate groups
3 events in Meiosis I that distinguish meiosis from mitosis?
Synapsis and crossing over in prophase I - homologus pairs line up at metaphase plate in metaphase I (individual Chromsomes line up in mitosis prophase) - homologous Chromsomes separate during anaphase I (in mitosis, sister chromatids separate)
Translation
Synthesis of polypeptide using info in mRNA
Primase
Synthesizes an RNA primer at 5′ end of leading strand and at 5′ end of each Okazaki fragment of lagging strand
TFIID consists of a ___ box binding protein and 13 transcription binding associated factors (___)
TATA, TAFs
____ is a general transcription factor that binds to the core promoter of eukaryotic genes and recruits RNA polymerase __ to initiate transcription
TFIID, II
How are galactose metabolism genes (Gal 1, Gal 7, Gal 10) not in an operon (they're in diff places on chromosomes) but transcription is coordinated by galactose?
This is bc there are enhancer elements upstream
Eukaryotic modificiations are due to separation of?
Transcription from translation
Example of repressible operon
Trp operon
Testcross
Used to determine whether a dominant genotype is hetero (Pp) or homo (PP). Cross dom cross with homo recessive to find out
DNA Polymerase III
Using parental DNA as a template, synthesizes new DNA strand by adding nucleotides to an RNA primer or a pre-existing DNA strand
Locus
Where gene is located on a chromosome
Morgan crossing recesssive white eyed mutant w WT, he saw what in F2 generation?
White eyes only showed up in males and all females have red eyes aka WT. Eye color is a sex lineked trait
A biological female notices certain regions of skin have sweat glands while other regions lack sweat glands. What is most likely reason?
X chromosome inactivation, mosaicism
Chiasmata
X shaped regions where crossover occurs
A long noncoding RNA called ____ is involved in X chromosome inactivation in mammals
Xist
A long noncoding RNA called ______ is involved in X chromosome inactivation in mammals
Xist
How does Xist work?
Xist RNA recruits a histone deacetylase that erases acetylation on H3K27 (resulting in heterochromatin). Then, a histone methyltransferase writes H3K27me3 to inactivate X chromosome
Replication fork
Y shaped region where parental DNA strands are unwound
Could remdesivir work on other viruses? What types
Yes since it'll work for any virus that needs RdRp like ss negative sense (which needs RdRp, also no such thing as ds neg sense btw)
Are transposons heavily methylated? Why?
Yes, especially in plants. DNA methylation enables transposon activation, ensuring their survival and propagation throughout the host genome, and also allows the host access to regulatory sequences encoded within the elements
Does acetylation of histone H3 lysine 9 open chromatin up?
Yes, makes it euchromatin, allows transcription
Polygenic inheritance
additive effect of 2+ genes on a single phenotypic character - think: skin color
dATP supplies ____ to DNA and is similar to the ___ of energy metabolism
adenine, ATP
Aneuploidy
abnormal number of a particular chromosome, includes monosomy (2n-1) and trisomy (2n+1)
cAMP is only made when glucose is _____, allows cAMP to bind to ____. That regulation is due to _____ at membranes that are sensing. cAMP and CRP induces expression of ____. If CRP is absent, we will get _____ of lacZ but at a lower amount
absent, CRP, proteins, lacZ, production
Acknowledgement of contributors in science is sometimes ____. Each person exists in a ___, ___, ____ and these factors can influence the person and their work. There is no ____ ____ for race and race is a ____ and ____ construct. There is more genetic diversity ___ racial groups than between. Genetics in model systems are informative but rarely have ____ ____ to human genetics.
absent, time, place, genetic basis, societal, cultural, within, direct equivalence
Open regions euchromatin, rich in histone H3K9 ____ nucleosomes are ____ digested by DNAse since there's more space for DNAse to work
acetylated, easily
Histone modification is about H3 _____ vs H3 ____ and we are specifically looking at the amino acid ____
acetylation, deacetylation, lysine
Histone modifying enzymes include histone ____, ____, ____, ____
acetyltransferases, deacetylases, methyltransferases, demthylases
In archaea, like eukaryotes, we can have ____, ____, ____. There's also similarity between structure of ____ ____ in archaea and bacteria
activators (encourage binding of inhibitors), repressors (does not encourage binding of inhibitors), and dual binding (encourage and discourage binding of inhibitors), transcription factors
DNA binding and mediator proteins are invovled in interations between ______ and general ____ ___ are important because they control genes
activators, transcription factors
When lactose is absent, the repressor is ___ and the operon is ___
active (lac repressor is always innately on), off (if there's no lactose, repressor binds to operon and switches it off)
acetylation =
active, genes are open, euchromatin
Repressor proteins exist in 2 states: ____ and ____. This is determined by whether they bind a ____ ______
active, inactive, signal molecule
Insertion
addition of nucleotides
In the Gal4 mutant, the Gal1, Gal7, and Gal 10 enzymes are/are not made when galactose is added
are not
How are genes passed from 1 generation to another?
asexual reproduction - binary fission - sexual reproduction
To elongate lagging strand, DNA polymerase works in the direction ____ from the replication fork
away
Bacteriophages, also called phages, are viruses that infect _____. They are the ___ understood of all viruses
bacteria, best
Specific transcription factors in archaea resemble _____ transcription factors and generally bind ___ to promoter
bacteria, close
How do sigma factors recognize specific DNA sequences in ____?
bacteria, they bind to core RNA polymerase and when bound they activate specialized genes
Lytic Cycle
bacterium lyses/breaks open and releases the phages
Nucleosome
basic repeating unit of eukaryotic chromatin. chromatin is DNA and proteins packed in nucleus. - composed of DNA wound twice around core of 8 histones, 2 of each of the 4 main histone types - 2 copies of each of the 4 histones
In a 10 nm chromatin fiber, unfolded chromatin looks like ___ on a ____. Each bead is a _____
beads, string, nucleosome
Meiosis I --> Meiosis II, how does n change from begining to end
beginning of meiosis I, we have one 2n cell end of meiosis I, we have two 1n daughter cells those two 1n daughter cells go through meiosis II to become four n daughter cells
As with prokaryotes, DNA replication in eukaryotic cells is _____. However, unlike the circular DNA in prokaryotic cells that usually has a _____ origin of replication, the linear DNA of a eukaryotic cell contains _____ origins of replication
bidirectional, single, multiple
Single strand binding proteins
bind to and stabilize single stranded DNA
Enhancers
bind transcription factors that function as activators or repressors
Operator
binding site for repressor protein that blocks RNA polymerase If it was mutated, RNA polymerase wouldn't be blocked = operon not repressed
Job of lacI
binds DNA and physically blocks RNA polymerase from moving forward (this is bc in transcription, RNA polymerase needs to follow DNA and synthesize RNA by copying DNA sequence into RNA sequence)
Metagenomic sequence data can be ___ and ___ into genomes for organisms that are present in a sample
binned, assembled
Transfer of genes into eukaryotes: some bacteria can transfer genes across?
biological domains
A repressor ___ transcription of the lac operon when the inducer is absent
blocks
Telomerase's function
cataluzes lengthening of telomeres in germ cells
Anaphase I
breakdown of proteins = pair of homolgous Chromsomes separate = sister chromatids - Homologs move to opposite poles by Spindle apparatus - sister chromatid conhesion at centromere
Anaphase II
breakdown of proteins holding sister chromatids tgt = sister chromatids separate and move to opposite poles - each chromatid becomes an individual chromsome
Nucleic acids (DNA and RNA) instruct how to _____ and ____ cells and passes information to the _____ _____
build, run, next generation
_______ is an activator of the lac operon
cAMP-CRP
Generalized transduction
can transfer any gene from a donor to a recipient cell
Specialized transduction
can transfer only a few closely linked genes btwn cells
RNA Polymerase II _____ initiate transcription by itself
cannot
Phages have an elongated ____ head that encloses their DNA. A protein ____ ____ attaches the phage to the host and injects the phage DNA inside.
capsid, tail piece
AS is ____ for SCD. SS is someone __ by SCD
carrier, affected
Glucose uptake at cell membrane causes signaling _____ that blocks the production of ____ _____. When glucose is absent, adenylate cyclase is ____ and can convert ATP to _____
cascade, adenylate cyclase, active, cAMP
Humans and other mammals and plants have the lowest ______ _______
gene density
Transposable elements allow for generation of new genes and allow for _______ ______ by unequal crossing over and ____ _______
gene duplication, exon shuffling
Multigene families result from ___ _____
gene duplications
Changes in chromatin, histones have effects on
gene expression
introns are integral to
gene expression
To determine gene function, we can use ___ ____, ___ ____, and __ ____
gene knockout, CRISPR Cas 9, RNA interference (RNAi)
In sexual reproduction, 2 parents give rise to offspring with unique combinations of _____ inherited from 2 parents
genes
Somatic cells: - don't pass ____ between generations - produced by? - are _____ aka __ copies of a gene/__ pair of chromsomes - n is?
genes mitosis diploid, 2, 1, 2n
Information flow, exchange, and storage: the growth and behavior of organisms are activated through the expression of ______ _______ in _____
genetic information, context
Prophage
genetic material of a bacteriophage, incorporated inito genome of a bacterium and can produce phages if activated
Provirus
genetic material of a virus incorporated into and able to replicate w the genome of a host cell
Polymorphisms that are inherited together happen because there is not much ____ __________ between them over many generations
genetic recombination
Mutations/changes are source of __ _____ upon which ____ ____ acts
genetic variation, natural selection
A clone is a group of _____ ______ individuals from the ____ parent
genetically identical, same
Ancestry of humans is reflected in the ____ _____, we're made of everything that we consume/makes us up
genomic signature
Each histone has a ___ ____ and a ___ ___ (amino end)
globular domain, histone tail
Polyploidy
having multiple sets of complete chromosomes, 3n, 4n, etc
Three step cycle in PCR: ____, ____, _____ results in?
heating, cooling, replication, brings a chain reaction that produces a growing population of identical DNA molecules
capsid can have a variety of structures; associated viruses may be referred to as ____ or ____ viruses.
helical, icosahedral
True breeding means?
kind of breeding wherein the parents would produce offspring that would carry the same phenotype.
Example of inducible operon
lac operon
Inducers of lac operon include
lactose, allolactose, and IPTG
Spliceosomes
large complex consist of varitety of proteins and several small RNAs that recognize splice site. binds to short nucleotide sequences along an intron
RNA splicing
large portions of RNA primary transcript molecules are removed and remaining portions are reconnected
Integration of a provirus into a human genome can lead to?
latent infections (hidden infection)
When there's lots of glucose, there is ____ cAMP
less
Eukaryotic chromosomes generally have _____ DNA molecules
linear
less than 50% recombination frequency is
linked
Recombination of ___ genes occurs because of crossing over during meiosis. Recombination of ___ genes occurs because of independent assortment
linked, unlinked
A gene's specific location along a chromosome is?
locus
As cell prepares for mitosis, chromatin is organized into ___ and ___ which eventually condednses into short, thick ____ chromosmes
loops, coils, metaphase
Acetylation of histone tails promotes ____ _____ _____ that permits transcription. A region of chromatin in which nucleosomes are ______ forms a more condensed arrangement of chromatin in which the DNA is not transcribed. When nucleosomes become highly acetylated the chromatin becomes less condensed, and the DNA is accessible for _____
loose chromatin structure, unacetylated, transcription
Error rate after proofreading is _ but not _
low, zero
Recessive mutant allele is denoated by?
lowercase NO +
Reverse transcriptase PCR purpose
making copies of specific RNA sequence due to use of a primer, used to determine the effect of gene expression is because it works backwards by utilizing reverse transcriptase to create a cDNA strand from an RNA template. In that sense, if we already know what the RNA does, we can use RT-PCR to figure out the gene responsible for coding those instructions.
In a linear chromosome of a eukaryote, replication bubbles form at ____ sites along the giant DNA molecule during __ ___ of interphase. The bubbles expand as replication proceeds _____. Eventually, the bubbles ___ and synthesis of the daughter strands is complete.
many, S phase, bidirectionally, fuse
Dispersive Model
material in the two parental strands is distributed more or less randomly between two daughter molecules. In the model shown here, old material is distributed symmetrically between the two daughters molecules. Other distributions are possible.
Each person, being diploid has a ___ ____ and a ___ ____ for each short tandem repeat
maternal allele, paternal allele
Mitochondrial inheritance is _____ and these genes are not ____ like nuclear genes during meiosis.
maternal, segregated
Extranuclear genes are inherited ___ bc the zygote's cytoplasm comes from the egg
maternally
Resemblance of offspring to parents relies on accurate replication of DNA prior to _____ and its transmission to next generation
meiosis
Beta gal is needed to _____ lactose
metabolize
Polypeptides are synthesized in one direction from the initial _____ at the amino end aka the __ _____ toward the final amino acid at the ____ ____ aka __ _____
methionine, N terminus, carboxyl group, C terminus
Repetitive DNA at eukaryotic centromeres is heavily _______ and therefore has a lot of ______
methylated, H3K9me
Actions of writers or readers are responsible for _____ or _____ domains. Writer domains __ chromatin and eraser domains ___ chromatin. Chromatin post translation modifications control ___ of protein domains that ___ the modification
methylating, demethylating, add, erase, binding, read
X inactivation in females is also a _________ ______ _______ ________. A result of whether _____ is a
methylation chromatin dependent process
After DNA repliation, if one strand is already methylated, then a ____ _____ will methylate the other strand. This is ____ _____
methytransferase enzyme, maintenance methylation
Double stranded region is processed into an active ____ near base of double stranded stem
miRNA
____ and the _____ complex is similar to CRISPR Cas system (a short RNA sequence binding to a protein complex to target nucleic acids)
miRNA, RISC
DNA ligase catalyzes an energetically unfavorable _____ _____ driven by being coupled to the energetically favorable process of ___ _____. The nick sealing reaction results in _______ bonds between 3' OH and 5' phosphate
nick-sealing reaction, ATP hydrolysis, phosphodiester
DNA is a polymer of nucleotides. It consists of a ______ ___, a ____, and a _____ _____
nitrogenous base, sugar, phosphate group
Most euk genes and their RNA transcripts have long _____ stretches of nucleotides that lie btwn coding regions
noncoding
Multicellular eukaryotes have lots of?
noncoding DNA
Sequence conservation in some _____ ______ suggests that these regions have some important functions
noncoding DNA
microRNAs (miRNAs)
noncoding RNAs that regulation RNA degradation and translation
The siRNA system in yeast interacts with other, larger _____ ________ and with _______ _______ __________s to condense the centromere chromatin into heterochromatin through __________ _______ ________
noncoding RNAs, chromatin modifying enzymes, RNA directed DNA methylation
Introns
noncoding segments in a gene
Eukaryote genes are _ functionally clustered, unlike prokaryotes. Genes that are part of same pathway on eukaryotes can be found on very different ____
not, chromosomes
Heterchromatin is more highly condensed and generally __ expressed since ____ _____ can't get in
not, transcription factors
Histone tails protrude outward from a _____. The amino acids in the histone tails are accessible for chemical modification.
nucelosome
Maternal inheritance of mitochondrial genes is dinstinct from the chromosomes of the ___ ____, is a form of _____ inheritance
nuclear genome, non Mendelian
SARS-CoV-2 is an enveloped virus with a large ~30 kb positive-sense ssRNA genome • The genome is coated with the _____ (N) protein • The lipid bilayer envelope contains 3 membrane proteins: ____, ___, ____ • The S protein is required for viral entry into host cells by ____ to the angiotensin-converting enzyme 2 (____) receptor protein
nucleocapsid, spike, membrane, envelope, binding, ACE2
Each nucleotide added to a growing DNA strand is
nucleotide triphosphate
For double stranded DNA viruses to infect a eukaryotic cell, they need to get into the ______. In comparison RNA viruses with a single stranded/double stranded/+ strand/- strand RNA (except for viruses w ____ _____) only need to get into the _____. Getting into the cytoplasm is easier. If we have a double stranded DNA virus trying to get into bacteria, they do not have to get into the ____
nucleus, cytoplasm, reverse transcriptiase, nucleus
Most chromatin is loosely packed in the ____ during ____ and condenses prior to ____
nucleus, internphase, mitosis
Gene density
number of genes in a given length of DNA
What is a frameshift mutation
number of nucleotides inserted or deleted isn't a multiple of 3, alters reading frame of genetic message and results in extensive missense mutations
Ploidy
number of sets of chromosomes in a cell
Inducible operon: usually __ but can be stimulated to be on when?
off, a specific small molecule interacts w a different regulatory protein
In asexual reproduction, a single individual passes all of its genes to its ______, WITHOUT the ______ ____ _____
offspring, fusion of gametes
rRNAs form?
ribosome
Sites of translation
ribosomes
tRNA binds to ____ during translation
ribosomes
The virus makes use host enzymes, _____, _____, ______ _____, ____, and other molecules
ribosomes, tRNAs, amino acids, ATP
genetic analysis of enhancer elements allows us to figure out their ___ through mRNA level of impact. Removing different enhancer elements has different ___
role, effects
Both Group 3 and Group 4 viruses require the ___ ____ before becoming mRNA
same protein
Genetics
scientific study of heredity and variation
Because the plasmid contains a ____ ____ ____ (usually for antibiotic resistance), only the bacterial cells that get the plasmid can survive and grow on the antibiotics. This is because there are selective conditions where only the cells that contain the plasmids with the appropriate selectable marker can survive. Selectable markers allow us to identify whether the vector has been introduced to the ___ ___ or not and it confers a trait suitable for ___ ____.
selectable marker gene, host cell, artifical selection
Transposable elements are often termed ______ ______ because they are parasitic DNA sequences that inhabit a host genome. Over time, many copies of selfish DNA are inactivated by mutations and deletions, leaving DNA remnants called ______ ______
selfish DNA, junk DNA
Sequencing technologies take advantage of the ____ nature of DNA
semiconservative
Quorum Sensing
sensing concentration of signaling molecules, allows bacteria to monitor cell density
transposable elements
sequences of DNA that move/jump from 1 location of genome to another
Metagenomics
sequencing of DNA from environemntal samples
Only eukaryotes are capable of ______ ______. They're also capable of _____ ______
sexual reproduction, asexual reproduction
Short tandem repeats
short sequences of 2-5 base pairs that are tandemly repeated a different number of times in different pepople's genomes
In plants, de novo methylation (methylation of unmethylated CG dinucleotide) is directed by ____
siRNAs
Major difference between siRNAs and miRNAs
siRNAs: inhibit expression of one specific target mRNA miRNAs: regulate expression of multiple mRNAs
RNA polymerase holoenzyme
sigma factor and RNA polymerase interact
RNA interference (RNAi)
silences the expression of selected genes. uses synthetic double stranded RNA molecules matching the sequence of a particular gene to trigger breakdown of a gene's mRNA or to block its translation
Viruses have ___ structure than prokaryotes and are not ___. They can't reproduce and don't have a _____ outside of the host
simpler, cells, metabolism
Single nucleotide polymorphisms
single base pair site where variation is found in at least 1% of the population
In situ hybridization
single stranded DNA or RNA sequence (called a probe) is allowed to form complementary base pairs with DNA or RNA present in a tissue or chromosome sample. The probe has a chemical or radioactive label attatched so that its binding be observed
Viruses can have ___ _____ DNA genomes and still be stable. They require ____ ____ to first become double stranded DNA before becoming _____.
single stranded, DNA polymerase, mRNA
Multigene families evolve from ___, ____ genes
single, ancestral
RNA of spliceosome also catalyzes?
the splicing reaction
Addition Rule
this OR that - use for mutually exclusive - used for unlinked genes (Independent events)
Chromosomal basis of Mendel's Laws
we see it in the law of segregation (2 alleles for a gene separate and end up in different gametes) and law of independent assortment (1 allele for a gene doesn't affect the expression of another allele for a different gene)
Gal4 has a DNA binding domain called a ___ ____ and a negatively charged ____ _____. The Gal4 binding site is more than ___ base pairs away from the promoter TATA box
zinc finger, activiation domain, 250
How could one find new chemical synthesis (e.g., antimicrobials) or degradation pathways in an organism?
•Enzyme similarity based on predicted polypeptide sequences •Direct testing of environmentally acquired samples, followed by identification of causative genes using sequencing and cloning • Gene similarity in the genome sequence