Bio

Which of the following do you have less of at the end of cellular respiration than at the beginning? a. the proteins of the electron transport chain b. NADH c. ATP synthase d. Co-enzyme A e. glucose

E

Which of the following reactions is most likely the one shown in the graph on the back of your cover sheet? a. carbon dioxide and water to glucose and oxygen b. sucrose to glucose and fructose c. ADP and Pi to ATP d. a phosphorylation reaction e. ATP to ADP and Pi

E

Assuming no mutations and before crossing over, sister chromatids a. have centromeres in the same locations. b. are joined during fertilization. c. have different gene loci. d. have different lengths. e. have different alleles.

A

During elongation of translation, which of the following happens next after a peptide bond is formed? a. the mRNA and tRNA in the A site move to the P site of the ribosome. b. the anticodon on a tRNA base pairs with the codon on an mRNA. c. a new charged tRNA base pairs with the codon in the P site. d. a new charged tRNA makes covalent bonds with the codon in the A site of the ribosome. e. the small subunit of the ribosome makes covalent bonds with the large subunit.

A

If you ran a blood test and found normal or high concentrations of insulin and higher than normal concentrations of glucose in a patient an hour after they drank a glucose solution, you would predict that the person a. had type II diabetes. b. had a damaged pancreas. c. was exercising more than usual after drinking the glucose solution. d. had low concentrations of glucagon in the blood. e. had a damaged liver.

A

Lactose affects the expression of the lac operon, by ________ the expression of genes that make ________. a. increasing, enzymes that break down lactose b. decreasing, enzymes that break down lactose c. increasing, enzymes that synthesize lactose d. decreasing, enzymes that synthesize lactose

A

The average net productivity of open ocean and of tundra are roughly equal to each other and are each about 150 g/m2/yr. The Earth has more open ocean than it has tundra. From this information you would predict that a. more of the Earth's net primary production is from open ocean, than from tundra. b. less of the Earth's net primary production is from open ocean, than from tundra. c. added together the open oceans and tundra of the Earth produces 300 g/yr of biomass. d. added together the open oceans and tundra of the Earth produces 150 g/yr of biomass. e. an equal amount of the Earth's net primary production is from open ocean and from tundra.

A

The purpose of mitosis is a. to get exactly one copy of each chromosome into each daughter cell. b. to get exactly one copy of each type of chromosome into each daughter cell. c. stop cell division if there is a mistake in DNA replication. d. get both copies of every other chromosome into each daughter cell. e. replicate the DNA.

A

Consider the carbon cycle and the role of primary producers, primary and secondary consumers and decomposers. Which of these organisms cycle fixed carbon back into carbon dioxide? a. just the producers b. the producers, consumers and decomposers c. just the decomposers d. just the producers and decomposers e. just the consumers and decomposers

B

For this question assume that you do not create or destroy any start or stop codons. The following codons code for the amino acid indicated by its three letter code: AUG-Met, UUU-Phe, GCG- Ala, GAA- Glu, UAU-Tyr, CGU-Arg, CGG-Arg, AGA-Arg, UGA-Stop. What would happen if you made the following mutation that is a single base substitution? Original: AUGUUUUUUGCGUAUCGUAGAUGA Mutated: AUGUUUUUUGCGUUUCGUAGAUGA a. Several amino acids will be different. b. One amino acid will be different. c. The protein will be shorter. d. The protein will be the same. e. The protein would not be made.

B

Red flowers show incomplete dominance. If you cross a P generation of plants with red flowers (RR) and white flowers (rr), what phenotypic ratio of flower color would you predict in the F2 generation? a. 2 red: 1 pink: 1 white b. 1 red: 2 pink: 1 white c. 3 red: 1 white d. 1 pink: 3 white e. all pink

B

The cardiovascular system does NOT....... a. carry the carbon dioxide generated by the muscles. b. carry the ATP generated by cellular respiration. c. carry the oxygen inhaled via the pulmonary system. d. carry the nutrients absorbed by the digestive system. e. carry the hormones released by the endocrine system.

B

What is a similarity between transcription and DNA replication? a. They both create new DNA nucleic acids. b. They both require a polymerase. c. They both occur in the cytoplasm. d. They both result in two new double helices. e. They both make new RNA nucleic acids.

B

The width of the a double helix of DNA is constant because a. a purine always pairs with another purine. b. a pyrimidine always pairs with another pyrimidine. c. a purine always pairs with a pyrimidine. d. the backbone of each strand of DNA is made of sugars and phosphates held together with covalent bonds. e. the two strands of DNA are arranged in an antiparallel orientation.

C

During oxidative phosphorylation a. ATP is used to make high energy molecules, such as NADH and FADH2. b. oxygen carries electrons through ATP synthase molecules to make NADH. c. the energy in a proton (H+) gradient makes ATP by chemiosmosis. d. glucose is oxidized to pyruvate. e. ATP is broken down into ADP and Pi by hydrolysis.

C

In a normal pregnancy, a human blastocyst implants in the __________ and becomes a human embryo. a. amniotic sac b. placenta c. endometrium of the uterus d. ovary e. oviduct

C

The purpose of the meiosis is a. to cause cancer. b. to make more exact copies of a cell. c. to get exactly one copy of each type of chromosome into each daughter cell. d. to make more copies of a cell for wound healing. e. merge a sperm cell with an egg.

C

Which of the following best describes the flow of energy through an ecosystem? a. sunlight energy enters, is converted to chemical energy then is permanently stored as fossil fuels b. heat enters, is converted to chemical energy and is released as light energy c. sunlight energy enters, is converted to chemical energy and is released as heat d. heat enters, turns into biotic chemicals, then is converted back to heat and released e. chemical energy enters, is converted to other forms of chemical energy, and is washed out of the ecosystem as medium-sized molecules

C

Which of the following would you predict would be used to carry energy in the bloodstream from one cell to another? a. pyruvate b. ADP c. glucose d. ATP e. NADH

C

61. If you look at cells under a microscope, in eukaryotes, but NOT prokaryotes, you would expect to see a. a single circular chromosome. b. ribosomes. c. a plasma membrane. d. endoplasmic reticulum. e. no membrane-bound organelles.

D

Covalent bonds between sugars and phosphate groups are found a. binding two molecules of DNA to each other across the middle of a double helix. b. holding water to DNA. c. binding nitrogenous bases to the deoxyribonucleic acid monomer. d. between neighboring deoxyribonucleic acid monomers in a molecule of DNA. e. between amino acids in polypeptides.

D

How many double helices of DNA are in one unduplicated chromosome? a. 23 b. 2 c. 8 d. 1 e. 4

D

If you look at cells under a microscope, in eukaryotes, but NOT prokaryotes, you would expect to see a. a single circular chromosome. b. ribosomes. c. a plasma membrane. d. endoplasmic reticulum. e. no membrane-bound organelles

D

If you look at cells under a microscope, in eukaryotes, but NOT prokaryotes, you would expect to see a. a single circular chromosome. b. ribosomes. c. a plasma membrane. d. endoplasmic reticulum. e. no membrane-bound organelles.

D

Not during glycolysis, but during fermentation a. Oxygen is required. b. All of the other answers are correct. c. pyruvate can be converted to lactose. d. NADH is converted to NAD+. e. NAD+ is converted to NADH.

D

Plants contain starches and cellulose. Starch and cellulose are polysaccharides (polymers of sugars). The carbon in starches comes from a. minerals from the dirt. b. cellulose from the dirt. c. the process of cellular respiration. d. carbon dioxide. e. pesticides.

D

The activation energy of a reaction a. determines whether a reaction is endergonic or exergonic. b. is positive for endergonic reactions and negative for exergonic reactions. c. is equal to the amount of energy released by the reaction. d. can be decreased by enzymes. e. determines whether the product will be potential energy or kinetic energy.

D

There is a population of 1000 crickets. 500 of the crickets are heterozygous for leg length, and 500 are homozygous for short legs. Long legs are recessive. What is the phenotype frequency of long legs in this population of crickets? a. 75% b. 25% c. 250 crickets d. 0% e. 50%

D

Which of the following situations is most likely if a eukaryotic cell is stuck at the M checkpoint a. The cell is in the process of DNA replication. b. There are errors in the replication of the DNA. c. The mitotic spindles are just starting to form. d. The cell is in mitosis with all but two of the chromosomes aligned on the metaphase plate. e. There are no growth factors, or nutrients.

D

Assuming no mutations, in one individual, two cells in different tissues have a. the exact same set of mRNA molecules. b. different RNA polymerase. c. the exact same set of proteins. d. different DNA sequences. e. different activated transcription factors.

E

Cats reproduce sexually, are diploid and have 38 chromosomes (n=19). Where do the chromosomes in a cat zygote come from? a. all 38 from an egg b. all 38 from a sperm cell c. all 38 from the mitotic division of a gamete d. all 38 from each gamete e. 19 from a sperm cell, 19 from an egg

E

Hydrogen bonds a. hold sequential nucleotides in a DNA molecule together along the backbone. b. are a type of peptide bond. c. are the strongest type of bonds. d. are a type of covalent bond. e. help determine the shape of a protein.

E

If you draw two strands (molecules) of DNA that are paired by hydrogen bonds, and there is a sugar end at the top and a phosphate end at the bottom of the right strand, then on the left strand a. the nucleotide T is at the top. b. a sugar end is at the top. c. either 3' or 5' can be at the top. d. 3' is at the top. e. 5' is at the top.

E

In human cells like we have been talking about in class, after transcription, but before translation, a. the mRNA enters the nucleus from the cytoplasm. b. a cap is removed from the mRNA. c. sugars are added to the mRNA in the Golgi. d. a carbon dioxide molecule is removed from pyruvate. e. a tail is added to the mRNA.

E

When a gene is expressed, it means that the protein that it codes for is being made by transcription and translation. Imagine two genes in a eukaryote. One is gene X. The other is gene A. In the cells you are studying, gene X is being expressed, and gene A is not being expressed. Which prediction below is most likely true in these cells? a. There is more mRNA for gene A than for gene X. b. There are more promoters for gene A than gene X. c. There are more copies of gene A than gene X. d. There are more operons for gene X than for gene A. e. There are more activators for gene X than for gene A.

E

Why do we have many definitions of species? a. to confuse biology students b. because there is no evidence for evolution c. to distinguish between species that reproduce sexually and those that reproduce asexually d. because we need different definitions for plants versus animals e. because we have different questions and different data in various situations

E

You are in a lab studying a new reaction. The reaction breaks a bond between two carbon atoms and does not make any new bonds. You would predict that your new reaction a. is endergonic. b. will need to be coupled to the reaction that breaks ATP into ADP and P. c. has more energy in the products than in the reactants. d. has the same amount of energy in the products and the reactants. e. is exergonic.

E

You remove four nucleotides from an mRNA, without disrupting or creating any start or stop codons. What would be the result? a. an insertion b. no change in the protein c. a point mutation d. exactly one amino acid would be different in the protein e. a frameshift mutation

E