Bio chem additional questions unit 4

The polymerase chain reaction is a tool used to study protein structure.

False Reason: This statement is FALSE. PCR is a tool used to amplify a specific segment of DNA.

What is the coding strand sequence if the non-template strand sequence is 5'- AGC CTT TAA CTA-3? 3'-AGC CTT TAA CTA-5' 3'-AGC CTT TAA CTA-5' 3'-ATC AAT TTC CGA-5' 5'-TCG GAA ATT GAT-3'

3'- ATC AAT TTC CGA -5' Reason: It is important to recognize that he names 'coding strand and 'non-template' strand refer to the exact same piece of DNA. Therefore, if the non-template strand is 5'-AGC CTT TAA CTA-3', then the coding strand is exactly the same sequence (because it is the same piece of DNA) However, it is written with its 3' end on the left in the possible answers (3'-ATC AAT TTC CGA-5'). We simply reverse the sequence' 5'-AGC CTT TAA CTA-3'

Assuming there is one copy of the target DNA sequence before PCR, how many copies of DNA are thereafter 5 PCR cycles?

32 Reason: Each cycle doubles the numbers of DNA copies. Round 1: 1- >2. Round 2: 2 ->4. Round 3: 4 -> 8. Round 4: 8 ->16. Round 5: 16 >32.

The following sequence is the coding DNA strand of the collagen gene: 5' ATG GCG TTC GAA 3' What is the sequence of the corresponding MRNA? 3' ATG GCG TTC GAA 5' 5' UTG GCG TTC GUU 3' 5' AUG GCG UUC CUU 3' 5' AUG GCG UUC GAA 3'

5' AUG GCG UUC GAA 3' Reason: coding strand and the MRNA both go in the same direction, but the MRNA contains Us instead of Ts.

Which of the following would be considered a point mutation to a DNA strand that consists of a nucleotide sequence: 5' CTG ACG TAT CTT AAT 3? Gentic code table used 5' CTG ACG TAT TCT TAAT 3' 5' CTG ACG TAT TTA AT 3' 5' CTG ACG TAT CTT AAT 3' 5' CTG ACG TAA CTT AAT 3'

5' CTG ACG TAA CTT AAT 3' Reason: The sequence, 5' CTG ACG TAA CTT AAT 3', is correct because a point mutation changes a single nucleotide in a codon, in this case, changing the T in the third position of the third codon to a (TAT > TAA).

If the coding (non-template) DNA sequence of a normal gene is 5' GTC GCA TGG TGA 3', which DNA sequence would represent a nonsense mutation? Genic code table used not pictured :

5' GTC GCA TAG TGA 3' Reason: The correct answer is "5' GTC GCA TAG TGA". A point mutation (single nucleotide change in a codon) that changed the G in the second position of the third codon (TGG) into an A (TAG) changed the amino acid tryptophan (Trp) into a premature stop codon This is a point mutation in the DNA that would result in a nonsense mutation in the protein. The sequence, 5' GTA GCG TGG TGA 3', is incorrect because the change here (GTC to GTA in the first codon) would change one Val codon to another Val codon. This is a point mutation in the DNA that would result in a silent mutation in the protein.

If the coding (non-template) DNA sequence of a normal gene is 5' GTC GCA TGG TGA 3', which DNA sequence would represent a deletion mutation? 5' ATC GCA TGG TGA 3' 5'GTC GCA TAG TGA 3' 5' GTC GCA TGT GA 3' 5' GTA GCG TGG TGA 3' Gentic code table used

5' GTC GCA TGT GA 3' Reason: The sequence, '5' GTC GCA TGT GA 3" results from a mutation that removes a G from the third codon (TGG). Then, the first T from the 4th codon becomes the third base of the third codon, 'shifting' the reading frame. This is a deletion mutation in the DNA. Notice that there are now fewer nucleotides in the mutant gene compared to the normal gene.

DNA polymerase can synthesize new DNA strands in which direction?

5' to 3' Reason: DNA needs a free 3' end to bind to and initiate synthesis of a DNA. It synthesizes in a 5' to 3' direction.

What would be the resulting mRNA seguence from a template strand with this sequence: 5'-CAG CTC GTC-3?

5'-GAC GAG CUG-3' Reason: Recall that sequences that bind each other (are complementary) must also be antiparallel (running in opposite directions). The sequence that is complementary to 5'-CAG CTC GTC- 3' is 3'-GUC GAG CAG-5'. Since the possible answers in the list to choose from are presented with their 5' ends on the left, we simply reverse the sequence to get 5'-GAC GAG CUG-3'. 3'-GUG GAG GAG-5' results from pairing G with both C (correct) and G (incorrect).

During DNA replication, which of the following sequences can be used as a primer for the following DNA sequence: 3' AGT GGA TCA CTA GGC TCT 5'? (Recall that DNA replication uses RNA primers whereas PCR uses DNA primers). 5' TCA CCT AGT GAT 3' 5' UCA CCU AGU GAU 3' 3' UCA CCU AGU GAU 5' 3' TCA CCT AGT GAT

5'UAC CCU AGU GAU 3' Reason: First note that the question asks for an RNA sequence. Since RNA uses U and DNA uses T, we know that any sequence with T in it must be DNA. Therefore, we can eliminate those answers right away. During DNA replication, RNA is used as a primer for the DNA polymerase. Recall that primers are complementary and antiparallel to the strand of DNA that is being copied. The complementary RNA sequence for 3' AGT GGA TCA CTA GGC TCT 5'? is 5' UCA CCU AGU GAU CCG AGA 3'. Thus 5' UCA CCU AGU GAU 3', which is contained within the sequence above (beginning at the 5' end), could serve as a complementary primer for DNA synthesis.

Which of the following is the correct tRNA anticodon for the MRNA codon 5' GCA3'?

5'UGC 3' Reason: First note that the question asks for an RNA sequence. Since RNA uses U and DNA uses T, we know that any sequence with T in it must be DNA. Therefore, we can eliminate those answers right away. MRNA binding to tRNA is also complementary and antiparallel. Thus, the complementary sequence to 5' GCA 3' is 3' CGU 5', Because the answers are presented with the 5' end on the left, we 'flip' the sequence to get 5' UGC 3'.

Given the following modification of the nucleosomes, discuss how the transcription and gene expression is impacted. In A, the nucleosomes are less condensed, and in B they are more tightly wound. Would A or B foster the ability to have more active transcription of genes DNA packing around modified nucleosomes?

A Reason: B is incorrect. When the histones of the nucleosomes have DNA wound tightly around them, less DNA is available to be bound and activated by transcription factors. the

А____. ↪️ (circle other way with DNA in middle)➡️ В____. ( above arrow) RNA ➡️C___( above arrow) Protein Match the letters with the correct names of the processes of the central dogma (Replication; Transcription; Translation).

A) replication, B) transcription C) translation Reason:The central dogma starts with DNA, which is able to be replicated to prepare for cell division (A). DNA in the nucleus can also be accessed and transcribed to MRNA (B). The MRNA will leave the nucleus and enter the cytoplasm where it will be translated protein by the ribosome (C).

If one strand of chromosome 2 has a DNA sequence that consists of this: 5'AAG CGG TAC GTA 3' What will be the composition of the complementary DNA strand? A) 5' TTC GCC ATG CAT 3' B) 5' TAC GTA CCG CTT 3' C) 3' AAG CGG TAC GTA 5' D) 3' TTC GCC ATG CAT 5'

B and D Reason: All complementary base pairing must be antiparallel. The strand that is complementary to 5' AAG CGG TAC GTA 3' is 3' TTC GCC ATG CAT 5'. If we simply read the sequence backwards, from right to Left, we get 5' TAC GTA CCG CTT 3'. Thus, both of these are the correct answers

The LEP gene codes for an anorexigenic hormone. Interestingly, breastfeeding has been shown to alter methylation of the promoter of this gene, leading to increased LEP expression. What is likely happening in response to breastfeeding:

Breastfeeding decreases the methylation of the promoter of the LEP gene, increasing the spacing between nucleosomes. Reason: When histones wrap up DNA, transcription will be repressed.

The following are steps involved in the polymerase chain reaction. Which is the correct order:

Denaturation, annealing, and elongation Reason: PCR uses repeated cycles of temperature to amplify particular DNA segments. In the first step, the reaction mixture is heated to separate the DNA strands (denaturation). The reaction then cooled to allow the DNA primers, which define the sequence be amplified, to anneal (base pair) with the template DNA. In the third step, DNA polymerase extends the DNA primers to create a copy of the target DNA sequence. Heating the reaction to stop polymerization and separate the DNA strands starts the cycle over again.

When the wrong nucleotide is added to a newly forming DNA strand during DNA replication:

Distortion of the double helix structure occurs because of uncomplimentary pairing of the nucleotides Reason: The correct answer is 'Distortion of the double helix structure occurs because of uncomplimentary pairing of the nucleotides'. A mismatch (A with C or G, T with C or G) causes a bump to form in the DNA double helix, which is recognized by the proof- reading capability of DNA polymerase or by mismatch repair.

Which of the following changes can NOT be detected using PCR?

Epigenetic changes Reason: Epigenetic changes do not affect the sequence of the DM PCR is used to look at the DNA sequence.

Which of the following components are involved in the process of actively transcribing a gene?

Epigenetic modifications to nucleosomes, promoters, RNA polymerase, transcription factors Reason: Epigenetic changes result in modifications of the nucleosomes that affect chromatin packing and transcription. an Transcription Factors are specialized proteins that recognize specific promoter sequences and bind to them. Once bound to the promoters, the transcription factors recruit RNA polymerase to the transcription start site. RNA polymerase begins transcribing the gene sequence into a new RNA molecule,

Some changes to the DNA do not modify the coding sequence of the DNA but do affect its winding and unwinding from nucleosomes. These changes can increase or decrease the availability of DNA and hence, the transcription of a gene. These are called ______changes.

Epigentic Reason: Epigenetic changes result from modifications of the DNA that affect nucleosome spacing and, therefore, transcription. They do not alter the DNA sequence itself.

Mismatch repair:

Fixes mistakes made by DNA polymerase during DNA replication Reason: Mismatch repair fixes errors in DNA replication made by DNA polymerase.

Nucleotide excision repair:

Fixes multiple damaged nucleotides Reason: The correct answer is 'Fixes multiple damaged nucleotides'. Nucleotide excision repair, which replaces several damaged nucleotides.

Base excision repair:

Fixes single damaged nucleotides Reason: Base excision repair is the repair mechanisms utilized for replaced a single damaged nucleotide.

What would the amino acid sequence be from this coding strand sequence: 5'- GGA AGG CCC-3'? Gentic code table not present

Gly Arg Pro Reason: The MRNA transcribed from the template strand is complementary and antiparallel to it. The coding strand of DNA (also called the non-template strand) is also complementary and antiparallel to the template strand. Thus, translating 5'-GGA AGG CCC- 3' gives us Gly Arg Pro.

What would the amino acid sequence be from this coding strand sequence: 5'- GGA AGG CCC-3? Genic code table not present

Gly Arg Pro Reason: The mRNA transcribed from the template strand is complementary and antiparallel to it. The coding strand of DNA (also called the non-template strand) is also complementary and antiparallel to the template strand. Thus, translating 5'-GGA AGG CCC- 3' gives us Gly Arg Pro.

Proteins that promote coiling of DNA and help prevent DNA strands from "tangling" are called?

Histones Reason: The combination of DNA and histone proteins creates nucleosomes.

If the coding (non-template) DNA sequence of a normal gene is 5' GTC GCA TGG TGA 3', what kind of mutation would create the mutant gene sequence 5' GTC GAC ATG GTGA 3? Deletion mutation Insertion mutation Nonsense mutation Silent mutation Genitc code table used

Insertion mutation Reason: The correct answer is 'insertion mutation'. An insertion mutation adds nucleotides to a gene and is a type of frameshift mutation, which changes the way the mRNA codons are read, changing the amino acid sequence. All point mutations are characterized by changing a single nucleotide- not by adding nucleotides. A nonsense mutation changes a codon for an amino acid into a STOP codon.

What changes can occur to the DNA and to the histones that will impact gene expression?

Methylation Reason: Methyl groups can be added to DNA (methylation) without altering the DNA sequence. DNA methylation changes the spacing of nucleosomes. Acetyl groups can also be added to histones (acetylation) and this also changes the spacing of nucleosomes. Nucleosome spacing affects the transcription of genes.

Which statement is true with respect to mismatch repair and nucleotide excision repair (NER)?

Mismatch repair follows the same steps as NER. Reason: Mismatch repair does not repair 'damaged' DnA onlt when two bases are paired incorreclty. NER repairs thymine dimers

Several components of cigarette smoke, including benzopyrene, insert themselves (intercalate) into the DNA between nucleotides and lead to several types of mutations such as frameshift mutations, including both insertions and deletions. Which of the following repair pathways would be used to repair this type of damage?

Nucleotide Excision Repair Reason: The correct answer is 'nucleotide excision repair'. Nucleotide excision repair is used to repair deletions, insertions, and helix- distorting lesions, such as thymine dimers.

Which of the following components is NOT used in PCR?

RNA polymerase Reason: RNA polymerase is not used in PCR. PCR makes a DNA copy, so DNA polymerase is used.

What is the proper order of the steps involved in excision repair?

Recognize the damage, remove the damage, resynthesize the sequence, ligate the DNA backbone. Reason: The correct sequence is 'Recognize the damage, remove the damage, resynthesize the sequence, ligate the DNA backbone.

Template DNA strand ➡️3' ATCTGTCCAAGTGCATGCATCAATTGCCGTCAAGTCATGCATGTCA 5' 5'GTTCACGTACGTAGTTAACGGCAGTTCACTAC ➡️elongation Elongation of DNA during PCR What color is the primer in the following diagram?

Red Reason: Recall that DNA polymerase needs a primer to begin DNA synthesis. This requirement means the primers will direct the DNA polymerase to synthesize complementary strands of the target DNA. Note: In DNA replication, the primers are RNA primers, while PCR generally uses DNA primers because they are more stable.

Homologous recombination:

Repairs a broken chromosome using genetic information from same chromosome inherited from other parent. Reason: The correct answer is 'repairs a broken chromosome by using information from the other copy of that chromosome inherited from the other parent'. Homologous refers to the pair of same chromosomes (same genes in same order, except different alleles) you inherit from each parent - for example, the two chromosome 12s in your cells, one from your mother and one from your father. Homologous recombination fixes broken chromosomes using DNA in the same position on the homologous chromosome as a template to fix the broken chromosome. Homologous recombination also shuffles DNA between the pair of chromosomes adding genetic variation.

Which of the following statements about epigenetics is false?

The DNA sequence is permanently altered. Reason: The DNA sequence is not permanently altered by epigenetics. Epigenetics involves reversible changes to the DNA or to histone proteins. These changes, such as adding or removing methyl groups from DNA or acetyl groups from histone proteins, respond to environmental stimuli. Such changes can increase or decrease nucleosome spacing, which can make the promoter of a gene accessible or inaccessible. In this way, epigenetic changes influence gene expression.

A patient with xeroderma pigmentosum is prone to developing multiple skin Cancers starting in childhood, This occurs because of a mutation in a gene that codes for enzymes that help repair DNA damage through the nucleotide excision repair (NER) pathways. How does NER differ from other repair mechanisms? In NER:

The error in one strand of DNA is removed as well as several nucleotides on either side of the error. The gap that was removed is filled in by DNA polymerase Reason: The correct answer is that nucleotide excision repair replaces several damaged nucleotides plus additional nucleotides and uses the DNA on the opposite strand as a template to fill in the gap.

When comparing a normal and mutant gene sequence, how do you identily a frameshift mutation?

The number of nucleotides between the normal and mutant gene sequences is different and the amino acid sequence is different. Reason: The correct answer is The number of nucleotides between the normal and mutant gene sequences is different and the amino acid sequence is different.' Errors that increase or decrease the number of nucleotides in a gene cause frameshift mutations. The insertion of an extra-base or the removal of one of the bases will change which groups of three bases that the ribosome reads when it translates the message. This is said to 'shift' the 'reading frame' from the correct groups of three bases to different groups of three.

The LCT gene codes for Lactase, which is responsible for the breakdown of lactose. Which of the following statements could explain how Lactase activity is increased in the presence of lactose?

The presence of lactose causes nucleosomes to separate, exposing the LCT gene. Reason: this case, the presence of lactose in the diet is an environmental stimulus. In response to this stimulus, DNA may be modified by the addition or removal of methyl groups and histones may be modified by the addition or removal of acetyl groups. These changes can alter the spacing of nucleosomes and therefore, affect gene expression

Genetic code table. ( not shown) What would be the amino acid sequence that would result from this template sequence: 5'-TGC AAG CCA-3?

Trp Leu Ala Reason: The RNA polymerase enzyme makes mRNA by antiparallel and complementary base-pairing with the template strand of DNA. Therefore, the mRNA transcribed from this template would be 3'- ACG UUC GGU-5'. MRNA codons are read 5' --> 3' on the genetic code table. 'Flipping the sequence gives us 5'-UGG CUU GCA-3'. Using the genetic code table, we see that UGG encodes Trp; CUU encodes Leu; and GCA encodes Ala: Trp Leu Ala.

dNTPs are DNA nucleotides used in PCR.

True Reason: This statement is TRUE. DNTPS stands for deoxynucleotide triphosphates, which are the nucleotides used in DNA synthesis.

DNA polymerase is used in DNA replication and in PCR.

True Reason: This statement is TRUE. Both PCR and DNA replication of a require DNA polymerase to make new copies of DNA.

A thermocycler is a machine used for PCR that varies the temperature of a sample.

True Reason: This statement is TRUE. The thermocycler is the machine that is used to vary the temperature of the samples. For PCR, in each cycle, the two strands of the duplex DNA are separated by heating, then the reaction mixture is cooled to allow the primers to anneal (or pair) to their complementary segments on the DNA. Next, the DNA polymerase directs the synthesis of the complementary strands. The use of a heat-stable DNA polymerase eliminates the need to add fresh enzyme after each round of heating ( heat inactivated most enzyme) Hence, in the presence of sufficient qualities of primes and dNTPs, PCR is carried out simply by cycling through the different temperatures for stand separation, primer annealing and DNA synthesis

Point mutations:

change a single nucleotide in a mutant gene compared to the normal gene. Examples are missense, nonsense, and silent mutations. Readon: The correct answer is 'change a single nucleotide in a mutant gene compared to the normal gene. Examples are missense, nonsense, and silent mutations.' A single nucleotide change in the DNA is a point mutation. For example, changing an A for a C would be a point mutation. Point mutations do not increase or decrease the number of nucleotides in a gene, and they might (missense and nonsense mutations) or might not (silent mutations) change the amino acid sequence of the protein.

Frameshift mutations:

change the number of nucleotides in a mutant gene compared to the normal gene examples are insertion and deletion mutations. Reason: The correct answer is 'change the number of nucleotides in a mutant gene compared to the normal gene. Examples are insertion nd deletion mutations.' Errors that change the number of nucleotides in a gene (insertion/deletion) are said to 'shift' the 'reading frame' from the correct groups of three basses to new groups. To visualize what a frameshift is, imagine you are given a string of letters and told to start at the beginning and read every group of three letters: CATDOGRATPIGAPE. You would get cat dog rat pig ape . But if we add an extra letter, say CATDFOGRATPIGAPE, following our read every group of three rules, we would get cat dfo gra tpi gap e. Shifting our reading frame' by adding one more letter completely changes what we read. This is similar to what happens with a frameshift mutation.

A nonsense mutation:

changes a codon to introduce a premature stop codon Reason: A nonsense mutation occurs when a point mutation (change in single nucleotide) changes a codon to a STOP codon- which causes the protein synthesis to prematurely terminate. For example, UGC (codes for Cys) changed to UGA (STOP) would cause the protein synthesis to stop early resulting in a truncated protein (non functional).

A missense mutation:

changes a single amino acid in a protein. Reason: The correct answer is 'changes a single amino acid in a protein'. A single nucleotide change in the DNA (point mutation ) that changes a codon in the mRNA such that it codes for a different amino acid that it did before is called a missense mutation. The missense mutation changes one amino acid in the amino acid sequence of a protein. For example, changing the codon UUU (codes for Phe) to UUA (codes for Leu) is a missense mutation.

In the organization of DNA into chromosomes, DNA is wrapped around_____ to form nucleosomes. Nucleosomes are organized further to form______

histones; chromatin Reason: DNA is wrapped around proteins called histones to prevent tangling, and the combination of DNA and histone nucleosomes. The histones promote coiling of the nucleosomes into proteins creates a larger chromatin fiber.

Histone proteins can be chemically modified by the addition of a methyl group. If this causes nucleosomes to pack______ the process of ______is decreased at those DNA sites.

more tightly; transcription Reason: Changes to histone proteins or to DNA that result in tighter nucleosome packing make the DNA less available for transcription. Therefore, transcription is decreased.

A mutation in the DNA that changes the sequence of a codon but does NOT change the amino acid sequence of the protein describes a______

silent mutation Reason: A silent mutation is caused when a point mutation (single nucleotide change) occurs it changes the mRNA codon (triplet sequence that codes for amino acid), however, it doesn't affect the amino acid it codes for. For example, if a point mutation caused UUU (codes for Phe) to change to UUC- this is a silent mutation as both codons (UUU and UUC) code for Phe.

Which of the following is NOT a step in base excision repair?

• Synthesis of an RNA primer Reason : synthesis of an RNA primer is part of DNA replication, not DNA repair.