Bio-L211 Exam 3 Quick Checks for Studying

Which of the following statements about antisense oligonucleotide therapy (ASO) is true?

- In ASO therapy the antisense RNA sequence is complementary to the portions of the mRNA - to reduce toxicity ASO's are often modified at (2′) in ribose sugar in the RNA -Many early trials for ASO's were for eye and liver diseases as those tissues the RNA could be delivered particularly well.

An mRNA sequences contain information for

-the frequency of its own translation - how long it may be translated -synthesizing a polypeptide

The codon 5'-CAA-3' is in the A site. What is the sequence of the anticodon that will complementary base pair with this codon?

5'-UUG-3'

In the following schematic diagram of five pairs of alternative RNA splicing patterns, which pair depicts exon skipping only? In the diagram, exons are colored dark blue and introns are colored yellow. Light blue indicates possible exons.

A : The alternative splicing event shown in A is exon skipping: the third exon is missing (together with its flanking introns) in one of the two mRNA variants. Shown in B is the retention of a single intron (together with its flanking exons) in one of the mRNA

Which of the following provides the best explanation for the role of alternate splicing?

Alternate splicing provides a mechanism for increasing the number of mRNA transcripts and thus the number of different proteins that can be found within a cell, without the need to increase the size of the genome.

Serine-arginine rich (SR) proteins bind the exonic splice enhancers (ESE) and help ____

Assemble the splicesomes in correct locations of the pre-mRNA, prevent ectopic (i.e. random) splicing, regulate alternative splicing

In which region of a tRNA is the anticodon located?

B (end with Py, U, Pu)

Which of the following is not a feature of miRNAs? - A. Primary miRNA transcripts have internal complementary sequences capable of forming hairpin structures. - B. Precursor miRNAs have internal complementary sequences capable of forming hairpin structures. - C. miRNAs are exported to nuclease in their single-stranded form. - D. Precursor miRNAs are approximately 60-70 nucleotides long.

C. miRNAs are exported to nuclease in their single-stranded form.

Based on your viewing of the videos regarding Alternative Splicing and Spinal Muscular Atrophy (SMA) which of the following statements is false.

D. The cause of SMA is unregulated transcription and translation of a second gene SMN2 due to loss of SMN1 gene resulting in excess SMN2 protein.

The enzyme that cleaves the mRNA transcript targeted by siRNA is:

Dicer

The enzyme that catalyzes the initial processing of miRNAs in the nucleus is:

Drosha

In what location would uncharged tRNA most likely be found?

E site

What causes tRNAs to leave the hybrid state and fully occupy new sites in the ribosome?

Hydrolysis of EF-G-GTP to EF-G-GDP

In a eukaryotic cell, a molecule of pre-mRNA is found to have four exons and three introns. Which of the following are possible combinations of the exons, if the order in which they are written is the order in which they will be translated? I. Exon 1, Exon 2, Exon 3, Exon 4 II. Exon 1, Exon 3, Exon 4 III. Exon 4, Exon 1, Exon 2, Exon 3

I and II ; This question is asking about alternative splicing. Option 3 is not an acceptable transcript, however, because alternative splicing maintains the integrity of the genomic order of the exons (i.e. exon 4 will not come before exon 1, 2, or 3).

Which of the following is not true of the function of iron response elements (IREs)?

Iron regulates translation by binding directly to the IREs.

Translate the following mRNA into protein, starting from the first initiation codon: 5'- CCGAUGCCAUGGCAGCUCGGUGUUACAAGGCUUGCAUCAGUACCAGUUUGAAUCC-3

Met-Pro-Trp-Gln-Leu-Gly-Val-Thr-Arg-Leu-Ala-Ser-Val-Pro-Val

Given the wobble rules, what is the fewest number of tRNAs necessary to insert the amino acid Phe, and what is the anticodon for each tRNA? There are two codons that specify Phe: UUU and UUC.

One, with anticodon GAA

Iron response elements form:

RNA hairpin structures.

Below are some events that occur in the process of translating mRNA into a protein in a bacterial cell. Pick the best order of events. -EF-G-GTP binds to the tRNA in the A site and causes the tRNA to advance to the P site. -The rRNA in the ribosomal 30S subunit base-pairs with the Shine-Dalgarno sequence in the mRNA. -Peptide bond forms between the growing amino acid chain in the P site and the new amino acid in the A site. -IF-3 binds in the E site. -RRF binds in the A site. -RF-1 or -2 binds in the A site. -Ribosomal complex dissociates. -Peptide chain dissociates from final tRNA. -fMET tRNA binds to the start codon in the mRNA. -RF-3-GTP causes displacement of RF-1 or -2 and its exit from the ribosome -EF-G-GTP binds to the A site and causes RRF to shift to the P site. -A conformational change in the 30S subunit allows the 50S subunit to bind, forming the 70S ribosome.

Step 4 Step 1 Step 5 Step 11 Step 9 Step 6 Step 12 Step 7 Step 2 Step 8 Step 10 Step 3

Splice site identification in genome sequences is difficult mostly because ____________

The sequence consensus of the splice signals is quite degenerative

Which characteristic of the genetic code lowers the likelihood of mutation?

degeneracy

A collection of neurodegenerative diseases called Trinucleotide repeat disorders is caused by

expanding triplet repeat

What would happen to the half-life of a human mRNA if a nonhydrolyzable phosphodiester analog were introduced near its 5′ end?

half-life would increase

A frameshift mutation

introduces a section of amino acids not normally found in the protein

An open reading frame (ORF)

is a long sequence of nucleotide triplets with no stop codons.

The genetic code

is degenerate

Changing the codon AGC to AGA represents a ____ mutation.

missense

A point mutation that changes a codon specifying an amino acid into a stop codon is called a

nonsense mutation

Which type of bond is formed, and where, in the process of translation?

peptide bonds between the amino acids to produce the polypeptide chain

Which of the following is not a function of the RNA-induced silencing complex (RISC)?

primary miRNA transcript conversion to precursor miRNA

RNAi probably evolved as a mechanism to:

suppress infection by RNA viruses.

Efficiently translated mRNAs tend to be stable in the cytoplasm; those that are poorly translated tend to be rapidly degraded. Which of the following is not a step in the pathway for mRNA degradation?

targeting of upstream open reading frames for nuclease binding