BIOL 1010 Final Exam

Cystic fibrosis is the most common lethal genetic disease among Caucasians. with cystic fibrosis produce a mutated chloride (Cl-) channel protein that results in abnormal ion and water transport across epithelia such as that lining the lung, often making it difficult to breathe. Cystic fibrosis is inherited in an autosomal recessive manner; individuals who are heterozygous for the cystic fibrosis allele are carriers but do not exhibit the disease. An individual who has the disease has children with an individual who does not have the disease and is not a carrier. What is the chance that their child will have the disease?

0%

Red-green colorblindness is a sex-linked trait on the X chromosome. A man with color-blindness and a woman with no history of color-blindness in either the males or females of her family plan to have children. What is the probability that a son born to this couple would be color-blind?

0%

Cystic fibrosis is the most common lethal genetic disease among Caucasians. with cystic fibrosis produce a mutated chloride (Cl-) channel protein that results in abnormal ion and water transport across epithelia such as that lining the lung, often making it difficult to breathe. Cystic fibrosis is inherited in an autosomal recessive manner; individuals who are heterozygous for the cystic fibrosis allele are carriers but do not exhibit the disease. An individual who has the disease has children with an individual who does not have the disease and is not a carrier. What is the chance that their child will not have the disease?

100%

Red-green colorblindness is a sex-linked trait on the X chromosome. A man with color-blindness and a woman with no history of color-blindness in either the males or females of her family plan to have children. What is the probability that a daughter born to this couple would be a carrier?

100%

Which is of these is the complementary DNA strand to the following template DNA strand? 5'-ATTCGGTAACCC-3'

3'- TAAGCCATTGGG - 5

The American Bison has a total of 60 chromosomes. How many chromosomes would be found in its sperm?

30

A cross is performed between a plant with genotype TtYy and a plant with genotype Ttyy. T refers to height (tall) and Y refers to color (yellow or white). If the two genes independently assort, what is the probability, expressed as a percent, that the offspring will be homozygous for the height gene?

50%

The DNA of fraternal twins is _____ identical.

50%

In pea plants, yellow peas (Y) are dominant to green (y) and round peas (R) are dominant to wrinkled (r). Two pea plants were crossed, one homozygous dominant for yellow round peas and one homozygous recessive for green wrinkled peas. What was the phenotypic ratio of the F2 generation?

9 yellow round: 3 yellow wrinkled: 3 green round 1: green wrinkled

You are examining the microsatellite DNA of a potential criminal. When you run the gel, you find only one band at the locus you are interested in. Which genotype below is the only possibility for that locus?

9,9 (same numbers)

Which of the following base pairs would be targeted and repaired by a mismatch repair system?

A-G

Which of these sequences of RNA starts at the beginning of the reading frame?

AUGAGGUAACAUACCCACGG

The characteristics of viral genomes show many variations. Which of the following does not describe a typical characteristic of viral genomes?

All of these describe typical variations in viral genomes.

The Law of Independent Assortment means that

Alleles for different traits do not have to be inherited together (ex. Red hair and blue eyes are not linked

Which of the following statements about alternative splicing is correct?

Alternative splicing leads to different protein products with different functions. Increase the number of proteins it can produce without having to increase the size of its genome. Alternative splicing is common in all eukaryotes, but uncommon in prokaryotes. Alternate forms of a protein are made by different cell types, or at different stages of development, from a single gene in the genome.

Individuals with Turner's syndrome have only one X chromosome and no Y. This is most likely due to an error during

Anaphase of meiosis

You transform bacteria with a plasmid carrying the ampicillin-resistance gene amp R. How would you determine which bacteria took up the plasmid?

Bacteria containing the plasmid would be able to grow in the presence of ampicillin.

Soon after the introduction of antibiotics, resistant strains of bacteria that could grow in the presence of particular antibiotics began to evolve. Researchers develop new antibiotics, only to see resistant bacterial strains evolve within a few years. Which of the following explains why resistant strains of bacteria can evolve so quickly?

Bacteria have a short generation time and can transfer plasmids containing resistance genes by horizontal gene transfer mechanisms such as conjugation.

The drug Plavix requires the enzyme CYP2C19 to take it from the prodrug form to the drug form (enzyme A below) and it requires the enzyme CES1 to convert it from active to inactive (enzyme 1 below). The active form of the drug is effective in preventing blood clots but is toxic in higher doses. Individuals with a mutation in this CES1 gene produce a version of CES1 that is not functional. You are a physician trying to determine the dosage of Plavix for a patient who is homozygous for the mutated version of the gene. What should you do?

Choose another drug as the individual will likely suffer from too much toxicity

In our case study, we learned about a type of antibiotic that binds to the DNA-DNA gyrase complex, preventing proper uncoiling of DNA for replication.

Ciprofloxacin

If DNA polymerase is not functioning normally, what is likely to occur?

Complementary bases will not be added to create a daughter strand

When a single chromosome has completed replication it now

Consists of sister chromatids

Why do complementary nucleotides across the double-stranded DNA bond together using hydrogen bonds rather than covalent bonds?

Covalent bonds would be too strong to allow the double helix to easily separate and make templates available for replication and transcription.

Transcription factors attach to

DNA

Which of these accurately depicts the Central Dogma as understood by Francis and Crick?

DNA codes for RNA which codes for protein

Eukaryotic cells store their DNA in the form of linear chromosomes. This creates problems for replication of DNA at the ends of the chromosomes because

DNA polymerase can only synthesize DNA in the 5' to 3' direction

Okazaki fragments are needed because

DNA replication only occurs in one direction

A protein that acts as an endonuclease and breaks down RNA during the process of RNA interference (RNAi) is called

Dicer

Which of the following terms would not be used to describe a trait that shows variation over a range of phenotypes?

Discrete

During the lysogenic cycle, viral particles are actively being manufactured and assembled.

False

Paternal inheritance occurs in plants but not animals because plants have chloroplasts instead of mitochondria. (T or F)

False

Unmethylated CpG islands are correlated with inactive genes. (T or F)

False

Following treatment with restriction enzymes, what procedure would be used to separate DNA fragments of different lengths?

Gel electrophoresis.

Which of the following statements most accurately defines genomic imprinting?

Inactivation of the allele from one parent and expression of the the allele from the other parent.

The drug Plavix requires the enzyme CYP2C19 to take it from the prodrug form to the drug form (enzyme A below) and it requires the enzyme CES1 to convert it from active to inactive (enzyme 1 below). The active form of the drug is effective in preventing blood clots but is toxic in higher doses. Individuals with a mutation in the CYP2C19 gene produce a version of CYP2C19 that is 50%less effective. You are a physician trying to determine the dosage of Plavix for a patient who is homozygous for the mutated version of the CYP2C19 gene. What should you do?

Increase the normal dosage because they are not making enough of the drug

Down's syndrome is an example of aneuploidy which is when

Individuals have an abnormality in chromosome number

If alternative splicing was not available, what impact would this have?

Individuals would need more DNA to code for proteins Individuals would not be able to make different proteins from the same sequence of DNA

Which of these is the correct sequence of events for transcription in eukaryotes?

Initiation, Elongation, RNA processing, Termination

Which of these is the correct sequence of events for transcription in prokaryotes?

Initiation, Elongation, Termination

A cell spends most of its life in which phase of the cell cycle?

Interphase

Which of the following is not true of epigenetic inheritance?

It affects the genotype.

Which of these is an advantage of semiconservative replication?

It is less prone to error

A new chemotherapy drug has been developed and it stopes the production of the microtubules that are used to create the spindle fibers? Why is this an effective chemotherapy medication?

It prevents sister chromatids from pulling apart during anaphase of mitosis

What sex is an individual who is XX (SRY+)

Male

silence the expression of specific mRNAs.

MicroRNAs (miRNAs)

A chicken zygote was formed when sperm and egg came together in a fertilization event. After this fertilization, the newly formed zygote grows by

Mitosis

I am looking at a cell under the microscope and see its chromosomes consisting of sister chromatids. What is the only possible phase of the cell cycle I am looking at?

Mitosis

In which site of the ribosome would you find the growing polypeptide chain?

P

Reverse transcription, carried out by retroviruses, is the process by which

RNA is copied into DNA.

Which type of mutation is most likely to still result in a functional protein?

Silent

Which of these is NOT true about the structure of DNA?

Single stranded

In order to produce human insulin in bacteria what must be done first?

The human insulin gene must be cloned.

In humans, long eyelashes (L) are dominant to short eyelashes (l). If an individual is ll for eyelash length, what does this mean?

The individual is homozygous recessive for eyelashes

In humans, long eyelashes (L) are dominant to short eyelashes (l). If an individual is LL for eyelash length, what does this mean?

The individual will have long eyelashes All offspring will have long eyelashes when crossed with the Ll genotype All offspring will have long eyelashes when crossed with the ll genotype The individual is homozygous dominant for eyelashes

If the gene that codes for ribosomal RNA is mutated and the E site of the RNA is misshapen, what will happen?

The mRNA and polypeptide chain will not be able to leave the ribosome

If the polyA tail AND guanine cap are missing from an mRNA molecule, what will occur?

The mRNA molecule will not be able to leave the cell nucleus The mRNA molecule will not be able to bind to the ribosome The mRNA molecule will not persist for very long in the cytosol All of the above

A mutation in a gene's promoter region would most likely result in

The rate of transcription may increase or decrease.

One of the characteristics of our genetic material was that it needed to have variation. The variation in our DNA comes from

The sequence of bases in the DNA

A researcher creates a strain of mutant yeast who lack the enzyme helicase. All of the yeast die. What is the problem?

The yeast cannot unwind the DNA for DNA replication

In pea plants, yellow peas (Y) are dominant to green (y) and round peas (R) are dominant to wrinkled (r). Two pea plants were crossed, one with yellow round peas and one with green wrinkled peas. What were the genotypes of the parents?

The yellow round was YYRR and the green wrinkled was yyrr

The drug Plavix requires the enzyme CYP2C19 to take it from the prodrug form to the drug form (enzyme A below) and it requires the enzyme CES1 to convert it from active to inactive (enzyme 1 below). The active form of the drug is effective in preventing blood clots but is toxic in higher doses. Individuals with a mutation in the CYP2C19 gene produce a version of CYP2C19 that is 50% less effective. This mutation is the recessive condition. You are a physician trying to determine the dosage of Plavix for a patient whose father is homozygous recessive for the mutated version of the CYP2C19 gene and whose mother is heterozygous for the mutation version of the CYP2C19 gene. What does this mean for you and the patient?

There is a 50% chance that you will need to increase the dosage of the drug

I am looking at a cell and see two chromosomes with the same basic genes (for example genes for finger length and hairline shape). However, when I sequences these two chromosomes they are similar but not identical in their DNA sequence. This means

They are members of a homologous pair

Tay Sachs is an autosomal recessive condition that is caused by a mutation in the gene that encodes for the hexA enzyme. This enzyme normally degrades a specific type of lipid in brain cells. When this lipid is not degraded, it results in degradation of brain neurons. An individual who is heterozygous for Tay Sachs has typical brain function. What is the most likely explanation for this?

They produce enough hexA to degrade the necessary lipids

In one family there is a skin tone that seems to "skip" a generation. For example the grandmother has it, her daughter does not, but her granddaughter does. What is the most likely explanation for this?

This skin tone is a recessive trait

Both eukaryotes and prokaryotes require a promoter region for gene transcription. (T or F)

True

During the lytic cycle, viral particles are actively being manufactured and assembled. (T of F)

True

Epistasis often involves genes of an enzymatic pathway (T or F)

True

Plasmids replicate independently of the bacterial chromosome. (T or F)

True

The final goal of mitosis is

Two diploid cells with identical nuclei

At the end of the first meiotic division (Meiosis 1), each chromosome consists of

Two sister chromatids

Using the following template strand of DNA, what would be the sequence of the complementary strand of mRNA that would be synthesized during transcription?Template strand: ATGCTCGATCAG

UACGAGCUAGUC

Using the following template strand of DNA, what would be the sequence of the complementary RNA strand?Template strand: ATGCTCGATCAG

UACGAGCUAGUC CTGATCGAGCAA None of the above

This type of plasmid makes the host more pathogenic.

Virulence plasmids

During DNA replication, new bases are always added to the 3'end. This means that one side will have a leading strand and the other side

Will have a lagging strand made of Okazaki fragments

Calico coat pattern in cats is the result of

X-chromosome inactivation

Which of the following types of proteins could be coded for by a tumor-suppressor gene?

a protein that codes for a DNA repair enzyme

The expression of the tryptophan operon is controlled by

a repressor that is active when it binds to tryptophan

Proteins that bind to DNA and turn on operons by making it easier for RNA polymerase to bind to a promoter are called

activators.

The phenomenon where a single type of pre-mRNA may give rise to multiple types of mRNAs due to different patterns of intron removal is called

alternative splicing.

In bacteria, the unit of DNA that contains multiple genes under the control of a single promoter is called _____. The mRNA produced from this unit is referred to as _____ mRNA.

an operon, a polycistronic

A naturally competent bacterium can

bind and take up DNA fragments

The _____ is the protein coat of a virus that surrounds the genetic material.

capsid

Which of the following is found in all viruses?

capsid

Liver cells, mammary cells, and skin cells all contain the same genome; however, their respective proteomes vary drastically. This observation is best explained by what phenomenon?

cell differentiation

RNA interference (RNAi) can be used by

cells to prevent infections from double-stranded RNA viruses.

Should a genetic abnormality arise, ________ prevent a cell from progressing uncontrollably through the cell cycle.

checkpoint proteins

A eukaryotic gene that is regulated by three activator proteins is said to be under

combinatorial control.

During _____, direct contact is made between bacterial cells, whereas during _____, genetic material is taken up directly from the surrounding environment.

conjugation; transformation

Linked genes generally

do not follow the laws of independent assortment.

A modification of a gene or chromosome that occurs during gamete formation or early development that permanently alters the expression of that gene for the lifetime of the individual is called

epigenetic inheritance

Which of the following results in a spontaneous mutation?

free radicals produced by cellular metabolism

The genomes of mammalian mitochondria contain

genes whose products are used in translation of mRNA. ribosomal genes. genes for proteins used in oxidative phosphorylation. a total of 37 genes.

An individual has green eyes and is homozygous recessive. What is her genotype?

gg

A bacterial species that becomes resistant to certain antibiotics may have acquired the resistance genes from another bacterial species. The phenomenon of acquiring genes from another organism without being the offspring of that organism is known as

horizontal gene transfer.

Which of the following molecules carries the message of the genes from the nucleus to the cytoplasm?

mRNA

DNA replication in eukaryotes begins at

many origins and proceeds in both directions

When cancer cells have the ability to migrate to other parts of the body, they are said to be

metastatic

In our case study, we learned that epigenetic changes to DNA can be accomplished by the following mechanism(s):

modification of chromatin packing

Some point mutations lead to an mRNA that produces a shorter polypeptide. This type of mutation is known as a ____ mutation.

nonsense

Beginning with the simplest level of structure, which order of organization of genetic material is CORRECT?

nucleotide, DNA, gene, chromosome, genome

DNA ligase binds

nucleotides in the DNA backbone together.

When DNA from two sources is combined into one single piece of DNA, it is known as

recombinant DNA

characteristic of a cancer cell?

replicates an unlimited number of times grows and divides without stimulation by a growth factor DNA damage does not halt cell division or stimulate apoptosis capable of movement to other parts of the body

Eukaryotic DNA regulatory elements that function to inhibit transcription when it is not needed are called

silencers

Transcriptional control of gene expression regulates which process?

the formation of RNA from DNA

In our Schizophrenia case study, we learned that identical twins can have different disease states (one has schizophrenia and the other doesn't) because

they have different proteomes and have been exposed to different environments.

Which of the following statements is TRUE of restriction enzymes?

they protect bacterial cells from invasion by foreign DNA

Gene transfer in which a bacterial cell takes up bacterial DNA from the environment is called

transformation.

The incorporation of methicillin resistance genes that are picked up by a bacterium directly from the environment outside the cell is an example of

transformation.

Which of the following types of physical mutagens produces thymine dimer mutations?

ultraviolet light

A horticulturist is breeding a new variety of houseplant in which two genes control leaf color. G (allele for green) is dominant to g (yellow) and B (second allele for green) is dominant to b (yellow). The recessive homozygous condition of either gene will mask a dominant allele. What color is a plant with the genotype Ggbb?

yellow