bis2a final exam review
N-terminus
denotes the beginning of a protein chain (first amino acid in the chain)
C-terminus
denotes the end of a protein chain (the last amino acid in the chain)
the random movement of molecules down their concentration gradient is called
diffusion
In oxidative phosphorylation, electrons are transferred from electron (donors or acceptors) to compounds with a (weaker or stronger) reduction potential.
donors, stronger
a cross-linked pyrimidine dimer, induced by UV light, might occur at the sequences: (a) TC (b) CC (c) TT (d) CT (e) any of these sequences might be the site of a pyrimidine dimer
e
a mutation occurs at the position that encodes the second codon of a gene. which of the following mutations would have the most severe effect of the function of the encoded protein? (a) silent mutation (b) missense mutation (c) nonsense mutation (d) a two nucleotide insertion mutation (e) both c and d would eliminate protein function
e
mutations are repaired by: (a) nucleotide excision repair (b) photolyase (c) end to end rejoining (d) homologous recombination (e) they aren't repaired
e
rifampicin is an antibiotic that binds to the bacterial RNA polymerase deep within the DNA/RNA channel, blocking elongation of the growing RNA polymer. a bacterium mutates in such a way as to develop resistance to rifampicin- it carries a new version of this gene. what will help the frequency of this new mutant sequence increase fastest in the general bacterial population? (a) continuous growth in the absence of the drug (b) continuous growth in the presence of the drug (c) transfer of the gene to an F plasmid that can permit the bacterium to mate with other bacteria, generating a copy of the F plasmid in this new host (d) ac (e) bc
e
translation of an mRNA encoding a plasma membrane protein occurs in the following locations: (a) the nucleus (b) the cell membrane (c) just the cytoplasm (d) just the rough ER (e) starting in the cytoplasm and ending in the rough ER
e
what is the biological (adaptive) value of a hydrogenosome? (a) the ability to use methane as an external electron source (b) the ability to detoxify O2 (c) the ability to generate H2 (d) the ability to oxidize glucose all the way to CO2. (e) the ability to ferment pyruvate in a way that generates ATP from ADP
e
when a mutation occurs in the DNA sequence, the protein sequence may or may not change. match up the mutation with the resulting phenotype: nonsense mutation (a) more codons are added to the protein (b) codon codes for the same amino acid (c) codon codes for a different amino acid (d) codons are read in the wrong direction (e) codon codes for a stop (f) codon and subsequent codons code for the wrong amino acids.
e
you're a cell making a protein. it makes sense that a protein that's very big would "cost" more to make than one that's small. how many ATP equivalents are used per amino acid per protein, on an "ATP equivalents per amino acid added" basis? (a) cost of polymerizing the mRNA? (1 ATP-> AMP per NTP added) (b) cost of charging tRNAs? (1 ATP -> AMP) (c) cost of adding tRNAs to the ribosomal A site? (1 GTP-> GDP) (d) cost of translocation of the ribosome? (1 GTP -> GDP) (e) bcd (f) abcd
e
a heme cofactor carrying an Fe atom is part of a cytochrome protein involved in electron transfer. two closely related species have different versions of this protein. one version (A) carries the cytochrome in an active site that has a neutral charge. the other (B) has the cytochrome in an active site that has a net charge of -2. what would you predict would be the effect, if any, on the ability of the oxidized cytochrome to ACCEPT electrons from other molecules?
the reduction potential of B would be lower (more negative), and it would be a weaker electron acceptor
electronegativity
the tendency of an atom to attract electrons towards itself
when a mutation occurs in the DNA sequence, the protein sequence may or may not change. match up the mutation with the resulting phenotype: frameshift mutation (a) more codons are added to the protein (b) codon codes for the same amino acid (c) codon codes for a different amino acid (d) codons are read in the wrong direction (e) codon codes for a stop (f) codon and subsequent codons code for the wrong amino acids.
f
some compounds need to travel into the cell through a membrane protein, this is an example of --------
facilitated diffusion
in the reaction C6H12O6 + 6O2 --> 6CO2 +6H2O + energy, the reactant C6H12O6 enters your body through
food
In the reaction C6H12O6 + 6O2 --> 6CO2 +6H2O + energy, the reactant 6CO2 enters the plant
from the atmosphere
reduction
gain of electrons
in which compartment of the mitochondria does glycolysis occur?
glycolysis doesn't occur in the mitochondrion
what unwinds the DNA for replication to begin?
helicase
moving down a concentration gradient means moving from a (lower or higher) to a (lower or higher) concentration.
higher, lower
in order for a polar compound to enter into the hydrophobic space of the phospholipid tails, it would need to break the many ------- bonds it has formed with the water and enter into a space where these bonds cannot form. therefore, it is not a repelling action but a "lack of attraction."
hydrogen
the two strands of the DNA are held together with -------- bonds.
hydrogen
polar compounds are forming bonds with the water on the outside of the membrane. these bonds are called
hydrogen bonds
what types of interactions can the polar compound have with the interior of this passage way (channel protein)?
hydrogen bonds
secondary structure of protein
hydrogen bonds are formed through the backbone atoms
tertiary structure of protein
hydrogen bonds, ionic bonds, covalent bonds, are formed between the R-groups
ionic bond
a bond that exists between two full, opposite charges
hydrolysis
a reaction that requires water as a reactant
condensation reaction
a reaction that results in the formation of water as an end product
a small inhibitory molecule binds to the regulatory site on an enzyme, resulting in a change of the protein's shape. this makes the active site inaccessible to substrate. this change in shape is probably due to
a rearrangement of the tertiary or quaternary structure, that extends from the regulatory site to the active site
transcription factors act to alter (a) translation (b) transcription (c) DNA replication
b
in bacterial cells this process occurs in the cytoplasm. however, in eukaryotes the process ------ occurs in the nucleus.
transcription
in horses, D is a dominant allele of the Dun gene that results in what is considered to be the "wild-type" coat color: dull brown with black mane, tail, legs, and dorsal stripe (called "dun" or "buckskin"). homozygosity for d, a recessive allele, results in a rich, vivid coat color (black, bay, chestnut etc). you have a dun male horse and want to determine whether he is heterozygous or homozygous for D, so you cross him to a bay female. the resulting offspring is bay. from this you can conclude... (a) your dun horse is homozygous (DD) (b) your dun horse is homozygous (dd) (c) your dun horse is heterozygous (Dd) (d) there are not enough offspring to be able to conclude anything (e) the male horse's phenotype already tells you his genotype.
c
the process of -------- makes an RNA copy from a DNA template.
transcription
which strand is made in short segments called okazaki fragments (leading/lagging) ?
lagging
the process of ------ occurs in the cytoplasm in both bacterial cells and eukaryotes.
translation
the process of ----------- makes a protein from an mRNA.
translation
which strand is made in one continuous piece (leading/lagging) ?
leading
In photosynthesis, energy in ------ is absorbed by an electron in a photocenter.
light
the end result of meiosis is 4 (unique/identical) cells
unique
what is the R section called?
variable group
pair the macromolecule with its building block: triglyceride
lipid
which of the following amino acids contain non-polar R groups?
1357
which of the following amino acids contain polar R groups?
2468
oxidation
loss of electrons
sort the following items in the order in which they occurred: 1 eukaryotes evolve 2 oceans present on earth 3 collision of the earth with the planetoid theia 4 photosynthesis evolves 5 cyanobacteria evolve a pathway to oxidize water
32451
RNA polymerase makes the RNA in which direction (3' to 5' or 5' to 3')?
5' to 3'
the DNA strand is made from which end to which end?
5' to 3'
when compounds are pumped against their concentration gradient they are being moved from (lower or higher) to (lower or higher)
lower, higher
lipid
macromolecule that can exist as linear oc cyclized, where it has a polar "head" group and a majority non-polar "tail" group
carbohydrate
macromolecule that can exist as linear or cyclized, where it has a 1:2:1 ratio of carbon, hydrogen, and oxygen
in telophase, the nuclear -------- starts to reform and the DNA de-condenses.
membrane
2nd phase of mitosis
metaphase
if the depolymerization of the microtubules was disrupted, the cell cycle would stop in which phase?
metaphase
in metaphase, the sister chromatids line up on the -------- plate.
metaphase
In the reaction C6H12O6 + 6O2 --> 6CO2 +6H2O + energy, the product C6H12O6 is created through reduction of
CO2
In the reaction C6H12O6 + 6O2 --> 6CO2 +6H2O + energy, the product C6H12O6 is metabolized by the plant in its
mitochondria
after replication, the RNA primers are removed by which enzyme before being replaced with DNA nucleotides?
DNA polymerase 1
the RNA primer supplies the 3' hydroxyl group used by ---------------- to start adding DNA nucleotides
DNA polymerase 3
which atoms would you consider more electronegative than carbon out of the following? mark all that apply: F O N H
F O N
in the redox tower, more positive E values means
more likely to accept electrons
in the redox tower, more negative E values means
more likely to donate electrons
the RNA is made by the enzyme ---------------
RNA polymerase
if protein DNA polymerase was disrupted, the cell cycle would stop in which phase?
S phase
if the protein ligase was disrupted, the cell cycle would stop in which phase?
S phase
quaternary structure of protein
multiple proteins in the tertiary structure come together to form a larger functioning enzyme
in DNA, A binds with ___ and G binds with ___
T, C
what is the complementary base sequence to this strand of DNA: 5' - ATGGTCGTAGTGA -3'
TACCAGCATCACT
can polar compounds interact in this same way with the hydrophobic tails of the phospholipids?
no
do interactions form between polar compounds and the hydrophobic tails?
no
In (cyclic or non-cyclic) photosynthesis the electron reduces NADP+ to form -------.
non-cylic, NADPH
type of covalent bond where electrons are shared equally
nonpolar covalent
pair the macromolecule with its building block: nucleic acid
nucleotide
OIL RIG
oxidation is loss, reduction is gain
NAD+ is in the ______ state.
oxidized
Oxidative phosphorylation is a metabolic pathway that (oxidizes or reduces) an energy-rich source to produce ATP from ADP
oxidizes
compound that becomes reduced acts as the
oxidizing agent
In the reaction C6H12O6 + 6O2 --> 6CO2 +6H2O + energy, the product 6O2 is considered a waste product of
oxygenic photosynthesis
the majority of the cell membrane is composed of what type of lipids?
phospholipids
a black cat bred to a tabby (striped) cat produces three tabby kittens, and zero black kittens. From this you can conclude: (a) tabby is dominant to black, the black cat is homozygous for the black allele, and the tabby cat is homozygous for the tabby allele (b) tabby is dominant to black, the black cat is homozygous or heterozygous for the black allele, and the tabby cat is homozygous or heterozygous for the tabby allele. (c) tabby is dominant to black, the black cat is homozygous or heterozygous for the black allele, and the tabby cat is homozygous for the tabby allele. (d) tabby is dominant to black, the black cat is homozygous for the black allele, and the tabby cat is homozygous or heterozygous for the tabby allele.
a
a cell pumps Na+ out of the cell, resulting in a high concentration of Na+ outside the cell vs a low concentration inside. this is an example of: (a) active transport (b) contraflow (c) facilitated diffusion (d) proton pumping (e) diffusion
a
a mutant is isolated with a nonsense mutation in the 5' end of the coding region of the gene encoding the trp repressor. such a mutant would be expected to: (a) strongly express the trp operon, all the time (b) strongly express the trp operon only in the presence of trp (c) strongly express the trp operon only in the presence of lactose (d) strongly express the trp operon only when trp is absent (e) strongly express the trp operon only the presence of high levels of cAMP.
a
fermentation occurs when: (a) the cell needs more NAD+ to perform glycolysis, and no external electron acceptor is available (b) the cell needs to get as much energy as possible from glucose, burning it to completion (CO2) (c) the cell has an external electron acceptor it can use (d) the cell has too much NAD+ (e) glucose is not available
a
in the cell depicted above, each line represents a chromatid. this cell is in the following stage of the cell cycle: (a) anaphase of meiosis I (b) metaphase of mitosis I (c) prophase of meiosis I (d) prophase of meiosis II (e) start of DNA replication (S phase)
a
in the signal transduction pathway illustrated in below, the student is defective in factor "B" (= a sense of responsibility). signal / \ A C | \ B D | \ go to the movies get Thai food as a result, the student will: (a) ALWAYS go to the movies, regardless of signal (b) only go to the movies in the absence of signal (c) only go to the movies in the presence of signal (d) NEVER go to the movies (e) only go to the movies if Thai food is present
a
in thermodynamics, a living organism is an example of a (a) open system (b) closed system (c) isolated system (d) system equilibrium
a
pyrimidine dimers cause mutations because: (a) the replicative DNA polymerase cannot replicate past them, and an error prone polymerase replicates across them instead (b) RNA polymerase mis-reads them (c) their sequences are like those of telomeres (d) the normal (replicative) DNA polymerase misreads them
a
the compounds found in living cells are not 'special' or even unique to living things and that they can be found/produced by specific environments. for example, Friedrich Wöhler created what chemical in his lab that was previously thought to be created only by living things? (a) urea (b) DNA (c) lipids
a
the first few steps of glycolysis are referred to as the 'investment' phase. why is that? (a) because you lose some ATP, turning them into ADP, in these steps (b) because they have a negative deltaG (c) because NAD+ is made (d) because they generate ATP from ADP + Pi (e) because they have a positive deltaG
a
the lac operon is fully activated only when E. coli (a) has lactose and has no glucose (b) has no lactose and has no glucose (c) has lactose and has plenty of glucose (d) has no lactose and has plenty of glucose
a
the sequence of a single strand of DNA is 5'-TTTGCAG-3'. it's complementary strand would be: (a) 5' CTGCAAA 3' (b) 5' AAACGTC 3' (c) 3' AACCGTC 5' (d) 3' CTGCAAA 5' (e) 5' GACGTTT 3'
a
transcription factors are (a) proteins (b) nucleic acids (c) lipids (d) carbohydrates
a
an RNA primer is created by enzyme
primase
1st phase of mitosis
prophase
if the chiasmata formation was disrupted, the cell cycle would stop in which phase?
prophase I
In photosynthesis, the ETC creates ------- which is used by the cell to power the formation of ATP.
proton motive force
In oxidative phosphorylation, as electrons move through an electron transport chain, ETC, the energy in the electron is used to pump ------ across a membrane.
protons
NADH is in the ______ state.
reduced
compound that becomes oxidized acts as the
reducing agent
the measure of a compound's likeliness to gain or lose an electron is its ________ (E value).
reduction potential
transcription factors cannot JUST be attracted to the DNA. they also need to bind to very specific sequences in the DNA in order to properly regulate gene expression. these specific interactions rely on (transcription factors binding to their specific site on the DNA)? (a) polar functional groups on the amino acids with the bases of the DNA (b) polar functional groups on the amino acids with the sugar-phosphate backbone of the DNA (c) non-polar functional groups on the amino acids with the bases of the DNA (d) non-polar functional groups on the amino acids with the sugar-phosphate backbone of the DNA
a
what are the products in the formation of the phosphodiester bond in a nucleotide polymerization reaction? (a) polymer and pyrophosphate (b) polymer and energy (c) pyrophosphate
a
what are the reactants in the formation of the phosphodiester bond in a nucleotide polymerization reaction? (a) polymer with 3' OH and CTP (b) polymer with 3' OH and ATP (c) polymer with 5' OH and CTP (d) polymer with 3' OH and ATP
a
what functional group is at the 5' end of the DNA? (a) phosphate group (b) hydroxyl group (c) hydrogen (d) sugar
a
what is the difference between the transition state energy and the activation energy of a particular reaction? (a) activation energy is the amount of energy in the structure of the transition state (b) changes in delta Gact cause changes in delta Grx, but changes in transition state energy do not (c) the transition state energy is a constant, activation energy is not (d) nothing. transition state energy and activation energy are two terms for the same thing
a
which half reaction is exergonic in this coupled nucleotide polymerization reaction? (a) hydrolysis of the anhydride bond (b) catalysis of the phosphodiester bond
a
which of the following components of the Lac regulatory system is a "cis-acting" factor? (a) the operator (b) lac permease (c) lac repressor (d) beta-galactosidase
a
why is one of our ancestors thought to have been a methanogen? (a) because some eukaryotes have hydrogenosomes instead of mitochondria (b) all responses are correct (c) because eukaryotes can perform methanogenesis (d) because the sequence of many eukaryotic nuclear genes is closest to that of an existing methanogen.
a
carboxylic acid
a functional group on an amino acid that is polar, acidic, part of the amino acid backbone, and can become negatively charged
amine
a functional group on an amino acid that is polar, basic, part of the amino acid backbone, and can become positively charged
protein
a macromolecule that exists with a backbone where the functional groups are the amine and the carboxylic acid
polar covalent bond
a type of covalent bond where electrons are shared unequally
looking through a microscope, you see a nucleus that has 6 chromosomes, each chromosome having one chromatid. you conclude that this nucleus is (select all that apply): (a) in telophase, from a haploid cell with 6 different, non-homologous chromosomes (b) in telophase, from a diploid cell with 3 pairs of homologous chromosomes (c) in interphase, and from a diploid cell with 3 pairs of homologous chromosomes (d) in interphase, and from a haploid cell with 6 different, non-homologous chromosomes
ab
Autotrophs can (choose all that apply): (a) Capture high energy electrons from organic sources (b) Capture high energy electrons from inorganic sources (c) Fix carbon from CO2 (d) None of the options apply
abc
the idea that all life arose from a common ancestor is supported by what data? select all that apply: (a) fossil record (b) genetic analysis (c) biochemistry
abc
which of the following parts of metabolism occur in and require the membrane? choose all that apply: (a) electron transport (b) light reaction of photosynthesis (c) pmf formation (d) atp synthesis
abcd
kinetochores play an essential role in mitosis by (select all that apply): (a) pulling the centromere along microtubules (b) separating the homologs (c) establishing tension and so allowing the cell to know when the sister chromatids are properly aligned (d) holding two sister chromatids together
ac
when would a cell use passive transport? (select all that apply) (a) when the cell needs to move a compound that cannot move freely through the membrane (b) when the cell needs to move a compound against its concentration gradient (c) when the cell needs to move a compound down its concentration gradient
ac
the signal to make new proteins can sometimes be an external signal. order the following events from first to last: (a) signal binds to a receptor on the outside of the cell (b) the activated protein enters the nucleus and interacts with a specific transcription factor (c) a series of phosphorylation events occurs to activate downstream proteins (d) the activated transcription factor binds to the DNA and alters gene expression
acbd
in eukaryotic cells the pre-mRNA undergoes processing. check the following options that are a type of mRNA processing. select all that apply: (a) 5'G cap (b) 3'G cap (c) 3' poly-A tail (d) 5' poly-A tail (e) removal of exons (f) removal of introns
acf
compounds are pumped against their concentration gradient and are being moved from lower to higher concentration by which type of transport?
active transport
In oxidative phosphorylation, the pumping of these molecules against their concentration gradient is a form of ------ transport. The movement of these molecules back into the cell (down their concentration gradient) releases energy which the cell couples to the formation of ------.
active, ATP
which of these bonds would you consider a polar covalent bond? mark all that apply: (a) C-O (b) C-H (c) C-C (d) H-N (e) H-O
ade
which part of the following statement is incorrect: water molecules repel non-polar substances. (mark all that apply) (a) repel needs to be replaced with "do not attract" (b) non-polar needs to be replaced with "polar" (c) away needs to be replaced with "towards" (d) the corrected statement should read: non-polar compounds such as lipids attract each other and repel polar molecules like water. (e) the corrected statement should read: water molecules do not interact with non-polar compounds, which become oriented away from water. (f) the corrected statement should read: water molecules attract polar and non-polar compounds, but the non-polar compounds are 'sticky' so they stick together.
ae
what is the center carbon section called?
alpha carbon
what is the H2N section called?
amine group
pair the macromolecule with its building block: protein
amino acid
3rd phase of mitosis
anaphase
the two strands of DNA are -------- to each other such that at the end of the DNA, one strand will be 3' paired with a 5' end.
antiparallel
Avery, MacLeod, and McCarty were able to genetically transform "rough" pneumococcus to "smooth", using an extract from killed pneumococci. they concluded that DNA rather than protein was the genetic material because: (a) The extract, when treated with protease, failed to transform cells (b) The extract, when treated with DNase, failed transformed cells (c) The extract, when treated with RNAse, failed to transform cells (d) The extract, when treated with DNAse, still transformed cells
b
In the absorbance spectrum shown below is from an extract of leaves of a plant that produces two pigments chlorophyl A and chlorophyl B. You're buying LED lamps to grow this plant indoors, and each lamp only emits photons at one wavelength. If we assume all lamps emit the same number of photos per second, which bulb/wavelength would be the worst choice to support the growth of this plant? (a) 480nm (b) 550nm (c) 640nm (d) 420nm
b
Per molecule, which of the following organic compounds would provide the most ATP when completely catabolized (to CO2) via aerobic respiration? (a) Phosphoenolpyruvate ("PEP", the compound right before Pyruvate in glycolysis) (b) Stearic acid (a fatty acid, see structure below, fatty acid processing is described in lecture 8 slide four) (c) Glucose (d) Pyruvate
b
What's the difference between a photosystem (ie, PSI) and a photoreaction center (ie, P700)? (a) They are two terms for the same thing (b) A photoreaction center contains many pigments (including chlorophylls) that can collect photons, while a photosystem (embedded in the reaction center) contains one or more "special" chlorophylls that can actually do photochemistry (c) A photoreaction center contains many different pigments and proteins, but only a subset of these pigments (called the photosystem) can actually perform photochemistry- donating electrons to an ETC. (d) One term (photoreaction center) is used for photosynthetic prokaryotes, the other (photosystem) is used for photosynthetic eukaryotes
b
a/an ------- does "positive regulation", meaning it acts to ------- expression of a gene. (a) repressor, increase (b) activator, increase (c) repressor, decrease (d) activator, decrease
b
avery and macleod's experiment strongly suggested that DNA, rather than protein or RNA, is the molecule of inheritance. this experiment involved the identification of a class of molecules that could transform bacteria from harmless to deadly. this transforming molecule was destroyed by... (a) RNase, but not protease or DNase (b) DNase, but not protease or RNase (c) protease, but not RNase or DNase (d) Both DNase and RNase, but not Protease (e) Both Protease and RNase, but not DNase
b
deltaG' refers to the change in Gibbs free energy under (biological) standard conditions. these standard conditions include: (a) pH=0 (b) all chemical components (reactants and products) are constantly at 1 Molar (c) temperature = 25 F (d) reaction is at equilibrium
b
dyneins walk where on what? (a) towards the outside of the cell, on microtubules (b) towards the inside of the cell, on microtubules (c) towards the inside of the cell, on microfilaments (d) towards the outside of the cell, no both microfilaments and microtubules (e) towards the outside of the cell, on microfilaments
b
how does mitosis differ from meiosis I? (a) the nuclear envelope disappears only in meiosis I (b) the sister chromatids separate in mitosis, not in meiosis I (c) homologs align in mitosis but not in meiosis I (d) chromatin supercoils only in mitosis (e) crossing over occur in mitosis, but not in meiosis
b
how many DNA polymerase III molecules are present at a single replication fork? (a) 1 (b) 2 (c) 3 (d) 4
b
in the reaction 2H2 + O2 --> 2H2O, what is being oxidized? (a) H2O (b) H2 (c) O2 (d) there is no redox in this reaction
b
regulated transcription is genes that are expressed (a) all of the time (b) only at certain times or in certain cells
b
scientists have found the presence of amino acids and sugars in meteorites, suggesting that these compounds: (a) make up meteorites (b) can be produced w/o life (i.e. in space)
b
the conversion of a C to a U by hydrolysis is an example of: (a) transcription (b) DNA damage induction (c) mutagenesis (d) translation
b
the enzyme that catalyzes the nucleotide polymerization reaction is (a) RNA polymerase (b) DNA polymerase 3 (c) DNA polymerase 1 (d) RNA primase
b
the ingredients listed below will give you 2 ml of 1/2 molar sodium chloride after mixing. which will release the greatest amount of energy (=has the largest negative deltaG) when doing so? (a) mixing dry NaCl (enough to make a 1mL, 1 molar NaCl solution), plus 2mL water (b) mixing enough sodium metal and Cl2 gas to produce the amount of sodium chloride salt described above, with 2mL water (c) mixing two 1mL tubes of 1/2 molar NaCl (d) mixing 1mL of 1 molar NaCl, plus 1mL of water
b
the term 'holliday junction' refers to: (a) the bacterial mating pilus (b) a structure that's formed between chromosomes or chromatids during homologous recombination (c) excision of the new DNA strand during mismatch repair (d) a form of fertilization in fungi
b
the term holliday junction refers to (a) the bacterial mating pilus (b) a structure that's formed between chromosomes or chromatids during homologous recombination (c) a form of fertilization in fungi (d) excision of the new DNA strand during mismatch repair
b
transcription factors need to have an attraction to DNA in order to stay near or on the DNA the majority of the time. if transcription factors were not attracted to DNA they may float off the DNA and diffuse away. in order to keep transcription factors associated with the DNA, what functional groups on proteins and on DNA may be involved in this attraction? (a) polar functional groups on the amino acids with the bases of the DNA (b) polar functional groups on the amino acids with the sugar-phosphate backbone of the DNA (c) non-polar functional groups on the amino acids with the bases of the DNA (d) non-polar functional groups on the amino acids with the sugar-phosphate backbone of the DNA
b
translate the very small gene below using the attached codon chart. the promoter is to the left of the gene. the bolded nucleotide is the +1. 5' Promoter CCATGGGTCTAGTATAGGGGT 3' 3' Promoter GGTACCCAGATCATATCCCCA 5' (a) Pro-Trp-Val-Stop-Tyr-Arg-Gly (b) Met-Gly-Leu-Val (c) Met-Gly-Leu-Val-Stop (d) Thr-Pro-Ile-Leu-Asp-Pro-Trp (e) Met-Gly-Leu-Val-Stop-Gly
b
what does the term 'common ancestor' refer to when discussing the origin of life? (a) the first life that evolved on the planet (b) the first life that evolved on the planet that lead to the life currently on the planet (c) the last life that evolved on the planet (d) the simplest form of life on the planet
b
what functional group is at the 3' end of the DNA? (a) phosphate group (b) hydroxyl group (c) hydrogen (d) sugar
b
what happens to ATP when you "use" it? (a) ATP is converted into energy and used up by the cell. (b) ATP is converted to ADP which can be recycled back into ATP (c) ATP is converted into a waste product that the cell excretes (d) ATP is broken down into its individual parts and would need to be re-made through metabolism to be used again.
b
what might provide the energy required to concentrate the sugar lactose within a cell? (a) the coupled active concentration of Na+ in the cell (b) the coupled hydrolysis of ATP to ADP + Pi (c) the coupled synthesis of ATP from AMP + PPi (d) the coupled concentration of protons
b
what types of molecular interactions are occurring between the base pairs? (a) covalent bonds (b) hydrogen bonds (c) phosphoanhydride bond (d) ionic bond
b
when a mutation occurs in the DNA sequence, the protein sequence may or may not change. match up the mutation with the resulting phenotype: silent mutation (a) more codons are added to the protein (b) codon codes for the same amino acid (c) codon codes for a different amino acid (d) codons are read in the wrong direction (e) codon codes for a stop (f) codon and subsequent codons code for the wrong amino acids.
b
when would a cell have to use active transport? (select all that apply) (a) when the cell needs to move a compound down its concentration gradient (b) When the cell needs to move a compound against its concentration gradient (c) When the cell needs to move a polar compound (d) When the cell needs to move a non-polar compound (e) When the cell needs to move an ion
b
which half reaction is endergonic in this coupled nucleotide polymerization reaction? (a) hydrolysis of the anhydride bond (b) catalysis of the phosphodiester bond
b
which of the following is true for both trans-membrane transporter proteins and enzymes? (a) both transporters and enzymes can be regulated by small metabolites (b) all are true for both transporters and enzymes. (c) the rate of transport or catalysis is determined by the number of active proteins available (d) reactions and transport can be pushed uphill (+∆G) if another reaction/transportation event with sufficient -∆G is coupled to it. (e) the direction of transport or catalysis is determined by ∆G
b
the protein is made by the --------- which catalyzes the peptide bond between each amino acid.
ribosomes
the cell membrane is considered ------- because it only allows certain compounds to travel through freely
semipermeable
primary structure of protein
sequence of amino acids
in anaphase I, the homologous chromosomes separate. in anaphase II, what separates?
sister chromatids
in anaphase, the (sister chromatids/homologous chromosomes) are pulled apart.
sister chromatids
which type of chromosomes are identical?
sister chromatids
constitutive transcription is genes that are expressed (a) all of the time (b) only at certain times or in certain cells
a
nucleic acid
a macromolecule that contains a sugar a phosphate group and a nitrogenous base
what are the three components of a nucleotide (select all that apply) ? (a) nitrogenous base (b) carboxylic acid group (c) phosphate group (d) 5-carbon sugar (ribose) (e) 6-carbon sugar (glucose)
acd
which of the following are traits of living things? select all that apply: (a) can break the 2nd law of thermodynamics (that entropy increases) (b) can metabolize compounds from the environment (c) contains genetic material to pass down to offspring (d) can respond to the environment (e) can produce energy for itself
bcd
a/an ------- does "negative regulation", meaning it acts to ------- expression of a gene. (a) repressor, increase (b) activator, increase (c) repressor, decrease (d) activator, decrease
c
a chemical reaction occurs in a test tube in lab. during the reaction, "reactants" gradually become "products" until equilibrium is reached. At equilibrium: (a) delta G = 0 (b) no more reactions occur: no molecules of reactant become product, and no molecules of product become reactant (c) some molecules of reactant become product, and some molecules of product become reactant (d) both a and c are true
d
which enzyme extends the ends by creating a repeating sequence of nucleotides which helps prevent loss of genetic material with each replication on linear chromosomes?
telomerase
4th phase of mitosis
telophase
which type of chromosomes allow recombination to occur?
homologous chromosomes
which enzyme seals the nicks in the sugar-phosphate backbone after the RNA primers are removed?
ligase
what types of amino acid R groups do you think will line the channel protein interior?
polar
protein cofactors are
required for the function of their protein
In the reaction C6H12O6 + 6O2 --> 6CO2 +6H2O + energy, the reactant energy enters the plant through
the sunlight
Oxidation of glucose means (mark all): (a) combining glucose with oxygen through metabolism (b) loss of electrons from glucose (c) oxidation of glucose (d) combining oxygen with sugar to make energy
bc
it is postulated that life may have evolved from chemistry. the chemistry of life is special in 2 ways. select the 2 correct options: (a) the chemistry of life can only be accomplished through enzymes (b) the chemistry of life is organized in metabolic pathways (c) unique chemicals are found in living things (d) chemicals in living cells make up the vital force of an organism
bc
in which compartment of the chloroplast does water-splitting occur?
the lumen of the thylakoids
which compartment of the chloroplast is the most acidic when light is available?
the lumen of the thylakoids
mendel's extremely important contributions to biology was/were (select all that apply): (a) identification of chromosomes as the subcellular organelle responsible for inheritance (b) the observation that different kinds of traits segregate independently (c) the observation that peas carry two copies - and so potentially two version - of what we now call 'genes' (d) proof that DNA is the molecule of inheritance
bc
hydrogen bond
bond that forms between an electronegative atom and a hydrogen atom with a positive dipole
in the reaction C6H12O6 + 6O2 --> 6CO2 +6H2O + energy, the product 6CO2 leaves your body through
breathing
in the reaction C6H12O6 + 6O2 --> 6CO2 +6H2O + energy, the reactant 6O2 enters your body through
breathing
DNA polymerase's enzymatic activity is (read carefully!). "N" stands for "one of four bases": (a) the addition of 3'triphosphate dNTPs to the 3'OH of a growing chain, producing free pyrophosphate (PPi) (b) the addition of 3'triphosphate NTPs to the 3'OH of a growing chain, producing free pyrophosphate (PPi) (c) the addition of 5'triphosphate dNTPs to the 3'OH of a growing chain, producing free pyrophosphate (PPi) (d) the addition of 3'triphosphate NTPs to the 5'OH of a growing chain, producing free pyrophosphate (PPi) (e) the addition of 5'triphosphate NTPs to the 3'OH of a growing chain, producing free pyrophosphate (PPi)
c
Ferredoxinox/red is an electron carrier in the ETC that runs from PSI* to NADP, forming NADPH. Would you expect to find this carrier in the ETC required for respiration of NADH, running from NADH to O2, forming water? (a) No, because Fdred is a weak reducing agent, weaker than NADH (b) Yes, because Fdox is a strong oxidizing agent- stronger that NAD+ (c) No, because Fdred is a strong reducing agent, stronger than NADH (d) Yes, because Fdox is a strong reducing agent, stronger than NADH
c
H2O is a liquid at room temperature while CO2 is a gas. why is this? (a) water has a higher molecular weight than CO2 (b) the polar covalent bond in CO2 cause the molecules to repel each other (c) water molecules are attracted to each other, CO2 molecules are not (d) water has a lower molecular weight than CO2
c
The leaves of green plants are green because: (a) When energy cannot be transferred to the ETC from excited chlorophyll, the electron will relax to a lower-energy orbital, emitting a green photon. (b) The pigments in the leaves of green plants absorbs green light most strongly, of all visible light photons (c) The pigments in the leaves of green plants do not absorb green light as strongly as they absorb other visible light photos. (d) The sun emits most of its radiation as photons that are green
c
a glucose transporter protein needs to be present in the plasma membrane, with hydrophylic end "A" exposed to the exterior of the cell, and hydrophylic end "B" exposed to the cytoplasm. at the moment when the ribosome completes synthesis of this protein and releases it, hydrophilic end A will be located... (a) in the cytoplasm (b) in the lumen of the thylakoid (c) in the lumen of the rough endoplasmic reticulum (d) in the exterior of the cell
c
chromosome arm exchange during meiosis is precise- if exchange occurs within a gene no bases will be added or lost. how can this happen? (a) the broken chromosome anneals to its homolog at specific sequences required for recombination (b) the sister chromatids are used for repair, and they match each other perfectly (c) the broken chromosome binds to its homolog at identical sequences, guided by base-pairing (d) a double strand break is intentionally induced by the cell in both homologs, at the exact same "hotspot" for recombination
c
constitutive promoters in bacteria are: (a) able to be transcribed without the help of RNA polymerase. (b) RNA polymerase binding sequences that are negatively regulated (c) RNA polymerase binding sequences that are always available for binding without help from additional transcriptional activators, and do not bind repressors d. RNA polymerase binding sequences that are positively regulated (d) RNA polymerase binding sequences that are positively regulated (e) promoter sequences that only transcribe multigene operons
c
glucose is processed via glycolysis, pyruvate oxidation, and the citric acid cycle. what is left of the original glucose molecule when this processing is complete? (a) water and CO2, plus energy stored in many (30+) ATPs (b) 2 pyruvates and some energy stored as ATP (c) CO2, some energy (stored as ATP), and some high energy electrons (stored as NADH and FADH2) (d) Acetyl CoA, CO2, and 2 ATPs (e) 2 Oxaloacetates, a few ATPS built by substrate-level phosphorylation, and 6CO2
c
in the diagram above, which is the newest (most recently synthesized) primer? (a) lagging strand, on the fragment closest to the origin of replication (b) leading strand, at its 5' end (c) lagging strand, on fragment closest to the replication fork (d) leading strand at its 3' end (e) all primers are produced at the same time- the initiation of replication
c
the Watson-Crick structure of DNA provided an extremely significant conceptual advance in our understanding of the role of DNA as the molecule of heredity. what was the critical aspect of this structure that suddenly allowed us to understand how DNA can provide a heritable "plan" for life? (a) the 2 strands of DNA run antiparallel to each other (b) the 2 strands of DNA carry identical nucleotide sequences (c) the 2 strands of DNA are base-paired by hydrogen bonds, with A paired with T and C paired with G (d) it is a helix (e) DNA has a major and minor groove
c
the diagram above represents DNA replication. how many primers were generated to create the new DNA strands in this picture? (a) 2 (b) 4 (c) 8 (d) 1
c
the enzyme that recognizes both the tRNA and its correct amino acid is called (a) tRNA polymerase (b) the ribosome (c) aminoacyl tRNA synthetase (d) amino acid polymerase
c
the lac operator is a (a) DNA sequence that binds the activator (b) repressor protein (c) DNA sequence that binds the repressor (d) a and b (e) b and c
c
the lac repressor is located next to the lac operon, presumably so that it has a better chance of being "horizontally inherited" with the operon it regulates. the gene encoding CRP, however, regulates the lac operon but is located halfway across the genome, making it unlikely to be horizontally inherited with the lac operon. why do you think CRP is not linked to the lac operon? (a) Because CRP is an activator, not a repressor, protein. (b) Because CRP is a repressor, not an activator, protein. (c) Because CRP is required for the activation of many operons not just the lac operon (d) Because CRP is required for the repression of many operons, not just the lac operon.
c
in the redox tower, compounds on the left side of the slash are:
the oxidized form
in the redox tower, compounds on the right side of the slash are:
the reduced form
the maize (corn) genome has many "transposons". transposons are DNA sequences (and therefore replicators) that generate copies of themselves throughout the genome, without encoding any genes that contribute to their host's success. why do transposons transpose to many positions, rather than staying in one chromosomal location? (a) copying the transposon into new positions in the genome results in insertion mutations, which are generally helpful to the host. (b) more copies result in a larger genome, improving the fitness of their vehicle. (c) more copies on more chromosomes make it more likely they'll be inherited in the next generation (d) more genes are always better for the host, even if they are transposons
c
transcription factors bind to (a) lipids (b) carbohydrates (c) DNA
c
when a mutation occurs in the DNA sequence, the protein sequence may or may not change. match up the mutation with the resulting phenotype: missense mutation (a) more codons are added to the protein (b) codon codes for the same amino acid (c) codon codes for a different amino acid (d) codons are read in the wrong direction (e) codon codes for a stop (f) codon and subsequent codons code for the wrong amino acids.
c
which directions do each of these polymer-forming complexes move on their template strand? (a) DNA polymerase, RNA polymerase, and the ribosome all move towards the 5' end of the template (b) DNA polymerase, RNA polymerase, and the ribosome all move towards the 3' end of the template (c) DNA polymerase and RNA polymerase move towards the 5' end of the template, but the ribosome moves toward the 3' end of the mRNA (d) DNA polymerase and RNA polymerase move towards the 3' end of their template strand, but the ribosome moves toward the 5' end of the mRNA
c
which of the following compartments would be expected to be most acidic when O2 is available? (a) the outer membrane (b) the inner membrane (c) the intermembrane space (d) the matrix (e) the entire mitochondrion should be at the same pH
c
pair the macromolecule with its building block: starch
carbohydrate
what is the COOH section called?
carboxylic acid
Which of the following processes are shared by both respiration and the light reactions of photosynthesis? Check all that apply. (a) Pyruvate oxidation (b) None are shared by both respiration and the light reactions of photosynthesis (c) ATP synthase (d) An electron transport chain
cd
in metaphase, the sister chromatids line up through a push and pull motion as they connect to the microtubule spindle fibers emanating from the --------.
centrosomes
in prophase I, homologous chromosomes are held together by -------, which, once resolved, create a cross over event.
chiasmata
in prophase, the DNA condenses down into compact ------, and the duplicated ------- separate.
chromatin, centrosome
a protein's primary structure is maintained by
covalent bonds
In (cyclic or non-cylic) photosynthesis the electron returns to the photocenter.
cyclic
if the polymerization of actin was disrupted, the cell cycle would stop in which phase?
cytokinesis
In carbon fixation, CO2 is reduced and incorporated into a larger carbon skeleton, which could then be converted to other storage forms of carbon and energy. The reverse citric acid cycle produces ____ and the Calvin cycle produces ______ (a) sugars, fats (b) fats, sugars (c) glyceraldehyde 3-phosphate (G3P), acetyl coA (d) acetyl coA, glyceraldehyde 3-phosphate (G3P)
d
In order to occur spontaneously (and therefor provide energy that can be captured to do work) a redox reaction must have (a) A negative ∆E, which is a positive ∆G (b) A positive ∆E, which is a positive ∆G (c) A negative ∆E, which is a positive ∆G (d) A positive ∆E which is a negative ∆G
d
What is the external source of electrons used to build NADPH from NADP in green sulfur bacteria? (a) Green sulfur bacteria only do cyclic photosynthesis- they make ATP but not NADPH (b) Glucose (c) Water (d) Reduced sulfur compounds, like H2S (e) Green sulfur
d
a glucose molecule has a bond between O and C. this is a: (a) hydrogen bond (b) non-polar covalent (c) ionic bond (d) polar covalent
d
how are the 3 domains of life related? (a) all prokaryotic species are descended from a single simple eukaryote (b) prokaryotes are descended from bacteria, while eukaryotes are descended from archeans (c) bacteria evolved into archeans, which became eukaryotes (d) a bacterium and an archean became symbionts; some of their descendants later evolved into eukaryotes
d
in living things, the two major components of G, "potential energy", are: (a) concentration and dilution (b) gibbs free energy and work (c) pressure and volume (d) concentration and molecular structure
d
sexual reproduction enhances the rate of evolution, allowing nature to select for novel combinations of alleles. two genes are present on the same chromosome. one homolog carries the dominant A and B alleles, while the other homolog carries the a and b alleles. which specific process of the meiotic cell cycle with result in a recombinant chromosome (for example, A with b)? (a) crossing over, during meiosis II (b) segregation of homologs, during meiosis II (c) the pre-meiotic S phase (d) crossing over, during meiosis I (e) segregation of homologs, during meiosis I
d
the RNA polymerase of archeans... (a) is most closely related to the RNA polymerases of eukaryotes (b) is most closely related to the RNA polymerase of bacteria (c) can transcribe tRNA, rRNA and mRNA encoding genes (d) ac (e) bc
d
the conversion of a C to a U by hydrolysis is an example of: (a) transcription (b) translation (c) mutagenesis (d) dna damage induction
d
the hershey-chase experiment was regarded as strong evidence that bacteriophage DNA carried the information needed to build a bacteriophage. they employed bacteriophage that had been grown in a medium that contained radioactive sulfur and phosphorus, and used these to infect bacterial hosts. what specific result(s) supported the 'DNA is inheritance' hypothesis? (a) only radioactive sulfur was injected into the host cell (b) both radioactive sulfur and radioactive phosphorus were bound to the exterior of the host cell (c) both radioactive phosphorus and radioactive sulfur were injected into the host (d) only radioactive phosphorus were injected into the host
d
transcription factors are made in the ---(nucleus/cytoplasm)--- but then migrate into the ---(nucleus/cytoplasm)---. (a) nucleus, nucleus (b) nucleus, cytoplasm (c) cytoplasm, cytoplasm (d) cytoplasm, nucleus
d
vesicles are carried as cargo by (a) kinesins (b) none are true (c) dyneins (d) all are true (e) myosins
d
which of the following objects requires a motor protein to diffuse across the cytoplasm of a cell at a biologically significant rate? (a) protons (b) glucose (c) dynein (d) vesicles (e) Na+
d
which of the following phosphate containing molecules is the strongest phosphate donor? (a) AMP (b) glucose 6-P (c) ADP (d) PEP (phosphoenolpyruvate), the last molecule in glycolysis before pyruvate (e) ATP
d
which of the following statements is correct? you can assume that cytokinesis occurs after completion of every meiosis or mitosis. (a) meiosis is followed by several mitoses, and then fertilization occurs (b) mitosis is followed by several meioses, and then fertilization occurs (c) the first cell cycle after fertilization is meiotic (d) fertilization occurs after meiosis, with no intervening mitoses
d
which strategy for capturing energy came last? (a) anaerobic respiration (b) fermentation (c) methanogenesis (d) aerobic respiration (e) oxygenic photosynthesis
d
are the hydrogen bonds that polar amino acid R-groups have with the interior of the channel protein the same ones the polar compound can have on the outside of the membrane with water?
yes
