BS 161 DNA to RNA transcription C5

an RNA molecule is synthesized in which direction?

5' end to 3' end

The RNA transcript runs from _____ and matches ______.

5' to 3' the sense (i.e., non-template) DNA strand

Which of of the following statements about RNA is correct?

RNA uses the same purine bases as DNA

RNA processing occurs in

eukaryotes only

During transcription of a given protein-coding gene, both strands are used as template.

false

T or F 3' - TCGGTCATCTGTGTGACCATGTC - 5' is RNA

false

Ribose differs from deoxyribose in that a ribose:

has an extra hydroxyl group.

In a DNA double helix the complementary strands are held together by:

hydrogen bonds

Transcription starts at the ________ and ends at the ________.

promoter; terminator

In prokaryotes, the messenger RNA consists of the:

unprocessed primary RNA transcript.

When RNA is transcribed from the DNA template strand, new nucleotides are added at the:

3' end

A template DNA strand contains 30% A, 20%T, 27% G, and 23% C. The RNA transcript contains:

30% U, 20% A, 27% C, and 23% G.

Which of the following CORRECTLY describes the complementary base pairing of adenine in both DNA and RNA?

Adenine pairs with thymine in DNA and with uracil in RNA.

A promoter region is a specific:

DNA sequence where RNA polymerase can bind to initiate transcription.

According to the central dogma of molecular biology, the genetic information flows as follows:

DNA →→ RNA →→ Protein

Which one of the following statements about RNA is INCORRECT?

RNA is usually found in double-stranded form, just like DNA.

What is the name of the enzyme complex that forms at the start of transcription?

RNA polymerase

transcription refers to the process in cells where information from:

a DNA strand is used to synthesize RNA

the base uracil pairs with

adenine

During transcription, the template DNA strand and the RNA:

are bound together by hydrogen bonds have an anti-parallel configuration

During transcription, the sequence of the primary transcript (i.e., the new produced RNA) matches

the sense strand, but T is replaces with U the non-template strand, but T is replaced with U

some RNA molecules possess catalytic activity T or F

true