Ch 25 Connect

p53 is a critical cellular protein that is often mutated in cancer cells. Select the statements that are true about p53. Check all that apply.

1. It can initiate DNA repair pathways. 2. It can initiate apoptosis pathways. 3. It can cause cell cycle arrest.

Cancer cells often contain

1. aneuploidies 2. gene amplifications 3. translocations

1. An affected offspring usually has one or two affected parents, and the trait occurs equally in both sexes. 2. Frequently an affected offspring has two unaffected parents, and the trait occurs equally in both sexes. 3. Males are much more likely to exhibit the trait, and mothers of affected males often have brothers or fathers who are affected. 4. Only females exhibit the trait when it is lethal to males, and affected mothers have a 50% chance of passing the trait to daughters.

1. auto dom 2. auto recess 3. x link recess 4. x link dom

1. Genetic diseases are spread by shared environmental conditions. 2. Genetic disorders are more common in families with one affected member as compared to the general population. 3. Both members of identical and fraternal twin pairs have the same likelihood of expressing the same genetic disease. 4. Genetic diseases occur at the same rate in all human populations. 5. Most genetic diseases have a specific age of onset. 6. Many human and animal genetic disorders share similar characteristics.

1. f 2. t 3. f 4.f 5. t 6. t

1. Prions are composed of protein. 2. Prions always exist in the abnormal protein conformation. 3. The prion protein is normally found in nerve cells. 4. Scarpie and mad cow disease are examples of prion diseases. 5. The only way to develop a prion disease is to eat tainted meat.

1. t 2. f 3. t 4. t 5. f

1. Cancer cells are clonal. 2. Benign tumors are invasive. 3. Papillomavirus can cause breast cancer in humans. 4. Metastatic tumors can invade other tissues. 5. Most cancers are the result of exposure to environmental agents. 6. Viruses can cause normal cells to be transformed into malignant cells.

1. true 2. false 3. false 4. true 5. true 6. true

A woman whose father has hemophilia and whose mother does not married a man with hemophilia. What is the probability that they will have a child with hemophilia?

1/2

In a disease that is associated with a single recessive allele, the concordance among dizygotic twins should be ____, assuming both parents are heterozygous carriers.

25

Dizygotic twins share _______ of their genetic information.

50

An individual with Huntington disease has two normal parents. What are plausible explanations for this pattern of inheritance? Check all that apply.

A spontaneous mutation occurred in the mother's germline to produce a mutant HD allele. A spontaneous mutation occurred in the father's germline to produce a mutant HD allele. Huntington disease shows incomplete penetrance.

What is p53?

A tumor-suppressor gene

____________ involves analysis of amniotic fluid. It takes several weeks before the results from amniocentesis are known because there are very few ____________ cells in the fluid. Chorionic villus sampling requires removal of a small part of the ____________ called the chorion. Chorion cells can be ____________ directly so the procedure is quicker. ____________ sampling can occur in the 10th-12th week of pregnancy. Amniocentesis carries ____________ of a risk of miscarriage than chorionic villus sampling.

Amniocentesis fetal placenta karyotyped Chorionic villus less

When are caspases active?

Apotosis

Which of the following DNA sequence repeats within the Huntington gene would be associated with the development of HD?

CAGCAGCAGCAGCAGCAGCAGCAG

What diseases are caused by prions? Check all that apply.

Creutzfeldt-Jacob disease Gerstmann-Straussler-Scheinker disease Familial fatal insomnia

How can a tumor suppressor gene lose its function? Check all that apply.

Gene mutation Aberrant DNA methylation Aneuploidy leading to loss of the tumor suppressor gene

Select the factors that would indicate that a disease had a genetic, rather than an environmental, cause. Check all that apply.

The disease has a specific age of onset. There is a high level of the disease's concordance among monozygotic twins. The disease does not spread to people sharing similar environmental situations.

Select the statements that characterize familial cancers. Check all that apply.

They typically initiate through changes to tumor suppressor genes A predisposition towards developing cancer is inherited, not cancer cells They account for most cases of cancer.

In the analysis of a family, you notice that males are more likely to contract a certain disease and the daughters of affected males produce 50% of their sons affected with the disease. This disease is displaying what pattern of inheritance?

X-linked recessive

A couple has four children, two sons and two daughters. One son has hemophilia and the other does not. One daughter has hemophilia and the other is a carrier. What were the genotypes of the mother and the father?

XHXh-A and Xh-AY

You are analyzing a human pedigree for a new disease and discover that the disease occurs with the same frequency in both sexes and that 25% of the children from two unaffected heterozygous parents have the disease. This disease is displaying ____ inheritance.

auto recessive

What type of inheritance pattern is being shown in the pedigree? Shaded symbols indicated affected individuals.

autosomal dominant

Haplotypes between homologs in the same individual _________; haplotypes for the same chromosome in different individuals ________.

can be the same or different; can be the same or different

The majority of human cancers are caused by ______.

carcinogens

When a scientist is attempting to use haplotype analysis to link a disease-causing allele to a molecular marker, it is important for the marker to be close to the disease-causing allele, otherwise _____ may occur.

crossing over

Within a given tumor type, gene expression is usually uniform among all cells.

false

A baby is born and is suspected of having Down Syndrome. A DNA sample is taken to analyze by karyotyping. This is an example of

genetic testing

1. Chromosomes from a sample of cells are stained and analyzed microscopically. 2. A DNA probe that hybridizes to a particular gene can be used to determine if a gene is present, absent or altered. 3. Antibodies are used to detect the presence or absence of a protein. 4. The enzymatic activity of a protein can be assayed in vitro.

karyotyping in suti immunilogical biochem

A geneticist cannot make sense of a pedigree he has put together for a newly discovered disease that he suspects is transmitted genetically. One possible explanation is

locus heterogeneity

A gene that promotes the development of cancer is called a(n) _______.

oncogene

Herceptin is a drug that is given to treat certain breast cancers. However, it is most effective on tumors that are overexpressing HER2. Therefore, patients are tested for HER2 overexpression before being given Herceptin. This is an example of

personalized medicine

Tamoxifen is a medication used for treating cancer. Many women were found to have resistance to this drug, and research showed that women with a mutation in their CYP2D6 gene could not break down Tamoxifen. Therefore Tamoxifen was not a useful treatment for their cancer. Women can now be screened for this mutation, allowing clinicians to use a therapy that is effective for each woman. This type of treatment is an example of

personalized medicine

In the future, it is conceivable that a doctor will check your sequenced genome before prescribing you medicine to ensure proper dosage and check for certain alleles that may affect drug metabolism in your body. This is an example of

pharmacogenetics.

A _______ is a cellular gene that has the potential to become an oncogene.

proto-oncogene

The International HapMap Project is an effort to identify differences in individual bases known as

single nucleotide polymorphisms.

Cancer is considered clonal because daughter cells from a cancer cell have the same genetic makeup as the parent cell.

true

Checkpoint proteins are encoded by ________.

tumor-suppressor genes

If the couple from the previous question were to have another child what is the probability that it would have hemophilia?

1/2

A woman whose father has hemophilia and whose mother does not married a man that does not have hemophilia. What is the probability that they will have a child with hemophilia?

1/4

A young man knows that his grandfather had Huntington disease (genotype Hh). However, his father passed away at the age of 26 without ever being tested or showing signs of HD. Neither the young man's mother nor his grandmother had Huntington disease. What is the probability that this young man will develop HD when he is older?

1/4

In a disease that is caused by a single gene, the concordance among monozygotic twins should be ____.

100

If the individuals in the picture above had a child, that child could have which haplotype listed (assuming no crossing over)?

1A2A3A4A; 1C2C3C4A

You are working in a lab where you are studying a disease that is known to be caused by a single nucleotide change, although the effect this change ultimately has on the protein's structure/function is unknown. You have DNA samples from multiple patients that you suspect of having this disease. What is the most efficient way to test the samples for the relevant mutation?

DNA sequencing

You are studying a disease that you suspect may be caused by prions. To help support your hypothesis, you decide to test which part of the cell from an infected animal can infect another animal. If the disease is caused by prions, what cellular component will be infectious?

proteins