Ch.7-11 Test

What would happen if crossing over occurred between sister chromatids?

Nothing would happen because sister chromatids are genetically identical or nearly identical.

Cancer-causing genes found in some viruses are called:

Oncogenes

According to Figure 9.11, which of the following is NOT responsible for amplifying the signal in a cell responding to adrenaline signaling?

One adrenaline molecule can bind to and activate many receptors simultaneously.

Why do the functions of many receptor kinases depend on the fluid nature of the plasma membrane?

The receptor monomers must move together and dimerize to be activated.

Epidermolysis bullosa is a set of rare genetic disorders that is caused by:

a keratin gene that disrupts intermediate filaments, weakening epidermal cell connections

A cell's particular shape is largely determined by:

a mesh of proteins and polysaccharides in the extracellular matrix. cytoskeletal protein networks in the cytoplasm. cytosolic proteins that assemble into structures called cell junctions.

A protein on a cell surface that binds to a signaling molecule is an example of which of the following elements of cellular communication?

a receptor protein

Which of the following statements regarding tumor suppressors are true?

Mutations affecting tumor suppressors can contribute to the development of cancers.

The inputs to glycolysis do not include:

NADH

In the lab you isolate a chlorella mutant that is unable to switch xanthophyll pigments into the inactive, non-heat-dissipating form. If you released that mutant into a small pond shaded by trees, would the mutation spread, and why?

No, because the light absorbed by chlorophyll would be released as heat and thus not used to make ATP or NADPH

The basal lamina is:

a specialized form of the extracellular matrix found beneath all epithelial tissues.

From its ground state, photosystem II can:

absorb light energy

In the second phase of glycolysis:

phosphorylated sugar molecule is cleaved and the products rearranged.

second phase of glycolysis

phosphorylated sugar molecule is cleaved and the products rearranged.

All cells able to carry out photosynthesis have:

plasma membrane

Cell signaling between two nerve cells can be thought of as an example of paracrine signaling because:

the cells are in close proximity.

The Z scheme refers to:

the changes in the energy level of electron donors during the photosynthetic electron transport chain

Which is the only reaction in the citric acid cycle that produces ATP by substrate-level phosphorylation?

the formation of succinate

What determines the specificity of a receptor protein?

the ligand-binding site

The division of genetic material in a eukaryotic cell is called:

mitosis.

Which of the following is NOT found in the extracellular matrix of animal cells?

cellulose

For every six CO2 molecules incorporated into carbohydrate molecules, how many triose phosphates can be exported from the chloroplast?

2

Beta-oxidation of fatty acids does not directly produce:

ATP

What happens to the alpha subunit of a G protein with GDP attached?

All of theses choices are correct

Look carefully at the image of the human karyotype shown in Figure 11.3. What is the significance of the small differences between homologous chromosomes?

Each homologous chromosome in a pair is from a different parent

Chemicals called uncouplers can make membranes permeable to small molecules and ions. What effect might un-couplers have on photosynthesis?

decreased ATP production because the proton gradient would decrease

Phosphorylating glucose during phase 1 of glycolysis:

destabilizes the glucose molecule so that it can be broken down in phase 2.

During pyruvate oxidation, pyruvate is broken down into CO2 and an acetyl group. The CO2 is:

less energetic than the acetyl group.

Which type of receptor is involved in rapid responses of muscle cells and neurons?

ligand-gated ion channel

ATP production in photosynthesis requires:

light, electrons and protons

The chemical bonds of carbohydrates and lipids have high potential energy because:

many of these bonds are C—C and C—H bonds

Which of the following is a product of the breakdown of fatty acids from lipids? Select all that apply

FADH2 NADH acetyl-CoA

Pyruvate oxidation is remarkably similar to glycolysis in that when one molecule of pyruvate enters into a mitochondrion, two molecules of acetyl-CoA are formed

False When one glucose molecule enters the glycolysis stage, two molecules of pyruvate are formed. When one molecule of pyruvate enters pyruvate oxidation in the mitochondrial matrix, it is converted into one molecule of acetyl-CoA when part of the one pyruvate molecule is oxidized and has some that splits into carbon dioxide.

Which one of the following is a candidate for the FIRST electron donor?

Fe2+

Many scientists use a specific type of mouse cell to coat the surface of petri dishes. These cells form a layer on which other kinds of cells, often of different species, can adhere and grow. The mouse cells used to coat petri dishes are likely:

Fibroblasts

Imagine that a eukaryotic cell carries a mutation impairing its ability to phosphorylate glucose during glycolysis. What is a likely result of this mutation?

Glucose could move out of the cell, slowing cellular respiration

During their experiments with chlorella, Calvin and Benson found no free glucose. Why do you think this is?

Glucose is stored as starch

_____ is found in animals, and possesses a large, central protein. _____ is found in plants, and lacks a central protein

Glycogen; Starch

Dynamic instability is the rapid assembly and disassembly of:

micro-tubules

Which of the following enable(s) the movement of cells?

microtubules and microfilaments

Macrophage cells undergo a process called phagocytosis in which material is brought into a cell in the form of membrane vesicles and then transported along microtubules toward the cell center. Assuming that the centrosome is near the cell center, you can predict that these vesicles are moving to the _____ end of microtubules using the motor protein _____.

minus end; dynein

In eukaryotes, pyruvate oxidation takes place in the:

mitochondrial matrix

Microtubules increase in length:

more quickly at one end than the other. if free tubulin dimers are available. in cycles, following rapid depolymerization. by growing outward from the centrosome.

Review the experiments by Kohler and Lipton described in Fig. 9.5.

Molecules found in serum promote cell growth; these molecules are not found in plasma.

What would happen to the daughter cells if the G2 phase of the parent cell is shortened?

The cells would be smaller than normal

The epidermis contains several layers and receives its nutrients from the dermis by diffusion. Which of the following explains why the outermost layers of the epidermis consist of dead cells?

One of the major functions of the epidermis is forming a waterproof barrier. Once that barrier is formed, nutrients cannot pass through it and the cells beyond that layer die

The area where the epidermis and the dermis meet is highly folded so that the epidermis "fits" into the dermis. What do you think is the function of this highly folded area?

The epidermis is the outer layer and is under constant physical stress. This highly folded area between the epidermis and the dermis gives the epidermis additional support and protection against abrasive stress

Imagine that you are examining a mouse that does not produce basal lamina in the skin. How will this mouse be different from a normal, wild-type mouse?

The epidermis will not be connected to the dermis

The prokaryotic protein FtsZ is evolutionarily related to eukaryotic tubulin. What does this mean?

The gene sequence for FtsZ is similar to tubulin. -The amino acid sequence for FtsZ is similar to tubulin. -The overall protein structure of FtsZ is similar to tubulin. -The two proteins evolved from a common ancestral protein

Which of the following is not true regarding CDKs?

The levels of CDK change with the cell cycle.

Crossing over occurs during which step in meiosis?

Prophase I

Which of the following statements is true regarding pyruvate oxidation?

Pyruvate oxidation forms the same number of NADH (per glucose molecule) as glycolysis.

Which of the following compounds is required for the carboxylation step of the Calvin cycle?

RuBP

The Calvin cycle includes 15 enzymes, most of which are involved in:

RuBP regeneration

The regeneration of RuBP typically limits the rate of photosynthesis under low light intensities. This is because:

RuBP regeneration requires ATP

When in the cell cycle would you find sister chromatids?

S and G2

Predict what would happen if an embryonic epidermal cell switched from expressing E-cadherin to N-cadherin

The cell would leave the epidermis and join the neural cells

Which of the following statements is TRUE if a cell has a mutation in the p53 gene such that the p53 protein is no longer able to be phosphorylated?

The cell would proceed through the cell cycle even in the presence of DNA damage

Imagine that a researcher is studying the embryonic development of mice that do not express the signal molecule Delta. What will likely be true of these mice?

The mice will have fewer glia compared to their normal counterparts

Which of the following statements is true regarding the earliest photosynthetic organisms on Earth?

The organisms likely used molecules other than water (i.e., H2S) as electron donors.

Which of the following statements is true regarding the equation C6H12O6 + 6O2 →6CO2+ 6H2O + energy?

The oxygen atoms in both CO2 and H2O are electronegative, and glucose is considered a reducing agent.

Which of the following statements is NOT true about gamete formation in mammals?

The polar bodies formed during meiosis in the female can participate in fertilization with sperm

A researcher is carrying out an experiment where she labels a protein with a fluorescent tag (so she can visualize its location in a cell), and introduces this tagged protein into the lumen of a single thylakoid. She observes her treated cells periodically, and notices that the labeled protein can move between grana, but is never observed in the stroma. What can she deduce? Please choose the correct answer from the following choices, and then select the submit answer button

The protein likely travels through a common lumen shared by thylakoid membranes and grana, and cannot easily diffuse through the thylakoid membrane

A researcher introduces a signal produced by bacteria to eukaryotic cells that she is culturing in the laboratory. Remarkably, she notices that this signal results in an increase in eukaryotic gene expression. How is this possible?

The signal is either similar in structure to a ligand used by eukaryotes, or this signaling pathway is utilized by both prokaryotes and eukaryotes

A researcher is assessing the expression of a certain protein in cells. This protein appears as a "web" in the cytoplasm of cells. The protein is likely:

a component of the cytoskeleton

The activation of protein kinase A by cyclic AMP binding likely occurs because of:

a conformational change to protein kinase A.

Which one of the following is NOT a product when photosystem II oxidizes a molecule of water?

carbon dioxide

Which is the correct order from lesser to greater complexity for the following?

cells, tissues, organs

Which one of the following does NOT actively move protons from the mitochondrial matrix to the intermembrane space?

complex II

A researcher is studying a population of cells that are shaped normally, but appear to slide past one another. This is likely the result of mutations in genes encoding:

components of cell junctions

Which of the following is thought to be the first group of organisms able to use water as an electron donor in photosynthesis?

cyanobacteria

The amount of _____ is fairly constant throughout the cell cycle, but the amount of _____ varies.

cyclin-dependent kinase/DNA

Which of the following is responsible for the transport of electrons between photosystem II and photosystem I?

cytochrome b6f.

In addition to chlorophylls, light-harvesting antennae include other pigments. What is the benefit of these additional pigments? Please choose the correct answer from the following choices, and then select the submit answer button.

narrower range of wavelength reflection

Which of the following statements is true regarding aerobic respiration?

none of the choices are correct

Which of the following statements is true regarding pyruvate and glucose?

none of these choices are correct

Which of the following statements is true regarding the Calvin cycle?

none of these options are correct

The citric acid cycle is a cycle because the starting molecule, _____, is regenerated at the end

oxaloacetate

The citric acid cycle begins when acetyl-CoA combines with _____ to form _____.

oxaloacetate; citrate

The electron transport chain is part of:

oxidative phosphorylation

In cellular respiration, glucose is _____ to CO2 and oxygen is _____ to water.

oxidized; reduced

The final electron acceptor of the electron transport chain is:

oxygen

Which of the following does not occur during the third phase of glycolysis?

oxygen consumption

Platelet-derived growth factor (PDGF) is a signaling molecule that functions in which of the following types of cell signaling?

paracrine

In a thylakoid membrane, absorbed light energy is passed from one chlorophyll molecule to another until it is:

passed to a reaction center

Many scientists are working to generate organs in vitro. In some cases, cells are seeded onto a "scaffold" shaped like the desired target organ. Such scaffolds are likely composed of extracellular matrix proteins.

true

The alignment of chromosomes at metaphase of meiosis II is most similar to the alignment of chromosomes during metaphase of mitosis.

true

There is no correlation between genome size and complexity of an organism?

true

the experiment in Fig. 8.3 demonstrates that the percentage of 18O2 increases when the:

water in the experiment contains 18O2.

Photosystem I is a _____ than photosystem II

weaker oxidant and a stronger reductant

Which layer of the extracellular matrix of a plant provides the greatest strength?

the secondary cell wall

If two signaling pathways are activated simultaneously:

they may strengthen each other. one may inhibit the other. they may inhibit each other

How many subunits make up some types of G protein?

three

How does an "activated" receptor transfer information into the cell?

through a conformational change of the receptor

How do cells connect to the extracellular matrix?

through integrins

Light energy is converted to chemical energy in the

thylakoid membrane.

The phosphorylation of glucose during glycolysis serves to: (Select all that apply.)

trap imported glucose inside the cell,destabilize the molecule, making it easier to cleave

Signaling molecules involved in paracrine and autocrine signaling:

travel by diffusion

Notch and Delta are both transmembrane proteins involved in cell communication in the developing nervous system of vertebrate animals. What makes Notch different from Delta?

Notch is a receptor and Delta is a signaling molecule.

Which of the following is a mesh-like attachment between cells formed by binding of transmembrane proteins of one cell to the same protein type on the adjacent cell, preventing substances from passing between cells?

tight junction

What is the function of histone proteins?

to package DNA in eukaryotic chromosomes

Coenzyme Q and cytochrome C:

transfer electrons between protein complexes of the electron transport chain

A single molecule of glucose requires _____ "turn(s)" through the citric acid cycle for its chemical energy to be completely harvested

2

For every six CO2 molecules incorporated into carbohydrate molecules, how many triose phosphates can be exported from the chloroplast? Please choose the correct answer from the following choices, and then select the submit answer button.

2

How many reactions in glycolysis directly generate ATP?

2

How many chromosome pairs are there in a normal human genome?

23

A photosynthetic electron-transport chain captures in chemical form approximately what percentage of the sun's usable energy arriving at the surface of a leaf?

24%

How many CO2 molecules must enter the Calvin cycle for each molecule of triose phosphate that can be exported from the chloroplast?

3

After pyruvate oxidation, the chemical energy of how many carbons of the original glucose molecule is converted to chemical energy in the form of ATP in the remaining steps of cellular respiration?

4

Approximately what percentage of the sun's output is available for photosynthesis?

40%

At the start of mitosis, how many centromeres are present in a human cell?

46

Why don't plant cells use a contractile ring to divide their daughter cells?

A contractile ring can't "pinch" a cell wall

Many diseases are the result of a problem with cell signaling. Which of the following diseases best exemplifies this fact?

A specific type of cancer, caused by a truncated receptor that becomes stuck in the activated form

Ligand binding to a receptor kinase results in

All of these choices are correct phosphorlyation of the cytoplasmic domain of the receptor. binding of cytoplasmic signaling molecules. receptor dimerization

Which of the following is TRUE about the Delta protein?

All of these choices are correct. Delta is produced by embryonic stem cells as they differentiate into neurons in the brain. Delta directly signals to a Notch transmembrane protein in adjacent cells. Delta directs adjacent cells to differentiate into glial cells Delta is a transmembrane protein found in embryonic brain cells.

A researcher is studying a population of eukaryotic cells. He notices that—regardless of the presence of ATP or ADP—the PFK-1 enzyme fails to function properly. Why?

Any of these choices are correct :a. These cells may carry a mutation that affects binding sites of the PFK-1 enzyme. b. These cells may carry a mutation that causes an over-production of citrate. d. These cells may carry a mutation that alters the active site of the PFK-1 enzyme.

In what way is cytokinesis in plant cells similar to binary fission in a bacterium?

Cell wall material is deposited to seperate the daughter cells

According to Figure 9.6, what is a key difference between cell signaling by a cell-surface receptor and cell signaling by an intracellular receptor?

Cell-surface receptors bind polar signaling molecules; intracellular receptors bind nonpolar signaling molecules.

What is the advantage of forcing materials to travel through cells instead of between cells?

Cells can control which materials are transported, exposure to bacteria/viruses is limited, and exposure to toxins is limited

Muscle cells in the mammalian heart are multinucleate, meaning that multiple nuclei are present in the cytoplasm of a large cell. Predict what is different about the cell cycle in a muscle cell.

Cytokinesis does not occur

Which of the following statements is true regarding binary fission?

DNA replication during binary fission is a bidirectional process, occurring in opposite directions.

Predict what would happen if crossing over between homologous chromosomes occurred as part of mitosis.

Daughter cells would not be genetically identical, and they could contain two copies of the same allele.

Which of the following is NOT true about the eukaryotic cell cycle?

Interphase is typically the shortest of the two stages of the cell cycle

In plants and algae, ____ is the source of the electrons needed for photosynthesis.

H2O

Some present-day bacteria use a system of anaerobic respiration characterized by an electron transport chain analogous to that found in aerobic organisms. Which of the following correctly characterizes the anaerobic electron transport chain?

It establishes a proton gradient between the cytoplasm and the extracellular fluid.

What is the role of the protein FtsZ?

It forms a ring at the site of constriction.

What properties are associated with a malignant cancer?

It is fast growing. It invades surrounding tissue. It is metastatic.

Which of the following correctly characterizes the F1 subunit of ATP synthase?

It is the catalytic unit that synthesizes ATP

Why would a compound that interferes with bacterial cell wall synthesis be useful for treating a bacterial infection?

It would limit the spread of the infection

Which of the following statements is not true regarding a neurotransmitter?

Like Delta or Notch, neurotransmitters are usually attached to the cell surface.

Collectively, most photosynthesis carried out in the ocean is performed by single-celled organisms as opposed to large, multicellular marine plants

true

Could an isolated melanin granule move along an actin microfilament?

No, motor proteins are specific for the type of filament they bind

How many molecules of NADPH are required for 12 molecules of RuBP to be carboxylated by rubisco?

None of these options are correct;the six carbon compound that is produced when carbon dioxide and RuBP immediately breaks into two molecules of 3-phosphoglycerate which is the first stable product of the calvin cycle.

In plants, the ultimate electron donor in photosynthesis is water

true

Which of the following has the MOST similarity in nucleotide sequence?

Sister Chromatids

How must spindle microtubules attach to chromosomes during prometaphase of meiosis I?

Spindle microtubules from one pole must attach to both kinetochores in a pair of sister chromatids.

Why don't steroid hormones bind to transmembrane cell-surface receptors?

Steroid hormones are nonpolar and cross the cell's plasma membrane, binding to receptors inside the cell.

How does the extracellular matrix affect a cell that it surrounds?

The size that the cell grows to depends in part on the polysaccharides in the extracellular matrix. The cell's shape depends in part on the structure and composition of the extracellular matrix. The genes that the cell expresses depend in part on the types of proteins in the extracellular matrix.

Which of the following steps in prokaryotic binary fission is CORRECT?

The two replicated chromosomes remain attached to the plasma membrane. Cell wall material is laid down at the midpoint to separate the two daughter cells. All of these choices are correct. DNA is replicated bidirectionally from a single point on the circular chromosome. The cell continues to grow outward symmetrically, separating the two chromosomes.

Recall from the text the example of cell communication in Streptococcus pneumoniae: the rate of DNA uptake by pneumococcal cells increases sharply when they are at high density due to changes in gene expression brought about by signaling between cells. If the pneumococcal cells did not express receptor protein, how would the rate of DNA uptake be affected when the cells reach high density?

There would be no change in the rate of DNA uptake

A researcher is evaluating the expression of p53 in cells she is culturing in the laboratory. She notices that in a small group of cells, high levels of phosphorylated p53 occur in the nuclei. What can she deduce about these cells?

These cells likely contain damaged DNA

Many scientists use chemical inhibitors to interfere with normal signaling pathways within eukaryotic cells. If such inhibitors are large, nonpolar molecules, what is the likely method of action of these chemical inhibitors?

These chemical inhibitors likely bind to receptors and interfere with receptor activation or signal-receptor binding.

Which of the following statements is true regarding Earth's earliest organisms?

These organisms likely carried out fermentation and may have had rudimentary proton pumps

How do new cyclin proteins appear in the cytoplasm?

They are made through protein synthesis.

Which of the following is not a true statement about receptors that are localized to the nucleus?

They bind polar ligands.

Gap junctions and plasmodesmata have what feature in common?

They both allow direct transport of materials between cells

Why are the X and Y chromosomes not considered homologous?

They do not carry the same set of genes, and mammalian males carry two very different sex chromosomes.

Which of the following is true concerning the Calvin cycle and light-harvesting reactions of photosynthesis?

They take place in different compartments of the same organelle.

How did the earliest organisms on Earth most likely produce ATP?

by glycolysis

A researcher is evaluating the role of a growth factor during embryonic development. She notices that this factor functions in both neural development and limb development. How is that possible?

all of these choices are correct

A researcher is studying a G protein-coupled receptor in eukaryotic cells. In one group of cells, he notices that even though a ligand can bind to its G protein-coupled receptor, nothing happens. Why could this happen?

all of these choices are correct

During what step in meiosis do the daughter cells become haploid?

anaphase 11

In the eukaryotic DNA sequence below, each highlighted sequence consists of a simple-sequence repeat. How are the highlighted regions organized relative to each other? ATTATCATCATCATCATCATTTACTAATCCTCATCATCATCATCATGGAATCTACATCATCATCATCAT

as dispersed repeats

In which form are electrons transferred during typical redox reactions such as the oxidation of glucose?

as hydrogen atoms

The microtubules that form the mitotic spindle extend out from the centrosome. Where would you expect to find the plus (fast assembling) end of a spindle microtubule?

away from the centrosome, at the kinetochore

Lactic acid fermentation occurs in

bacteria and animals

Cadherins bind to which type of cytoskeletal element(s)?

both intermediate filaments and microfilaments

Which of the following cytoskeletal elements is capable of assembling and disassembling in the cell?

both microtubules and microfilaments

Within the plant cell wall, the primary cell wall contains ______, and the secondary cell wall is composed of ______

both pectin and cellulose; both lignin and cellulose

The natural loss of dead cells from the surface of your skin is a result of:

both the loss of adherens junctions between epithelial cells, and the breakdown of desmosomes

Cell signaling over a long distance is known as:

endocrine signaling

Antennae accompany reaction centers, promoting _____

energy transfer

All cancers are caused by viruses.

false

Given that most ligands form covalent bonds with their associated receptors, these complexes are more or less permanent and can only be broken through the hydrolysis of ATP.

false

Based on the data provided in the two graphs shown in Fig. 9.5, which method of culturing resulted in the greatest number of fibroblast cells on day 6?

fibroblasts cultured with serum

Where does the oxygen come from that is produced as a by-product of photosynthesis?

from the breakdown of water

In cellular respiration, oxygen:

gains electrons and is an oxidizing agent.

The genome of a virus can contain which of the following?

genes that code for surface proteins genes that code for components of the capsid genes that code for reverse transcriptase genes that code for proteases

Kohler and Lipton first discovered platelet-derived growth factor by observing that fibroblasts:

grew better in cell culture when blood serum from clotted blood was added to the growth medium instead of blood plasma from unclotted blood

Which of the following is a button-like point of attachment formed by the linking of integrins to intermediate filaments inside the cell and their binding to a protein of the extracellular matrix on the outside of the cell?

hemidesmosomes

Sexual reproduction results:

in a new generation that is not genetically identical to its parents. in a new generation with the same number of chromosomes as each parent. in offspring that are not genetically identical. from combining genetic material from two gametes.

Paraquat is an herbicide that blocks the transfer of electrons from photosystem I to NADPH. Mechanistically, paraquat is effective because it:

increases the formation of reactive oxygen species

PFK-1 is _____ by ATP and _____ by ADP.

inhibited; activated

With the endosymbiotic hypothesis in mind, what structure within modern-day chloroplasts is likely derived from the plasma membrane of ancestral cyanobacteria that took up residence within a eukaryotic cell?

inner membrane

In skin, the cells of the epidermis connect to the basal lamina through cellular junctions known as hemidesmosomes. Select the cytoskeletal element that helps maintain the integrity of this connection.

intermediate filaments

Which of the following provide structural support for epithelial cells, such as those in the skin (keratinocytes)?

intermediate filaments

Ras is a type of G protein because it:

is only active when it binds GTP.

Zebrafish embryos change the color of the melanophore cells in their skin to a darker shade by:

kinesin motor proteins moving pigment granules outward from the center of the cell

In human cells such as muscle tissue, the product of fermentation is:

lactic acid

In nerve cells, the centrosome is located near the nucleus. Vesicles move from near the nucleus to the end of long extensions (axons) along microtubules. Based on these two facts, it is possible to conclude that these vesicles are moving in the _____ direction on the microtubule using the motor protein _____.

plus end; kinesin

The occurrence of photorespiration _____ CO2 and _____ ATP.

producers; consumers

According to Figure 9.14, phosphate groups play a key role in receptor kinase activation by:

providing binding sites to recruit and activate signal-transduction proteins.

Another name for acetyl-CoA synthesis, is:

pyruvate oxidation

Which step of the Calvin cycle would be affected first by a lack of NADPH?

reduction

Which of the following is not an essential element involved in communication between all cells?

second messenger

The most likely reason(s) a metastatic tumor cell might lose its connection to the basal lamina would be:

the loss of integrin proteins from the cell's surface, or a change in the type of integrin proteins present on the cell's surface.

In eukaryotic cells, the oxidation of pyruvate occurs in:

the matrix of the mitochondria.

The first event that happens after a signaling molecule binds to a receptor is:

the receptor is activated

The extracellular matrix is composed of: (1) proteins; (2) polysaccharides; (3) nucleic acids

statements (1) and (2) are correct

With the endosymbiotic hypothesis in mind, which of the following within modern-day chloroplasts is likely derived from the cytoplasm of ancestral cyanobacteria that took up residence within a eukaryotic cell?

stroma

In glycolysis, ATP is synthesized by:

substrate-level phosphorylation

Studies of rapidly dividing embryonic animal cells revealed:

that the production of cyclin proteins is followed by activation of CDK enzymes. a cyclic production of certain proteins in sync with the cell cycle. a cyclic activation of protein kinases in sync with the cell cycle. that inhibition of protein production blocks mitosis

A cadherin protein can only bind to:

the extracellular domain of the same type of cadherin.