Chapter 14. Biotechnology and Genomics

Réussis tes devoirs et examens dès maintenant avec Quizwiz!

What are some of the advantages of molecular pharming in animal versus bacteria?

-Animals can make large quantities of the protein products -Proteins remain stable and do not degrade quickly -Animals can fold the proteins properly.

Of the list below, which two answers components necessary for the polymerase chain reaction to occur.

-DNA polymerase -Nucleotides

Which of the following are direct applications of bioformatics?

-Determining the function of genes -Comparison of our genome to model organisms -Discovering the interplay of genes and proteins in our cells.

what type of information can be gained from studying whole genomes?

-Function of genes -Function of intergenic sequences -Sequence of bases -Function of introns.

choose the characteristics of structure of eukaryotic chromosomes

-Genes are fragmented into exons and introns -Genes randomly distributed -More complex than prokaryotic chromosomes

Genomics seeks to determine ____

-How many genes we have -The sequence of the bases in DNA

select the benefits of using genetically modified plants?

-Increased crop yield -Pest resistant crops -Herbicide resistant crops -Production of human proteins.

which of the following are vectors that have been used for in vivo gene therapy?

-Liposomes -Lentiviruses -Adenoviruses

which of the following are applications of transgenic bacteria?

-Product of insulin -Clean up oil spills -Production of growth hormone

Select the choices that may refer to a plasmid.

-Prokaryotic DNA -Vector

Transposons are able to

-Regulate the activity of other genes -Play a role in evolution of organisms

which of the following explains why we need a broader definition of gene?

-Some prokaryotes ave RNA genes -The end product of some DNA is RNA (not a protein) -Genes can be split across several loci across the genome

Which of the following are possible functions of introns in eukaryotic genes?

-They allow a variety of proteins to be made from a single gene -They can regulate gene expression

Which of the following are methods for creating genetically modified animals.

-Vortex mixing of animals cells with foreign DNA -Microinjecting foreign DNA directly into egg cells

select applications for PCR from the choices below

-confirming a genetic disorder -Evolutionary studies -Confirming a cancer -Confirming paternity -DNA fingerprinting -Confirming a viral infection.

PLace the steps in ex vivo gene therapy for familial hypercholesterolemia in the correct order. Begin with the first step at the top.

1. A portion of the patient's liver is removed 2. Liver cells are infected with virus carrying normal gene 3. Removed liver portion is reconnected in the patient's body.

Arrange the steps used to clone a mammal from beginning to end.

1. An egg is collected from a donor and encleated 2. Inject nucleus of somatic cell different donor into encleated egg. 3. The donor egg is induced to start dividing 4. The dividing egg is implanted into a surrogate 5. A clone (of DNA donor) is born.

List the sequential order of events in ex vivo gene therapy of the disease SCID

1. Bone marrow is removed form the patient's body 2. Bone marrow cells are injected with a virus carrying a corrected gene 3. Bone marrow cells are injected into the patient 4. Normal bone marrow cells divide to produce normal blood cells.

List the sequential order of events that occur during the production of recombinant DNA (rDNA)

1. Identify an mRNA from a target gene 2. Use reverse transcriptase to produce a complementary DNA 3. Cleave the cDNA and vector DNA with same restriction enzyme 4. Introduce DNA ligase to connect sticky ends of DNA 5. Allow vector to reproduce to clone the gene

The human genome is composed of about ____ repetitive DNA elements.

50%

Which answer would be an example of unique noncoding DNA?

ATCGAAATTCGGGCTACCAAC

A proteome is:

All of the a species' proteins

Transposons were discovered by _____.

Barbara McClintock

Why was sperm often used as the source of DNA for the human Genome project?

Because of the high ration of DNA to protein

____ is a new technology that acts as a "molecular scalpel", which allows scientists to edit specific gene sequences.

CRISPR

a new form of genome editing called ____ is being researched to allow pigs to grow additional organs for human transplant.

CRISPR

Repetitve DNA elements make up the ____ of chromosomes and the chromosome ends which are called ____.

Centromeres; telomeres

Unlike eukaryotic organisms, prokaryotic organisms have a single ____ chromosome.

Circular

Comparing the human genome to that of other organisms is called ____ genomics.

Comparative

PCR is a technique used to create copies of a segment ____ quickly in a test tube.

DNA

why is DNA polymerase important to the PCR reaction?

DNA has to be replicated

which enzyme is used during recmbiant DNA production to link foreign DNA to vector DNA?

DNA ligase

Match the parts of the eukaryotic DNA with its function.

Exon- Regions of a gene that will eventually become translated into proteins Intron- Regions of a gene that will be excised after transcription Intergenic sequences- Regions of the genome located between genes.

True or false: Short tandem repeat fingerprinting can be used to identify cancer in humans.

False

True or false: Unique noncoding DNA changes often and is not conserved through evolutionary time.

False

The common DNA fingerprinting technique involves tagging short tandem repeats (STRs) with ____, so that a computer can analyze the emission of each fragment.

Fluorescence

which of the following technologies also happens naturally?

Gene cloning

The human genome can be compared to genomes of model organisms such as mice, fruit flies and yeast through the field of comparative ____.

Genomics

The ____ Project sought to determine the complete sequence of human DNA.

Human Genome

____ therapy delivers the gene to the body or cells directly.

In vivo gene

There is interest in injection p53, a tumor suppressing gene, into cancer cells. This is an example of"

In vivo gene therapy

DNA regions that reside between genes on a chromosome are called ____ sequences.

Intergenic

Multiplying bacteria on spoiled food, plants with new underground shoots, and identical twins are all examples of ____ cloning.

Natural

What is the general term used when small regions of DNA differ among individuals?

POlymorphism

An accessory ring of DNA in bacteria, often used as a vector in gene cloning, is a(n) _____.

Plasmids

____ interference is when small pieces of RNA are used to silence the expression of specific alleles.

RNA

a large percentage of what was once considered "junk DNA" is actually transcribed into ____.

RNA

The sequence AAGCTTCGTTC is found five different places on a chromosome. It is a(n):

Repetitive DNA element

The term, ____ DNA element, is used to describe when a sequence of two or more nucleotides is repeated many times along the length of one or more chromosomes.

Repetitve

DNA is cut with ____ enzymes at specific points during recombinant DNA production.

Restriction

Which tandem repeat type is used in determining famillial relationships?

Short tandem repeats

A(n) ____ repeat is a type of repetitive DNA element in which repeats occur one after another on a chromosome

Tandem

What does the "chain reaction" in the polymerase chain reaction mean?

Targeted DNA is repeatedly replicated.

Genomics is ____

The study of genomes

which of the following happens first in the process of recombinant DNA production?

The target DNA and vector are treated with the same restriction enzyme.

Why does the DNA polymerase used for PCR need to come from the organism THERMUS AQUATICUS?

This organism produces a DNA polymerase that can withstand heat

genetically modified organisms that have had foreign DNA inserted into their genome are said to be ____ organisms.

Transgenic

true or false: The word 'fingerprinting" is used to describe the technology of DNA fingerprinting because like a fingerprint, each human has their own unique DNA pattern.

True

A plasmid is often used in biotechnology applications as a(n) ____ to transfer foreign genetic material.

Vector

There is interest in injection p53, a tumor suppressing gene, into cancer cells as a form of in vivo therapy. The idea is that p53 would cause cancer cells to undergo

apoptosis

The field of study that relies heavily on computer technologies to analyze genomic and proteomic data is called ____.

bioinformatics

the process by which bacteria can be used to clean up a toxin or pollutant in the environment is called ____.

bioremediation

Products made with or derived from transgenic or genetically modified organisms (GMOs) are called ____ products

biotechnology

A knockout mouse has had.

both alleles for a gene removed

the process that is used to seperate DNA fragments according to size is____.

called gel electrophoresis

Ex-vivo therapy removed ____ from the body, genetically, modifies them, and then reinserts them.

cells

The production of genetically copies of DNA, cells, or organisms through some asexual means is called ____.

cloning

Organism complexity is ____ related to its proportion of non-gene DNA.

directly

In genetically modified animals, foreign DNA is introduced into ____.

eggs

What specific type of genomic study determines the role of the genome in cells and organisms?

functional genomics

The type of cloning through which identical copies of a functional unit of DNA made is called ____ cloning

gene

Introns can regulate which genes may undergo transcription and how the mRNA gets spliced Thus introns can be said to regulate ____.

gene expression

____ engineering is a modern field that allows scientists to change genomes, this can be to create biotechnology products or change the organism's characteristics.

genetic

Biotechnology products are produced by ____ modified organisms.

genetically

an organism that carries a foreign gene in their genome is a ____ organism.

genetically modified

Functional genomics tries to understand the exact role of the ____ in cells orgranisms

genome

if there are two different genes that code for the same protein, these are considered ____ genes.

homoiogous

A(n) ____ repeat is a type of repetitive DNA element that is spread across several regions of a chromosome.

interspersed

If a segment of non-coding DNA contained a sequence TTAG every 2,000 bases throughout the entire chromosome, you would call this a(n) ____ repeat.

interspersed

Gene therapy ____

is an accepted therapy for treatment of a disorder or disease

In research involving the SRY gene, when an embryo was injected with the SRY gene it became ____ ; when an embryo was not injected with the SRY gene it became ____.

male; female

what is the most complex type of organism science has been able to clone?

mammal

DNA ____ have microsopic amounts of DNA sequences on a glass slide, which allow visualization of which genes are turned on in specific cells.

microarrays

The process of gene pharming is most often used in transgenic animals to produce ____.

pharmaceuticals

Gene ____ describes the production of pharmaceuticals using transgenic animals.

pharming

one method of making a genetically modified ____ is by subjecting a protoplast floating in foreign DNA to an electric current.

plant

An individuals's genetic ____ shows their genome, including mutations

profile

A major goal of proteomics is to identify and determine the function ____ within a particular cell type.

protein

A plant cell whose whose cell wall is removed is called a(n) ____.

protoplast

A segment of DNA containing genes from both mice and humans would be called ____ DNA

recombinant

PCR works by amplifying short tandom ____ sequences (STRs), sequences of DNA that are repeated many times and are considered noncoding.

repeat

DNA gel electrophoresis is able to ____ DNA fragments.

sort

The source of DNA for sequencing the human genome came mostly from:

sperm

After DNA is cut by a restriction enzyme, often a "____ end" forms, allowing one place of DNA to attach to a foreign piece of DNA.

sticky

If a segment of non-coding DNA contained a sequence TTGTTTAGTTTGT, you would call this a(n) ____ repeat.

tandom

Gene ______ is a correction of detrimental DNA mutation by inserting new DNA into the genome.

therapy

DNA sequences able to randomly move from one site to another in the genome are called ____.

transposons

A lab technician can introduce rDNA into a host cell using a ____.

vector


Ensembles d'études connexes

Options Lesson 5 - Naked Call Writing

View Set

Gross Domestic Product (GDP), Unemployment, and Inflation

View Set

Digestive (worksheet) 13.2 and part 2

View Set

Lesson 4: Strong Rulers Unite China Honors World History A Unit 5: Ancient India and China

View Set

A & P Quick Cards 10, 11, 12, 16, 17, 18, 19

View Set

Abeka: English 10 Appendix Quiz N

View Set

Introduction to computer concepts IST 101

View Set

Parts, Function and purpose of a network switch

View Set