dna cloning and sequencing

what were the assumptions made when fragmenting the human genome with restriction enzymes?

% AT = % GC base sequence of human genome is random (NOT TRUE)

what are the steps involved in sequencing a genome via whole-genome shotgun strategy?

1. fragment the genome to make overlapping fragments. 2. clone each fragment to construct a genomic library (collection of clones representing a genome) 3. sequence the ends of each DNA fragment for millions of clones 4. assemble the sequences

what is the probability that any six-base restriction site (EcoRI) will be found in a genome? what will be the average size of each fragment? how many fragments will be made from the human genome?

1/4 x 1/4 x 1/4 x 1/4 x 1/4 x 1/4 = 1/4096 or 4^6 = 4096 base pairs 3,000,000,000 / 4096 = 700,000 fragments

You generate overlapping fragments of the human genome and obtain the following fragments from the same DNA strand. If the top fragment is the at the left end of the complete sequence, what is the correct order of these four fragments following it? 5' ATATATAT--------------------------ATATATAT 3' F1: 5' ATGGCATT--------------------------CCCCCCCC 3' F2: 5' CCCCCCCC--------------------------GCGGCGTA 3' F3: 5' ATATATAT--------------------------TAGCATGG 3' F4: 5' CGTATTCC--------------------------GAGAGAGA 3'

5' Fragment 3 Fragment 1 Fragment 2 Fragment 4 3'

(instapoll) what would be the sequence of a 5 nt primer to use in order to determine the sequence of X1-X5? 5' GATCCX1X2X3X4X5TCCTT 3'

5' GATCC 3' or 5' AAGGA 3'. write reverse complementary strand. needs to go 5' to 3' so find that sequence. the antiparallel of it will be the primer.

(part 2 of previous question) What is the sequence of the smallest DNA molecule that would be synthesized in the sequencing reaction and would contain dideoxyC (ddC)?

5' primer-TTTGC 3'. explanation: smallest on left side and must terminate at "C"

what enzyme do you need to sequence DNA?

DNA polymerase

where would DNA polymerase connect 2 dNTPs?

DNA polymerase connects 5' PO4 of a free nucleotide to the 3' OH of an existing chain

How can you create overlapping fragments?

Digest multiple copies of the genome by sonication, Digest multiple copies of the genome partially with a restriction enzyme.

EcoRI

GAATTC

e. how would the data differ from those shown if you accidentally left the dATP out of the reaction? what if you accidentally omitted the ddATP?

If dATP were left out of the reaction, the only A nucleotides present would be ddATPs. No synthesis products could proceed past the first ddA incorporated (the first T encountered in the template).

(part 2 of previous question) what is the smallest DNA fragment?

J. (the one furthest down)

the DNA molecule whose entire sequence follows is digested to completion with the enzyme EcoRI (5' G^AATTC 3'). how many molecules of DNA would result from this reaction? write out the entire sequence of resultant DNA molecules indicating all relevant 5' to 3' polarities. what about the given sequence appears improbable in relationship to DNA made of random nucleotide sequences? 5' AGATGAATTCGCTGAAGAACCAAGAATTCGATT 3' 3' TCTACTTAAGACTTCTTGGTTCTTAAGCTAA 5'

Note that the DNA molecule depicted has two recognition sites for the EcoRI enzyme. When you cut a linear piece of DNA twice, you end up with three fragments. 5′AGATG 3′ 5′ AATTCGCTGAAGAACCAAG 3′ 5′ AATTCGATT 3′ 3′TCTACTTAA 5′ 3′GCGACTTCTTGGTTCTTAA 5′ 3′GCTAA5′ Because the EcoRI restriction site is 6 bp long (G^AATTC), the enzyme would on average digest DNA of random sequence only once in every 4^6 or 4096 bp. The original piece of DNA shown in this problem is much smaller than 4096 bp, so it would be unusual to find two recognition sites for EcoRI so close together. However, if the DNA that was digested is long (like the 3 billion bp in the human genome), it is likely that somewhere in the genome two such sites would be as close together as these are.

Which of these restriction enzymes will generate smallest number of fragments of the human genomic DNA upon complete digestion? SbfI (CCTGCA^GG) SphI (GCATG^C) HpaII (C^CGG)

SbfI (CCTGCA^GG). explanation: cuts every 4096 (4^6) bp, resulting in smaller number of fragments

2 EcoRI sites are restored after ligation of vector and insert, this is only one possible recombinant DNA. what is the other one?

The insert can go in either of two directions (inverted)

c. how did you know how to design the primer you would need for the sequencing reaction?

You know how to design the primer because: (1) You added the insert into the vector at a known location defined by a specific restriction enzyme; and (2) you know the sequence of the vector that flanks the position of the insert.

what are restriction enzymes?

a class of enzymes called endonucleases. they cut the DNA backbone. digest DNA at a recognition sequence (restriction site). cut between the same nucleotides on top and bottom strand. they are produced naturally as part of the bacterial immune system.

why do cloning vectors have polylinkers?

allow vectors to be opened (linearized) with any one (or two) of several different restriction enzymes so that DNA fragments with any one (or two) of a variety of types of ends can be ligated into the vector.

how does ampicillin resistance work?

amp gene product B-lactamase enzyme cleaves ampicillin. ampicillin cleaves wall synthesis

bp

base pair (double stranded DNA)

primer is designed to?

be complementary to the plasmid sequence adjacent to the unknown insert sequence when you want to sequence the insert of recombinant plasmid you cloned. face insert

what do dideoxynucleotides inhibit?

chain elongation. terminates synthesis because no 3' OH

what is a genomic library and how do you make it?

cloning every piece of genomic DNA. when a collection of cellular clones as a whole contains copies of nearly every sequence in the genome cloned in a vector.

what is needed for sanger sequencing?

depends on DNA polymerase to make new DNA. DNA pol requires template (single strand of DNA to copy), primer (short single stranded DNA complementary to the template, dNTPs (deoxyribonucleoside triphosphates. dATP, dCTP, dGTP, dTTP), ddNTPS (dideoxyribonucleoside triphosphates. ddATP, ddCTP, ddGTP, ddTTP, less abundant than deoxy)

how is the sequence of cloned DNA determined?

determine the sequence at two ends. two separate sequencing reactions will give only the end sequences of an insert, which is too large to be sequenced entirely

(instapoll) will the 2 primers (1 and 2) sequence the same strand or different strands of plasmid DNA?

different strands. they are antiparallel and are using different template strands so their sequenced DNA would also be antiparallel

what is complete digestion?

every restriction site is cleaved, producing non-overlapping tandem fragments

who developed the original sequencing method in 1977?

frederick sanger.

how do you distinguish a recombinant plasmid?

gel electrophoresis

gbp or gb

gigabase. 1,000,000,000 bases

how large is the haploid/diploid human genome?

haploid: 3 billion base pairs diploid: 6 billion base pairs spread through 23 unique chromosomes

what are the 2 ways to make copies of a gene?

insert into vector and replicate in bacteria (in vivo) polymerase chain reaction (in vitro)

what is different about a dideoxynucleotide?

it has no 3' OH group. has H instead

would partial digestion or mechanical shearing generate random fragments?

mechanical shearing

mbp or mb

megabase. 1,000,000 bases

how will restriction enzymes with shorter recognition cleave genomic DNA?

more frequently

(instapoll) can you start out with just one genome copy from a single cell to make overlapping fragments?

no

what are blunt ends?

no overhangs. digestion occurs at the line of symmetry

nt

nucleotide (single stranded DNA)

how are repeats corrected?

paired-end sequencing which correctly aligns repeats by aligning the unique sequences on the other end.

what is EcoRI?

six-base restriction enzyme

what are plasmids?

small circular DNA molecules that are not part of chromosomes. bacteria normally contain plasmids that replicate autonomously from the chromosome. they are easy to purify and manipulate

Does KpnI that cuts 5' GGTAC^C 3' make sticky ends (with what overhangs) or blunt ends?

sticky ends with 3' overhangs

(instapoll) will BamHI restriction enzyme make sticky or blunt ends? 5' G/GATCC 3'

sticky ends with 5' overhang. write out reverse complementary strand.

what happens when ddNTP (dideoxynucleotide) is added?

synthesis stops because there is no 3' OH needed to add next nucleotide

where are the new nucleotides added?

the 3' end of the primer, complementary to the template. there is an equal chance of deoxynucleotide and dideoxynucleotide, if it is di sythesis is terminated

what does the fluorescent dye color of the fragment in gel electrophoresis denote?

the base sequence of the terminal ddNTP of each fragment

how are end sequences aligned?

using computational tools.

how to clone genes in plasmids

1. prepare vector and insert by cutting with same restriction enzyme 2. mix cut vector and insert and ligate (produces recombinant or non recombinant plasmid: more common) 3. transform bacteria with plasmids. make a hole in membrane by electric shock so the plasmids can enter. (produces non transformants: more common or transformants. a transformant with a recombinant plasmid or without) 4. select for transformant plasmid containing bacteria. (each of these colonies originated from one bacterial cell with a single plasmid prior to DNA replication. that bacteria cell divided many times so each colony has a clone of cells with identical plasmids) 5. screen for recombinant bacteria by cutting the plasmid using the same restriction enzyme used for cloning. gel electrophoresis

what is the probability that any four-base restriction site (RsaI) will be found in a genome? what will be the average size of each fragment? how many fragments will be made from the human genome?

1/4 x 1/4 x 1/4 x 1/4= 1/256 or 4^4 = 256 bp 3,000,000,00 / 256 = 12,000,00 fragments

(instapoll) which tubes contain the recombinant DNA on gel electrophoresis diagram?

2 and 4. these have an extra small band, indicating the insert released from the vector

What is the average size of fragments in base pairs (bp) when a random sequence of DNA is digested with a restriction enzyme that has a 4-base recognition site?

256 bp. 4^4

The following picture shows ethidium bromide-stained DNA bands revealed by gel electrophoresis of the same circular DNA digested in three different tubes containing the following restriction enzyme(s): EcoRI only, BamHI only, or a mixture of the two enzymes. The arrow represents the direction of electrophoresis. FYI, a restriction enzyme digests DNA by cutting both strands of a specific, short DNA sequence it recognizes. How many EcoRI and BamHI site(s) are present in this circular DNA?

3 EcoRI sites, 2 BamHI sites. (count number of lines under EcoRI lane and BamHI lane)

You performed a Sanger sequencing reaction and obtained the following chromatogram (a computer-generated trace of the intensity of each color's fluorescence). In this figure, A = green, C = purple, G = black, T = red. The height of the peaks is unimportant. The 5' end of the sequence is at the left of the trace. 5' TTTGCTTTGTGAGCGGATAACAA 3' What is the sequence of the template DNA used for this sequencing reaction?

3' AAACGAAACACTCGCCTATTGTT 5'

d. show the full sequencer of the smallest DNA molecule that would be synthesized in the sequencing reaction and that would contain dideoxyG (ddG). indicate the 5' to 3' orientation of this molecule and the location of the ddG.

5′GCCTCGAATCGGGTACCTTTG* 3′ The asterisk indicates the dideoxy G, which must be at the 3′ end because the chain terminates when this dideoxy nucleotide has been incorporated.

you use the primer 5' GCCTCGAATCGGGTACC 3' to sequence part of the human DNA insert of a recombinant DNA molecule made with a plasmid vector. the result of the automated DNA sequence analysis is shown. (peak graph) a. write the sequence of all the nucleotides of human DNA that you can determine. indicate the 5' to 3' orientation of this sequence.

5′TTTGCTTTGTGAGCGGATAACAA 3′. Note that this is NOT the sequence of the primer, but instead the sequence of part of the human DNA insert.

the lacZ gene from E. coli encodes the enzyme B-galactosidase, which can catalyze the conversion of a colorless compound called X-gal into blue product. molecular biologists have taken advantage of this property by constructing plasmid vectors that contain the lacZ gene with an EcoRI site within it. after cutting this vector with the EcoRI enzyme, scientists ligate it together with EcoRI-digested human genomic DNA, transform the resultant molecules into E. coli, and plate these cells on petri plates containing ampicillin and X-gal. some of the colonies growing on this plate are white, others are blue. why?

If the vector resealed without any insert (these are sometimes called empty vectors), the resultant colonies growing on ampicillin plates supplemented with X-gal would be blue in color, because these cells would make the β-galactosidase enzyme, and this enzyme would turn the colorless X-gal into a blue compound. If the vector contained an insert, the resultant colonies growing on the same plate would be white, because no enzyme and thus no blue compound would be made. This property of the vector allows researchers to identify white colonies that have recombinant DNA molecules and to ignore blue colonies that have resealed vectors without inserts.

to make a genomic library useful for sequencing an entire genome, why would you ordinarily fragment the genomic DNA by mechanical shearing forces like sonication rather than by cutting the DNA with a restriction enzyme?

Mechanical shearing will fragment DNA at random locations, ensuring that overlap will be obtained if enough fragments are analyzed. Because the genomic DNA sample is obtained from many cells, the fragments from different cells will not have the same beginning and end points; thus, they will overlap.

why do longer DNA molecules move more slowly than shorter ones during electrophoresis?

The agarose gel through which the DNA is being electrophoresed has holes that are roughly the size of the DNA fragments to be analyzed. Smaller DNA fragments will find more holes through ewhich they can travel, so they will move faster than larger DNA fragments(their paths will be straighter), whose movements will be retarded when they bump into holes that are not large enough for them to go through(their paths will be more circuitous and thus longer).

A plasmid vector contains a single EcoRI site in the polylinker (multiple cloning site). An insert is flanked by two EcoRI sites, one at each end. You cut the vector and the DNA containing your insert with EcoRI and ligate the two. How many EcoRI site(s) are present in the recombinant DNA molecule and how many band(s) would you see when you run your EcoRI digest of the recombinant DNA on a gel? (There is no internal EcoRI site in the insert DNA.)

The recombinant DNA contains 2 EcoRI site(s), and there would be 2 band(s) when the recombinant DNA digested with EcoRI is run on a gel. cut circle vector 2 times leads to 2 sites. 2 sites = 2 bands

b. is the sequence you wrote in (a) part of the new DNA strand that was synthesized in the sequencing reaction or part of the template strand used in the sequencing reaction?

The sequence written in part (a) is of the strand that is being newly synthesized in the sequencing reaction.

suppose you only had a single restriction enzyme and you want to make a genomic library from which you could assemble the genomic sequence. how might you be able to achieve this goal? to make this library, would it be preferable to use a restriction enzyme that recognizes a 4-base, 6-base, or 8-base sequence of DNA?

You could perform a partial digestion with the single restriction enzyme. This will ensure overlap because different genomic DNA molecules will be cut at different sets of recognition sites. If the restriction enzyme recognizes sites that are relatively far apart in the genome (for example, a 6 bp recognition sequence will be found on average every 4 kb, but an 8 bp sequence will be found on average every 64 kb), any approach using a single enzyme will suffer because some fragments are too large to clone. It will be preferable to use an enzyme that recognizes a 4 bp sequence because the sites will be spaced closer together. The more potential locations of digestion, the more the fragments would resemble a library made by mechanical shearing with cuts made at random locations.If you adjust the partial digestion conditions properly, you could construct a library that would have inserts with an average size of any desired length.

what enzymes do you need to make a recombinant DNA molecule? what are the functions of those enzymes in the process?

a restriction enzyme to cut the vector and the genomic DNA so that the resultant pieces have compatible sticky ends; DNA ligase to stitch together the vector and insert.

(i) approximately how many fragments would result from digestion of the human genome (3x10^9 bases) with the enzyme? (ii) estimate the average size of the pieces of the human genome produced by digestion with the enzyme. (iii) state whether the fragments of human DNA produced by digestion with the given enzyme would have sticky ends with 5' overhang, sticky ends with a 3' overhang, or blunt ends. (iv) if the enzyme produces sticky ends, would all the overhangs on all the ends produced by that enzyme on all fragments of the human genome be identical or not?

a. Sau3A (^GATC) (i) Sau3A recognition sites are 4 basepairs (bp) long and are expected to occur randomly every 4^4 or 256 bp. The human genome contains about 3x10^9bp, one would expect 3× 10^9/256 = 1.2× 10^7~ 12,000,000 fragments. (ii) The enzyme would cut on average once every 4^4 or 256 base pairs, so this should be the size of the average piece of the human genome cut with this restriction enzyme. (iii) Ends produced by cleavage with this enzyme have sticky ends with a 5′overhang. (iv) All the ends of human DNA fragments produced by digestion with Sau3A would be identical (they are all 5′GATC overhangs). b. BamHI (G^GATCC) (i) The enzyme would cut random DNA once every 4^6 or 4,096 bp. 3× 10^9/4,096 = ~732,400 fragments. (ii) 4,096 base pairs= ~4.1 kilobase pairs (kb). (iii) Sticky ends with a 5′overhang. (iv) All ends are identical (they are all 5′GATC overhangs). d. SphI (GCATG^C) (i) 3× 10^9/4,096 = ~732,400 fragments. (ii) 4,096 base pairs. (iii) Sticky ends with a 3′overhang. (iv) All ends are identical (these are CATG 3′overhangs). e. NaeI(GCC^GGC) (i) 3× 10^9/4,096 = ~732,400 fragments. (ii) 4,096 base pairs. (iii) Blunt ends. (iv) All ends are identical.

consider partial restriction digestion, in which genomic DNA is exposed to a small, limiting amount of a restriction enzyme for a very short period of time. a. would the resultant fragments be longer or shorter or the same size as those produced by complete digestion? b. if you prepared genomic DNA from a tissue sample containing millions of cells, would the fragments produced by partial digestion of DNA from all of these cells be the same or different?

a. With partial restriction digestion, the enzyme does not cut the genomic DNA at every recognition site that is present in the genome. Thus, the partial digest would produce fewer fragments of longer average sizes than would be produced by digesting the same DNA sample to completion with the same enzyme. b. The fragments of DNA produced from the genomes of different cells by partial restriction digestion would be different from each other.

what is an issue encountered in molecular cloning (the construction of recombinant DNA molecules)?

after the vector is cut by a restriction enzyme, the two ends of the vector can come back together and be resealed by DNA ligase without any insert being incorporated at all. Such resealed vectors are undesirable since bacterial cells transformed with these DNAs would form colonies that could not be distinguished (except by time-consuming DNA sequencing) from colonies containing the recombinant DNA you were trying to make.

what is the purpose of the origin of replication in a plasmid vector?

allows the vector (and any recombinant DNA molecule that incorporates the vector) to replicate in a bacterial host cell independently of the bacterial chromosome. This property allows the plasmid to be transferred to daughter cells when the cells divide, and allows researchers to purify the plasmid away from the bacterial host′s chromosome.

what do template and primer do as the temperature is lowered?

anneal/hybridize

what are sticky ends?

have either 5' or 3' overhangs. digestion occurs offset the line of symmetry

why would the sequence of your genome much easier to assemble than the 1st human genome sequence?

if you have the complete genome sequence of any given species the order of fragments is assembled correctly so all other sequences belonging to the same species will be similar and easier to assemble/align

suppose that you wanted to make a genomic library to determine the complete sequence of a newly discovered organism's genome, but you did not have a sonicator readily available. explain how you could nonetheless use two or more restriction enzymes to make libraries whose clones could be sequenced so that a computer could assemble the genomic sequence.

in this case, overlap is obtained by making different libraries of the same genome, each library constructed with a different restriction enzyme (for example, one library made with the EcoRI enzyme and a second library with the BamHI enzyme). The recognition sites for different enzymes are at different positions in the genome to be analyzed, so that the fragments in any region obtained from the libraries will overlap. One problem with constructing a library by complete digestion of a genome with a given restriction enzyme is that by chance, some fragments may be too large to be cloned or analyzed, while others are so small. Thus, another advantage of using multiple libraries made with different restriction enzymes is to minimize the chance that a region will not be covered. For example, a too-long fragment with EcoRI sites at its ends may have internal sites for BamHI or some other enzyme.

why do we clone genes?

it is easier to characterize and manipulate cloned genes. to study genes or gene products. mass produce large quantities of protein. prepare to insert a gene into another organism.

kbp or kb

kilobase. 1,000 bases

overview of genome sequencing

large DNA molecule part of a single chromosome is fragmented so the pieces can be sequenced individually. the fragments are overlapping. but each fragment was too large to be completely sequenced by sanger method. fragments made of repeats could not be aligned correctly with other fragments

how will restriction enzymes with longer recognition sites cleave genomic DNA?

less frequently

bacterial plasmid (cloning vector) contains

origin of replication (allows each plasmid to replicate independently), antibiotic resistance gene, multiple cloning site (AKA polylinker, region of plasmid vector that carries many restriction sites that are recognized by restriction enzymes)

how can you generate overlapping DNA fragments of different sizes?

partial digestion with restriction enzyme: vary the fraction of sites cut. can adjust reaction time and enzyme concentration. mechanical shearing: sonication. push DNA through a syringe needle. can adjust the amount of mechanical stress.

sequenced DNA fragments must overlap so you can put the genome back together. how can you do this?

partial digestion: only a fraction of the restriction sites is cleaved, producing overlapping fragments

what kind of bond do restriction enzymes cleave?

phosphodiester bond

what purpose do selectable markers serve in vectors?

provide a means of determining which cells in the transformation mix take up the vector. These markers are often drug resistance genes, so a drug can be added to the media and only those cells that have received and maintained the vector will grow into colonies.

what can you do after screening for recombinant plasmid?

purify it after growing a single clone. you can grow them in liquid culture and isolate the millions of copies of your genes of interest

(instapoll) IacZ gene encodes B galactosidase enzyme which cleaves the colorless chemical X-gal into galactose and blue colored indigo compound X. X-gal is added to the medium along with ampicillin prior to plating bacterial cells. how does x-gal allow the screening of recombinants?

recombinants will be white because the lacZ gene is disrupted by cloning the gene of interest

what do restriction enzymes produce?

restriction fragments with either blunt or sticky ends

what is gel electrophoresis?

separates DNA fragments by size as they migrate through gel in an electric field. DNA is negatively charged so it moves down toward the positive end of the electrode. longer molecules move slower and are at negative side

what is fragment length determined by?

the chance incorporation of a dideoxynucleotide

what is the key point of genomic sequencing?

the fragments to be sequenced need to overlap; otherwise you would have no way of understanding their relationship to each other in the original genome.

what is the genome sequencing - the human genome project?

the goal was to determine the DNA sequence of an entire haploid human genome. 1990-2003. involved identification of the base pair sequence and annotation (marking important gene features). the first completed sequence is called RefSeq. costed $3 bil fragmenting, storing, sequencing, and assembling genome. capturing, storing, and analyzing vast amounts of data, genomes of thousands of species made available and routine genome sequencing made possible due to new, automated methods with advanced computational tools

the first signal detected in the chromatogram is the base adjacent to what?

the primer. subsequent signals tell us the order of bases in the DNA sequence 5' to 3' the smaller signals on the left, larger on the right

what is the newly sequenced DNA (5' TGGCAG 3') antiparallel and complementary to?

the template

during electrophoresis, what happens to a nested set of DNA fragments?

they are separated by size. the smaller ones migrate fastest and their colors are recorded

how are restriction enzymes palidromes?

they recognize sequences that are symmetrical and read the same on both strands.

why are many clones sequenced?

to give lots of overlap, allowing complete coverage of genome and confirmation of accuracy. it is impossible to obtain a perfect library that has every sequence represented once

what is the purpose of molecular cloning?

to isolate DNA corresponding to a small region of a complex genome. With cloning, scientists can purify enough of this small region of DNA to study in detail (for example, to determine the region's nucleotide sequence).

which kind of bacteria post transformation is able to grow on the agar plate with amp antibiotic?

transformants containing the cloning vector.

what is sanger sequencing?

use recombinant plasmid as template for DNA synthesis. denature the double stranded plasmid DNA by raising the temperature. the pol can use one of the strands as a template. lowering the temperature allows the primer to base pair with the complementary sequence on the template. along with the presence of nucleotides, the pol can elongate the primer to make the new DNA

overview of cloning genes in plasmids

uses a plasmid to carry an insert (gene of interest) of your choice to generate recombinant plasmids. you introduce the recombinant plasmid in vitro to a fresh culture of bacteria and let the host cell make many copies. you then purify the plasmids

what do you need to clone bacteria?

vector (plasmid), gene of interest, restriction enzyme (cut DNA), DNA ligase (glue)

what do you do after gel electrophoresis?

visualize DNA fragments by staining the gel with fluorescent dye (EtBr dye which intercalates into DNA) and photograph gel under UV light. determine the sizes of unknown fragments by comparing to the bands of DNA markers of known sizes

next generation sequencing at different levels of coverage detects sequence variation (substitution, insertion, deletion)

whole genome sequencing whole exome sequencing: identifies all kinds of variants in coding region (exons) targeted sequencing: sequences specific regions and identifies all kinds of variants in specific regions