Exam 4 r

Biolistic​

Biolistic method​ -Physical method of introducing D N A to cells​ -Particles of heavy metals (gold) are coated with the DNA that will transform the cells​ -These are introduced to cells in vitro using a gene gun​ -Plants with gene are selected for the desired phenotype​

What does the future hold?​ part 2

CRISPR mushroom​ -White button mushroom first gene edited crop using CRISPR-Cas9 to reduce browning approved for human consumption​ -Researchers at Penn State targeted polyphenol oxidase (PPO) -30% reduction in activity ​ -Longer shelf life and resists browning from ​ mechanical harvesting​ -Didn't use traditional methods, so doesn't need ​ USDA approval​

Golden Rice Controversy​

Controversy regarding Golden Rice​ -Clinical trials show that the beta-carotene in Golden Rice 2 was efficiently converted into vitamin A​ Golden Rice 2 is undergoing biosafety testing​ Critics of G M foods suggest that Golden Rice will make farmers too dependent one one type of food​ There are concerns about long-term health or environmental effects​

What are the methods used to create GM plants?​

Creating G M plants: Two approaches​ 1.) Biolistic method​ 2.) Agrobacterium tumefaciens-mediated transformation​ ​ Both methods target plant cells growing in vitro​ -Plant tissue is cultured that is grown in presence of nutrients or hormones​ -Cultured cells form clumps that will form roots​ -The rooted plant develops into a normal plant​

What about environmental effects?​

Critics of G M foods state that G M Os released into the environment have potential consequences​ Advocates argue that potential consequences can be identified and managed​ ​ 1.) Emerging herbicide resistance​ ​ 2.) Spread of G M crops into non-G M crops​ -Outcrossing (gene flow): The transfer of transgenes from G M crops or wild plants​ -Confers undesired phenotypes​

What does the future hold?​

Future of G M foods​ -New genome information will allow us to more accurately edit a plant's endogenous genes, decreasing, increasing, or eliminating expression to obtain desired phenotypes​ -New techniques can devise creative ways to protect plants from insects and disease​ Transgenic salmon is likely to receive marketing approval soon​ -The Aqua Advantage salmon grows twice as fast as a non-G M Atlantic salmon, reaching market size in half the time.​ -First GM animal approved for human consumption​ -Transformed Atlantic Salmon with another salmon's​ growth hormone downstream of antifreeze ​ promoter driving winter synthesis​ -Selling only fertilized female eggs that are sterile​ ​

Types of GM crops​

GM crops are grown in approximately 30 countries​ -90 percent are grown in the United States, Brazil, Argentina, Canada, and India​ -93 percent of soybeans​ -88 percent of corn​ -70 percent of processed foods in the United States contain GM crop ingredients​

Health & Safety​

GM food advocates state that there is no evidence of adverse health effects​ ​ Critics counter that most G M foods are consumed by livestock​ -The processing of foods removes D N A and proteins​ -Testing of food-derived ingredients is not sufficient​ ​ G M foods have been consumed for over 20 years​ -Toxicity testing in animals shows no negative effects​ -Short-term toxicity studies in animals are well established methods for detecting toxins​

Controversies​

GM food controversies​ -GM foods have increased farm productivity​ -Critics claim G M foods are unsafe​ -Every G M crop or organism has different expression sequences​ -Making general statements about all G M foods is not possible​ ​

Herbicides​

Herbicide-resistant G M crops​ -Weed infestations destroy 10 percent of crops worldwide​ -Herbicides that applied before seeding can be so efficient; they kill crop plants​ ​ Herbicide-tolerant G M crops are the most widely planted​ -70 percent of G M crops are herbicide-tolerant​ -Contain a bacterial gene that confers tolerance to the broad-spectrum herbicide glyphosate​ -Glyphosate: The active ingredient in Roundup​

Insects​

Insect-resistant G M crops​ -Insect resistance is the second most prevalent G M modification​ -Makes plants resistant to agricultural pests​ -Insect damage is a serious threat to food production​ ​ Bt crops​ -Bt (Bacillus thuringiensis) is a group of soil-dwelling bacterial strains​ -Produce Cry proteins, which are toxic to insects​ -Bt crops are engineered​ *cry genes are introduced into plant cells​ *The GM crop plant now can manufacture its own Bt Cry proteins, which kills the target pest when it eats the plant's tissue​

Golden Rice​

Most G M crops are made to increase yield​ ​ Golden Rice was engineered to combat vitamin A deficiency in developing countries​ ​ Golden Rice was genetically engineered to synthesize beta-carotene (precursor to vitamin A)​

Roundup-Ready Soybeans​

Roundup-ready soybeans​ -G M plant with resistance to the herbicide glyphosate, the main ingredient in Roundup​ -Utilizing Agrobacterium, an epsps gene was cloned into soybean plant to produce a glyphosate-resistant soybean plant​ -Biolistic technique introduced the plasmid​ -Farmers can spray Roundup on crops and kill only weeds, not their crop of soybeans​

Selectable Markers​

The rates of successful T-D N A integration (1 in 1000) and expression are low​ Selectable markers allow scientists to distinguish between transformed and non-transformed products (colonies, plants, tissues, etc.)​ Negative Selection​ -Marker gene: hygromycin-resistance​ Positive selection​ -One example involves the marker gene encoding P M I: Phosphomannose isomerase enzyme which catalyzes interconversion of mannose 6-phosphate and fructose 6-phosphate​ -Plant cells that express p m i gene survive​ -Can be positively selected by growing cells on mannose-containing medium​

Golden Rice 2 Generation​

Ti plasmid was used to create Golden Rice ​ -Plasmid contained several genes​ *crtl gene: Carotene desaturase cloned from bacteria​ *Psy gene: Phytoene synthase cloned from maize​ *Pmi gene: Phosphomannose isomerase cloned from E. coli​

Transgenic Organisms & Biotechnology​

Transgenic organisms​ -Genetic engineering allows genes to be cloned and transferred from one organism to another​ -When genes are transferred between unrelated species, a transgenic organism is created​ Cisgenic: Used to describe genes transferred within a species​ ​ Biotechnology​ -Wide range of methods that manipulate organisms or their components, such as isolating enzymes or producing wine, cheese, or yogurt​ -Genetically modified plants and animals are one aspect of biotechnology​

Agrobacterium-Mediated​

Utilizes bacteria Agrobacterium tumefaciens, a soil microbe that infects plant cells and causes tumors​ These characteristics are conferred by Ti plasmid​ ​ After Agrobacterium infection, the Ti plasmid integrates a segment of D N A (T-D N A) into plant genome​ Scientists remove T-D N A and replace with cloned D N A of genes desired​

Gene Editing​

Zinc-finger nucleases​ TALENs​ CRISPR​ ​ Speed​ Types of changes​ ​ ​ ​ Are they Genetically Modified? ​ (pic on phone)

What is the order of the three main steps in a PCR?

denaturation, annealing primers, elongation

SYNTHETIC GENOMES​

"what is the minimum number of genes necessary to support life?" ​ Synthetic genomes constructed in a lab to generate artificial cells or designer organisms​ Core genes- minimal genes required to support life​ Mycoplasma genitalium is a human parasitic pathogen & among the simplest self-replicating cells known ​ Initial bioinformatic analysis ~256 genes minimum​ Targeted mutation one gene at a time revealed 375/525 genes minimum​

Visualizing specific targets: In situ hybridization

*Other Molecular Techniques Can Be Used to Find Genes of Interest with a Cell​ ​ *FISH: fluorescence in situ hybridization -DNA probes used to determine the (a) chromosomal location and to (b) visualize a gene's expression while it is in a cell -FISH of a zebrafish embryo 48 hours after fertilization showing expression of a particular mRNA (atp2a1). The probe produces dark blue/purple staining. ​

ALLELE-SPECIFIC OLIGONUCLEOTIDE (ASO) TESTING​

1.) DNA is extracted​ 2.) Small region is amplified by PCR​ 3.) Small amount spotted onto strips of DNA-binding membrane​ 4.) Strip exposed ASO synthesized to match either normal or mutant sequence & has fluorescent marker attached​ 5.) Probe hybridizes with matching DNA on strips​ 6.) Analyzed to identify where fluorescent signal seen​ ​ AA= homozygous normal​ AS= heterozygous​ SS= homozygous mutant​ (A) probe only hybridizes to normal sequence​ (B) probe only hybridizes to mutant sequence​

Generate DNA profile- STR​ part 2

1.) Design primer sets​ A.) tagged by one of four fluorescent dyes (blue, green, yellow, red)​ B.) each set is designed to amplify specific DNA fragment​ 2.) Region amplified by primers will be different lengths depending on the number of repeats ​ 3.) Since STRs are smaller repeated units, have smaller size range per loci (D21S11 ranges from 200-260bp)​ 4.) Use the same fluorescent label for many different loci as long as sizes do not overlap​ 5.) After PCR large amounts of fluorescently labeled amplified products of different sizes & colors​ 6.) Sizes measured by capillary electrophoresis​ ​ ​

Generate DNA profile- VNTRs​

1.) Extract DNA from tissue sample​ 2.) Digest with a restriction enzyme that cleaves on either side of the VNTR region (black arrows) ​ 3.) Digested DNA run on agarose gel electrophoresis (smaller bands run faster to the bottom of the gel)​ 4.) The gel is then subjected to southern blot analysis using a probe that recognizes the VNTR region​ 5.) The probe hybridizes to the digested VNTR region & is visualized​ 6.) The pattern of bands is compared between samples​ The larger the number of VNTRs analyzed, the more likely the profile will be unique. Usually 5 or 6 loci are analyzed to create a profile. ​

Other types of selection​

1.) In addition to drug resistance, you can also use other screening methods and combinations of both.​ ​ 2.) The lacZ gene can be used to screen for bacteria containing recombinant plasmids.​ 3.) The intact lacZ gene will allow for production of an enzyme which will metabolize a substrate found in the growth media, turning it blue​ 4.) Within the lacZ, is the MCS used to clone in your ROI, if you are successful, the lacZ gene is disrupted and the colonies grow white​

Steps to clone rDNA ​

1.) Isolate DNA segment to be cloned​ ​ ​ 2.) Select a cloning vector ​ ​ ​ 3.) Join DNA fragments together​ ​ ​ 4.) Clone rDNA in host organism​

Knockout mice part 1

1.) Know the sequence of the gene & flanking regions that you want to disrupt. Use this to generate a rDNA called a targeting vector​ 2.) Targeting vector provides a new piece of DNA to be introduced by homologous recombination to embryonic stem cells (ES).​ -using the flanking regions as homologous regions​ -Target gene in targeting vector is mutated or disrupted. Disruption can be a drug resistance protein as positive selection or a fluorescence protein as a reporter. ​ 3.) Recombination will disrupt or replace the gene of interest and render it non-functional ​

Gel Electrophoresis​ part 2

1.) Load your samples into the well​ 2.) Apply electrical current​ 3.) Opposites attract, so DNA with a net negative charge moves towards positive​ 4.) Migration through pores within the gel will result in separation of DNA/RNA fragments by size​ 5.) Stain gel with dye which binds to all DNA & RNA in gel ​

Enzyme: Reverse Transcriptase

1.) RNA is reverse transcribed using RNA as a template to generate a strand of DNA​ 2.) DNA synthesis is stimulated by a primer: Oligo(dT) or random hexamers​ 3.) The original RNA strand is partially digested and a second complementary strand of DNA is synthesized​ 4.) This process of converting RNA to DNA is called reverse transcription and the DNA product is referred to as cDNA​ 5.) cDNA =DNA complementary to RNA​

A probe with the sequence 5'-A-T-G-C-C-A-G-T-3' will serve as a probe for which sequence? *notice DNA directionality*

3'-T-A-C-G-G-T-C-A-5'

Assume that a plasmid (circular) is 2800 base pairs in length and has restriction sites for EcoRI at the following locations: 400, 700, 1400, and 2600. Give the expected sizes of the restriction fragments following complete digestion with EcoRI. *Hint: draw a plasmid map (circle) like a clock from 0 to 2800, draw in the locations of the cuts. What is the distance between each cut?

300, 600, 700, 1200

Knockout mice part 2

4.) Targeting vector is introduced and cells are selected based off mutations & markers​ 5.) Selected cells introduced into a mouse blastocyst via microinjection​ 6.) Blastocyst transferred into pseudo-pregnant mother who will give birth to chimeras​ 7.) Chimeras are mice with some cells from the original blastocyst and some from the manipulated ES cells that were injected. Many times the cells and blastocyst will be generated from mice with different coat colors, so you can visually see the difference in where the cells arose.​ 8.) Chimeric mice are bred with wt mice and after generations can generate mice with mutation in all cells in one or both copies of the gene​ ​

Which of the following best describes a cloning vector?

A DNA molecule that accepts DNA fragments and replicates the fragment in a host

ddATP, ddTTP, ddCTP, and ddGTP are labeled with red, green, yellow, and blue fluorescent dyes, respectively. A five-base read from a sequencing reaction produced the following color sequence, read by the computer: red, yellow, yellow, green, green. What is the sequence of the template DNA?

ACCTT

Visualizing specific targets​ part 2

After running gel, will be placed into a "sandwich" with specialized paper which binds to your molecule. Apply current and move the molecules from inside the gel to the surface of the paper. Apply probe to paper, will hybridize with complementary sequence. ​ *Southern Blot: DNA​ *Northern Blot: RNA​ *To visualize protein, overall similar technique but uses an antibody to recognize antigen, or piece of protein​

Central Dogma of Biology​

Altering the DNA...​ ​ ​ ​ Resulting in new or altered RNA & protein​

Amplification: Polymerase Chain Reaction​ part 1

Amplify rare specific DNA sequences from a complex mixture when the ends of the sequence are known​ ​ Needs the following below:​ 1.) Template: DNA or cDNA containing ROI​ ​ 2.) Primers: Short pieces of complementary DNA that flank the ROI​ ​ 3.) Polymerase, nucleotides, & multiple heat source (thermal cycler)​

Gel Electrophoresis Visualization​

An agarose gel containing separated DNA fragments stained with a DNA-binding dye (ethidium bromide)​ Visualized under ultraviolet light. ​ Smaller fragments migrate faster and farther than do larger fragments, resulting in the distribution shown. ​ Molecular techniques involving agarose gel electrophoresis are routinely used in a wide range of applications.​

Generate DNA profile- STR​ part 4

An electropherogram showing the results of a DNA profile analysis using a 24-locus STR profile kit​ Homozygous- single larger peak​ Heterozygous- double peaks​ ​ Sizes of each peak indicated by the axis shown​ ​

AGRICULTURE & GMOS​

Before genetic engineering, farmers were manipulating the genetic makeup of plants and animals through selective breeding​ Selective breeding is the breeding of natural or mutagen induced mutations to produce a desired result​ -Demonstrated by the 4X increase in corn yields over 60 years, 50% of increase due to selective breeding​ -Dog breeds as a result of certain job needs​ Improvements in DNA technology has accelerated GMO production​ Agricultural biotechnology works to produce plants with insect resistance, herbicide resistance, or added nutritional characteristics​ -Corn, soybeans, cotton, canola, alfalfa, rice, potatoes, tomatoes, tobacco, wheat, and cranberries​

CRISPR-Cas9​

CRISPR: clustered regularly interspaced short palindromic repeats​ Cas: CRISPR associated genes, endonuclease enzyme which cuts DNA​ Based on a bacterial primitive immune system to destroy foreign virus or plasmid DNA. In this system, the bacteria generates the short sequences from invading pathogens. It can then use these sequences to target the pathogen in the future. ​ Similar to RNAi, short guide RNAs are used to target nucleases to cleave specific DNA sequences (rather than cleave RNA as with RNAi). ​

VACCINE PRODUCTION​ part 2

Can plants be a good expression hosts? ​ Easy to make transgenics and easy to grow​ No FDA approved drugs yet​ Some promising Ebola virus antibodies produced in tobacco leaves are in ongoing clinical trials​ Mice were used to create monoclonal antibodies against the virus, the gene used to produce that antibody was introduced into the plant​ Huge barrier to vaccine effectiveness is the ability to transport and store the vaccine in any condition- refrigeration & sterilization facilities are not always available​ In response, scientists are trying to produce vaccines that can be synthesized in edible food plants​. -Vaccine against cholera in potatoes​ -Bananas & hepatitis b vaccine​ Can be hard to control dose (how big is the banana, how many leaves?)and will is pass through digestion unharmed? ​

Generate DNA profile- STR​ part 3

Capillary electrophoresis- thin glass tube filled with gel material, sample loaded on top and electric current passed through samples migrate through just like regular gel electrophoresis​ ​ As samples pass through the capillary gel, the samples pass by a laser which can detect the fragments​ ​ Samples measured are analyzed by software which calculates the size & quantities of each fragment​ Represented as peaks on a graph​ Systems can analyze dozens of samples at a time and analysis takes less than an hour​

ETHICS & SOCIETY​ part 2

Case: a prenatal ultrasound revelated a potentially debilitating problem involving the spinal cord of the developing fetus, called Noonan syndrome. DNA test came back positive for a gene variant linked with Noonan syndrome. Parents chose to terminate the pregnancy. ​ ​ Later: The locus linked to noonan was not involved in the disease, but there was no effective way to inform the research and commercial genetic testing community. ​ ​ Result: NIH National Center for Biotechnology Information (NCBI) developed ClinVar which integrates data from clinical genetic testing labs and research literature to provide an updated resource ​

Enzyme: DNA Ligase​

Catalyzes the formation of phosphodiester bond between 5' phosphate and 3' hydroxyl terminal groups​

Conditional KO

Conditional KO: control of when and where a KO will be in the mouse​ -Time in development​ -cell type specific​ -chemical cues​ Used often when a KO is lethal or disabling​ Common system: Cre-lox​ -Insert sequences, called loxP sites, into the targeting vector on either side of regions in the gene of interest​ -Mouse generated as before, but now mouse must be bred with mouse carrying a Cre gene, which encodes cre recombinase which can cut and recombine DNA at loxP sites​ -Recombination will result in the portion of DNA between the loxP sites being cut out, disrupting the gene​ -The key? The promoter driving the production of the Cre gene. Tissue specific promoters, stages of development specific promoters, and chemical driven promoters can be used to induce deletion in particular circumstances​

Sequencing DNA​

DNA Sequences Can Be Determined and Analyzed​ DNA sequencing technique examples: ​ -Dideoxy sequencing aka Sanger sequencing ​ -Next-generation sequencing technologies​ -Third generation sequencing​ Applications can include: ​ -DNA fingerprinting​ *Identifying people who died in the collapse of the World Trade Center​ *Establishing paternity​ -Identification of disease-causing mutations​

MICROARRAYS​ part 2

DNA microarrays have been generated which detect mutations in p53, BRCA1, and SNPs​ Microarrays can be used for: ​ -Gene Scanning- analyze a person's DNA for hundreds of disease alleles ​ -Gene-Expression Profiling- detect gene-expression patterns for specific genes, can use this to compare healthy vs cancerous tissues from a single patient and/or between many patients​ -Example: normal cells vs cancer cells arising from same cell type​ -Resulting 'heat map' with different fluorescent at each spot/probe indicates the relative RNA expression of many genes​ -Present only in normal cells= green signal​ -Present only in cancer cells= red signal ​ -Present in both samples equally = yellow signal​ -Present in both in varying amounts = range in between​ *REMEMBER that levels of mRNA does not always equal protein levels, just steady-state levels of transcribed mRNAs​

DNA Phenotyping​

DNA phenotyping- using DNA sequence information to reveal a person's physical features and ancestral origins ​ New & VERY controversial​ ​ ​ ​ ​ ​ Services now generate 3D facial structures & compile full color photographic representation of a person's face from DNA sample​ Not validated to be used in court , but used in unknown missing persons identification & cold cases​ Concerns? Privacy violations, racial profiling, accuracy, validation​ ​

Technical & Ethical Issues​

DNA profiling is sensitive, accurate, & powerful, but has limitations​ -No DNA evidence or DNA evidence wouldn't help case (I find this a weird limitation)​ -DNA evidence is waiting to be processed, takes time & money​ -HUMAN ERROR, switched samples, contamination​ -Evidence which is mixtures of profiles from people directly present, but also indirectly (transfer of hair or saliva)​ -Degraded DNA yields partial DNA profiles which are difficult to interpret​ -Deliberate tampering​ *Introduce someone else's DNA​ *Fragments of a synthetic genome mixed with body fluids​ Who should have their DNA profile stored? Should police be able to collect DNA samples without a suspect's knowledge or consent? ​ Searches yielding partial matches may indicate a family member was involved, familial DNA testing. Is this scientifically valid or ethical? ​ Should DNA phenotyping be used to convict a suspect?​ Should public genealogy databases be used for criminal investigations? ​

VACCINE PRODUCTION​ part 3

DNA vaccines- recombinant DNA encoding proteins injected into an individual or delivered by virus​ Zika Virus (ZIKV) outbreak in 2015 which resulted in congenital birth defects prompted swift vaccine development & production​ Early trials with DNA-based vaccine worked well in mice & rhesus macaques to produce neutralizing antibodies against zika​ Clinical trials in humans have begun, effectiveness yet to be determined ​ Similar Trials with HIV vaccines which highlight a major limitation: low production of recombinant protein resulting in low immune response​

ETHICS & SOCIETY​ part 4

Direct to Consumer Genetic Testing (DTC)​ Mail in saliva, hair, or cheek swab sample ​ SNP sequencing will screen for different mutations which might increase the risk of disease​ Why controversial? ​ -Purchased online by individual without a health-care provider to administer or interpret the results​ -Questions about quality, effectiveness, and accuracy because DTC is self-regulated, no FDA regulation​ -No way to compare & evaluate available tests​ ​ Could they give a false sense of security with a negative test? ​ ​ Some DTC genetic tests do fall under FDA regulation, like 23andMe because they offer health-related analyses ​

Amplification: Polymerase Chain Reaction part 2

During amplification researchers can introduce mutations​: 1.) Aid in cloning process (add in restriction sites)​ 2.) Disease causing mutations​ 3.) Mutations to alter protein activity​

Engineered Nucleases​

Engineered nucleases: enzymes made to cut in unique sequences in the genome. Cuts by EN lead to dsDNA breaks and repair, like NHEJ. Here you are hoping for error prone repair which will generate a deletion in your gene of interest.​ Transcription activator-like effector nucleases (TALENs) & zinc-finger nucleases: the sequence the enzyme cuts is determined by the amino acid sequence of the nuclease. This can be costly as every new cut you need to make required purchase of a new enzyme​ CRISPR-Cas genome editing​ -The technology provides a powerful means of cutting and editing the genome. ​ -Combines a single guide RNA with a nuclease, which together attach to specific DNA sequences and make double-stranded cuts at specific locations. ​ -Repair of these cuts by nonhomologous end joining or homology-directed repair provides the means to introduce alterations to the genome. ​ -Used in many organisms and cell types, and it has the potential for additional applications, but its use has raised a number of ethical concerns.​

Interpreting DNA Profiles ​ part 2

Example of how to get a profile probability​ 1st locus, D5S818, 2 alleles = 11 & 13​ -11 allele frequency of 0.361 in population ​ -13 allele frequency of 0.141 in population​ -Frequency of two different alleles at a locus = p & q, so probability of having one from each parent is pq, since there are two possibilities this is calculated at 2pq​ -Probability of inheriting the same allele = p*p = p2​

STRs are repeated elements in the genome. They have ________ nucleotides per repeat compared to VNTRs.

FEWER

MICROARRAYS​

For screening of many genes at once, a high throughput method is preferred ​ Examples:​ - Cystic Fibrosis​ *CFTR gene contains 27 exons and is 250 kilobases of genomic DNA​ *~1000 known mutation distributed through the CTFR gene, including point mutations, insertions, and deletions​ -Mutations in p53​ *Over 500 different mutations known to occur​ *Associated with/predispose a patient to many different types of cancers​ DNA microarrays​ -Spot single stranded DNA molecules (probes) onto a glass slide ​ -Labeled DNA or cDNA allowed to hybridize and can be visualized​

Forensic Science

Forensic Science- or forensics uses technological and scientific approaches to answer questions about the facts of a criminal or civil case. ​ Older methods: blood typing, fingerprint analysis, (many more which are no longer in use)​ First use of DNA profiling in 1986​ ​ DNA forensics is also called forensic DNA fingerprinting or DNA typing​ Used to identify sources of biological materials, like​ -saliva, pet hairs, or blood spots​ -Even samples degraded by fire or time ​ Compare samples to large databases to match profiles (DNA profiling)​ -Evidence of guilt or innocence​ -Identify victims of mass disasters​ -Identify endangers species & illegally trafficked animals​ ​ ​

Benefits of GMOs​

G M foods address malnutrition​ ​ More than 200 different G M foods have been created​ ​ Golden Rice: A variety of rice that contains the vitamin A precursor​ -Developed on a humanitarian nonprofit basis​ -Purpose: To alleviate vitamin A deficiencies in developing world​ -Protestors argue that Golden Rice is a threat to human health and biodiversity​ ​

GENOME WIDE ASSOCIATION STUDIES (GWAS)​

GWAS allows for the analysis of populations as opposed to individual sample comparison​ Enables scientists to identify multiple genes that may influence disease risk​ -Autism, Obesity, Diabetes, Arthritis, Cancers, Autoimmune diseases​ -Intelligence & other behavioral traits​ Takes large populations of sequencing ​ -From affected individuals and compares to ​ -Genomes of individuals without the disease​ Goal: identify genetic variations that may ​ -confer risk of developing the disease​ Typical representation as scatterplot​ X-axis: position within genome​ Y-axis: genotypic association ​ -Higher on chart = higher association with ​ Type 2 diabetes​

Gel Electrophoresis​ part 1

Gel electrophoresis resolves DNA fragments, RNA or protein fragments of different size​ Agarose Gel electrophoresis can be used to separate DNA molecules on the basis of their size and electrical charge.​

MICROARRAY VS SEQUENCING​

Gene-expression Microarray of host-response to pathogen ​ How do the mice's immune system react similarly and differently to different types of pathogens? ​ ​ ​ Microarrays are limited to the number and types of probes on a slide​ Sequencing of mRNAs (as cDNAs) gives researchers the whole picture​ Transcriptome- sum total of all mRNAs molecules expressed from genes of an organism. Gives sequence and relative amounts of each RNA. ​

MICROARRAY​

Gene-expression microarray results analyzing 18,000 genes expressed in two types of DLBCL Lymphoblastomas​ Very different expression patterns between the two groups of samples​ Patent's with Activated B-like patterns had much lower survival rate than patient's with GC B-like patterns. ​ Helps to distinguish different subtypes of diseases​ Profiling analysis in clinical use can direct therapies which help patients in that group better​

Generate DNA profile- STR​ part 5

Generated profile compared to other profiles (right)​ STR profile genotype is designated by the number of repeats of STR (table below)​ Statistics & probability used to interpret profiles & make comparisons​ Rape case: Samples taken from suspect, victim, and two fractions from vaginal swab of victim ​ Result: Victim profile matches EC fraction from vaginal swab as expected. Suspect's profile matches sperm fraction. ​

APPLICATIONS OF GENETIC ENGINEERING AND BIOTECHNOLOGY​

Genetic Engineering is the alteration of an organism's genome usually using rDNA​ Manipulating DNA in vitro and then introducing that DNA into living cells has allowed scientists to generate new plants, animals, and other organisms with specific traits ​ These organism are called genetically modified organisms (GMOs)​ Biotechnology uses living organisms to create products or processes that help to improve life​ - using microbes to make important products (wine, bread, beer)​ -Biopharmaceutical products​ -Agriculture​ -Engineered Animals​ -Genetic Testing​ -Genome Analysis​ -Synthetic Genomes​

Recombinant DNA (rDNA)​

Genetic material from multiple sources are joined together to create unique sequences not otherwise found in the host genome. ​ This is done by molecular cloning

What are Genetically Modified Foods?​

Genetically modified organisms (GMOs): Plants and animals of agricultural importance whose genomes have been altered​ ​ Genetically modified foods: Type of genetically modified organism- plants and animals of agricultural importance​ ​ Modified via genetic engineering or recombinant D N A technologies​ ​

APPROACHES TO GENETIC TESTING​ part 2

Human Genome Project led to the sequencing and identification of many genes & disease-causing mutations​ Now that the sequence is known, PCR & probes/synthetic oligonucleotides can be used to detect mutations ​ Allele-specific oligonucleotides (ASOs)- synthetic DNA probes used to detect point mutations​ Point mutations are single-nucleotide polymorphisms (SNPs)​ SNPs are found all throughout the genome and are just variations in DNA sequences from person to person​ -Coding, non-coding, intergenic, all over​ -Disease causing​ *Effect any of the steps in central dogma​ -Indicate Disease susceptibility​ -Associations​ -haplotypes​

ETHICS & SOCIETY​

Human Genome Project- how would the genome information be used and how can individuals and society be protected​ Ethical, Legal, and Social Implications (ELSI) Program was established by the NIH, focus: ​ -Privacy and fairness in use and interpretation of genetic information​ -Transfer of genetic knowledge from the research lab to clinical practice​ -Ways to ensue that participants in genetic research know and understand potential risks and benefits ​ -Enhancement of public and professional education​ Most of the widely applied genetics tests are used to improve quality of life, like with newborn screening for PKU​ What about when the consequences are not clear? ​ -No effective treatments​ -negative doesn't mean never and positive isn't for sure​ -What information do you need to feel informed before testing? ​ -Sequencing of fetal genomes reveals all sequences and mutations, how might people use this information? ​ -Issues of consent & HIPAA​ -Define & prevent genetic discrimination ​

Mitochondrial DNA profiling is useful in developing DNA profiles from samples that are in less than ideal condition. What is a major limitation of using mitochondrial DNA profiling?

It is not possible to differentiate between maternal relatives.

Transgenic Animals​

Knock-in mice: express or overexpress a particular gene of interest. ​ Transgene, could be a gene already found in a mouse or a new gene like GFP (seen below).​ Mechanism similar to KO, but instead of disrupting a gene, you are introducing something new. Specific promoters can also be used to drive gene expression resulting in control over expression like seen in conditional KO mice. Gene can be incorporated ANYwhere in the genome. ​

TRANSGENIC ANIMALS​ part 2

Less virtuous uses of this technology: GloFish, transgenic zebrafish which fluoresce various colors under UV light​ Abuse, just to look pretty?​ What about if the fluorescence was driven by a promoter only activated by heavy metals? ​ Could be used as sentinels for contaminated water- bioassay​ ​

Visualizing specific targets​ part 1

Locating DNA Fragments with Probes​ Probe: DNA or RNA with a base sequence complementary to a sequence in the gene of interest​ -Labeled probes are complementary to the sequence of interest and can be used to locate individual genes or sequences among DNA fragments separated by electrophoresis.​ -Probes will have a visualization molecule covalently attached​ *Radioactive label​ *Fluorescent label​ *Enzyme label which can generate a light or color signal​

AGRICULTURE & GMOS​ PART 2

Main reasons for generating transgenic crops: ​ -Improve growth characteristics and yield​ -Increase nutritional value​ -Provide resistance against herbicides, pests, viruses, and drought​ Other examples: ​ -Crops produced to be used for ethanol production for making biodiesel fuel​ -Golden rice- a variety of rice which produces beta-carotene, a precursor of vitamin A. This fortified food is to be grown and consumed in areas with a shortage of dietary vitamin A. This deficiency kills around 700,000 children a year and another 500,000 cases of irreversible childhood blindness. ​

DNA Profile Databases​

Many countries maintain a national DNA database​ UK contains >6 million profiles​ US state & federal -> CODIS Combined DNA Index System maintained by the FBI​ -Contains both a database of the profiles & the tools to analyze the data​ - >16 million DNA profiles​ -Convicted offender database & forensic database ​ - >350,000 profile matches have assisted in criminal investigations & missing persons searches​ Concerns over privacy & civil liberties of individuals vs the needs of the state​ ​ Example in text: In two cases men were convicted and on death row based on "bite mark" evidence. The specialist who testified was discredited, but this evidence was continued to be used. With advancements in technology which allowed older & degraded samples to be sequences generated DNA profiles which exonerated the two men after serving many years. The real perpetrator was found by his DNA profile.​

Methods of getting and cloning RNA

Methods:​ ​ 1.) Transformation- uptake of exogenous DNA from environment by a bacterial cell (cells must be "competent")​ ​ 2.) Transfection- forced introduction of small molecule into eukaryotic cells​ -Chemical​ -Lipid-based​ -electroporation​ ​ 3.) Transduction- introduction of exogenous genetic material into cells by a virus​

Mitochondrial DNA (mtDNA) Profiling​

Mitochondrial DNA (mtDNA) analysis​ -200-1700 mt/cell​ -mtDNA= 16kb circular DNA chromosome, one or more per mt​ mtDNA passed from egg to zygote, but sperm contributes little to no mtDNA​ mtDNA is inherited only from the mother & undergoes little to no recombination​ ​ mtDNA is highly present in samples, making it useful in degraded samples​ ​ Like Y-chromosome profiling, mtDNA profiling can be useful in identifying familial relationships where samples from relatives are available. ​ Also like Y-chromosome profiling, mtDNA profiles can be shared by two individuals without direct relationships, but a shared ancestor-maternal ancestor​ Used most often in genealogy, evolutionary studies, & human population migrations​ ​

Vector: allows amplification of DNA fragment (ROI)

Modified versions of viruses or plasmids​ Relatively small​ Replicate in suitable host to produce large quantities of rDNA (self-replicating)​ Easy to purify away from host cell DNA​ Common Features: ​ 1.) Cloning host origin of replication​ ​ 2.) Drug resistance marker (selection)​ -Cloning host​ -Final host​ ​ 3.) Multi-cloning site or unique restriction enzyme sites​ ​ 4.) Expression plasmids: inserted DNA downstream of promoter active in final host​

RECOMBINANT PROTEIN PRODUCTION​

Molecular cloning and the production of rDNA​ Recombinant Insulin first produced​ Insulin- protein hormone which regulates glucose metabolism​ Natural preproinsulin is processed after translation resulting in mature insulin molecule composed of A & B chains disulfide linked​ Recombinant DNA containing A and B generated fused to B-gal​ Fusion proteins purified & the Chain cleaved from B-gal by cyanogen bromide​ A & B mixed together to generate mature, active insulin molecule​

TRANSGENIC ANIMALS​

Most transgenic animals produced to study gene function​ Second most common use is for production of biopharmaceuticals​ Additional efforts are being made to protect farm animals against pathogens​ Mastitis in cows​: -Mastitis- infection of mammary glands which block milk ducts reducing milk output and contaminates milk with pathogenic microbes. ​ -Current therapies unsuccessful in treating the infection​ -Transgenic cows generated which produced an enzyme which can cleave the cell wall of most common bacterial pathogen​ -Enzyme is NOT effective against other pathogens & pathogen may develop resistance​ Transgenic cow producing hypoallergenic milk​ Transgenic salmon producing a growth hormone​

SYNTHETIC GENOMES​ part 2

Mycoplasma mycoides genome was chemically synthesized in 1078 1080-bp oligonucleotide pieces​ Pieces were clones and assembled into the entire genome through a homologous recombination technique ​ This synthetic genome was then placed into a recipient cell of a close relative mycoplasma capricolum, genome transplantation​ This transplantation of a full synthetic genome shifted the phenotype of the recipient cells including expression of b-gal​ Further studies identified that in this genome 473 genes were essential and about 1/3 of those genes have no known function​

PRENATAL GENETIC TESTING​

Newborn Screening- ~60 conditions required to be tested immediately after birth​ Prenatal genetic tests- testing before birth to detect disorders which may need earlier intervention​ -Amniocentesis ​ -Small volume of amniotic flued removed​ *Contains fetal cells used for testing​ Karyotypes​ Genetic tests​ Other procedures​ Chorionic villus sampling (CVS)​ Cells from fetal portion of placental wall​ Non-invasive tests​ -Circulating DNA from dead cells isolated​ -Cell-free DNA(cfDNA)​ -Pregnant mother has her DNA and Baby's​

DNA Profiling​

Not just for forensic investigations​ Also used for:​ -Paternity​ -Family relationship testing​ -Identification of plant material​ -Evolutionary studies​

Final Host/Applications​

Now that you have many copies of your ROI/gene as DNA, you can now use in your application . Final host: 1.) Study activity of genetic product (miRNA, lncRNA, protein, ....)​ 2.) Introduce advantageous gene into new system (resistance, alternative nutrient metabolism, ....)​ 3.) Generate large amount of protein for isolation (insulin, enzymatic reactions, ...)​ Sequencing: 1.) Identify Genetic Mutations​ 2.) Forensics​ 3.) Genealogy​

Detecting levels of DNA​ part 1

Once you generate cDNA, you can run a PCR to amplify your gene of interest. After amplification, the amount of sample seen can help to tell you relative expression of your gene of interest within different samples. *PCR & agarose gel: only semi-quantitative. Can determine overall levels, and presence or absence of a molecule, but cannot detect smaller differences well. ​ *Quantitative real-time PCR (qPCR): quantitatively determines the amount of DNA amplified as the reaction proceeds​ -Reaction overall the same as semi-quantitative PCR, but​ -To measure the relative DNA concentration a dye or probe that binds to the DNA is used.​ -As the product increases the fluorescent signal increases as well.​ -The signal relates to the starting levels of the gene product, so more starting mRNA = faster increase in the fluorescence signal.​

The development of which biotechnology revolutionized the field of DNA forensics by allowing analysis of small or degraded samples?

PCR

Enzyme: Restriction Endonuclease part 2

Palindrome​ ​ Enzyme dimer cut each DNA strand in the same location relative to restriction site​ ​ Two outcomes from cleavage: ​ ​ Flush/Blunt end- no complementary end for base pairing​ ​ 5' or 3' Overhang- nucleotides overhang for complementary base pairing "sticky"​ ​

GENETIC ANALYSIS ​

Personal Genomics- sequencing of individuals is more approachable as costs plummet​ Whole Genome sequencing (WGS) is being used in medical clinics at an accelerating rate​ -Providing insights into complex disorders like anorexia, Alzheimer's disease, and autism​ -WGS of individuals affected by Autism Spectrum Disorder (ASD) has revealed involvement of over 100 genes​ -Alternative Whole Exome Sequencing (WES)- sequencing only the exomes to focus only on protein-coding segments of the genome, much less expensive​ NIH's Undiagnosed Diseases Network it using WGS & WES to help diagnose rare and mysterious disease conditions with an unknown genetic basis ​ ​ Single Cell sequencing (SCS)- involves isolating DNA from a single cell which is then subjected to Whole Genome Amplification (WGA) by PCR and then sequenced. ​ -Germ-line cells & in vitro fertilization​ -Trace changes in cancer cells​ -Immune cells ​

ALLELE-SPECIFIC OLIGONUCLEOTIDE (ASO) TESTING​ part 2

Pre-Implantation Diagnosis- genetic analysis of single cells from embryos created by in-vitro fertilization (IVF)​ 1.) Sperm & Egg cells mixed to create zygotes​ 2.) Early stage embryos grown in culture​ 3.) Single cell removed from embryo using vacuum pipette​ 4.) Analysis​ 1.) FISH​ 2.) ASO testing​ 5.)Decide which embryos to be implanted (no mutations, sex)​ *cannot detect epigenetic changes which may still lead to issues with fertility​ ​ ​

Manipulating the Genome​

Previously discussed adding in exogenous rDNA to express DNA outside of & in addition to the genome You can also alter the genome to study genes: ​ -Knock-Out (KO): disrupt or delete part of a gene leading to a loss-of-function mutation​ -Conditional KO: can induce the KO, but only in certain circumstances​ -Transgenic or Knock-In (KI): alter gene sequence to change the gene, like we did with rDNA, BUT this is inside the gDNA, so will be a permanent change in the cell's DNA​ -New technologies to accomplish this include designed nucleases and CRISPR ​

Enzyme: Restriction Endonuclease part 1

Produced by bacteria to limit bacteriophage (viral) infection​ ​ Recognize particular DNA sequences "restriction sites" and cleave DNA at or near these sites​ ​ Type II most commonly used, cut at recognition site in predictable patterns​ ​ Restriction site is often a palindrome, reads the same both forward and backward​ (R-A-C-E-C-A-R​)

RNA SEQUENCING​

RNA sequencing (RNA-seq) allows for whole transcriptome analysis ​ Single-cell RNA-sequencing (scRNA-seq)​ scRNA-seq of innate lymphoid cells (ILCs) ​ -ILCs can differentiate into a variety of different cell types​ -Dot plot groups ILCs into clusters which share similar gene-expression patterns​ -Heat map of RNA expression levels for a subset of genes, samples broken into clusters as shown above​ -Bottom row is expression of beta-actin a component of the cytoskeleton which should be in all cells​

APPROACHES TO GENETIC TESTING​

Restriction fragment length polymorphism (RFLP) analysis- sickle cell anemia​ Sickle-cell Anemia is caused by a single nucleotide substitution in the β-globin gene​ -Mutation in sequence eliminates a restriction site (for Restriction endonuclease) present normally​ -When DNA is exposed to the specific restriction enzymes, different cleavage patterns will result (normal vs mutant, heterozygous vs homozygous)​ Limitation? Relies on presence and absence of RE site​

Dideoxy Sequencing​

Sanger's dideoxy sequencing method​ The dideoxy sequencing reaction requires a special substrate for DNA synthesis.​ Dideoxyribonucleoside triphosphate (ddNTP) lacks a 3′-OH group, which terminates DNA synthesis​ 4 different reactions are made. Each reaction has all 4 regular nucleotides (dNTPs) plus a small amount of one ddNTP​ This will result in chain termination at each occurrence of that base a small percentage of the time. ​ Generated sequences from each tube run on an agarose gel and analyzed.​

Single-Nucleotide Polymorphism (SNP) Profiling​

Single-Nucleotide Polymorphisms (SNPs)​ -Single nucleotide changes between two DNA molecules​ -Bp change, insertion, or deletion​ SNPs occur randomly throughout genome ​ -approx. every 500-1000 nucleotides​ -Generating many different potential loci for profiling​ SNPs usually only have 2 alleles, 50+ loci used for profiling​ Like other profiling methods, primers for specific regions used and sequencing or probe hybridization used to identify differences​ SNPs only need "one nucleotide" (plus primer lengths) vs STR which needs a much longer stretch making it better for degraded samples​ SNP profiling not used commonly for forensic applications (but is common for genealogy/"DNA health" websites like 23andMe), but SNP profiling of mtDNA and Y-chromosome more common in genealogy. ​ ​

The following are four processes common to most cloning experiments:

THESE ARE IN ORDER: (_3_) transforming bacteria (_4_) plating bacteria on selective medium (_2_) ligating DNA fragments (_1_) cutting DNA with restriction endonucleases

GENETIC TESTING ​

Technology to sequence DNA and clone genes has major implications on diagnosis & treatment of disease​ Human Genome Project & Advances in genomics accelerated phenotype & disease-causing gene identification​ Genetic Testing ​ -Mostly sequence patient genome to detect gene alterations in single-gene disorders: sickle-cell anemia, cystic fibrosis, Huntington disease, hemophilia, muscular dystrophy​ -Advancements have led to development of tests for complex disorders like breast and colon cancer​ Gene tests used for prenatal, childhood, and adult ​ -Prognosis- likelihood of developing disorder or predicted course of disease (severity)​ -Diagnosis- identification of genetic cause of disease or condition ​ Genetic counselors​

If one wishes to clone a gene using typical restriction endonucleases, how does the restriction endonuclease identify the appropriate cut sites in the genome?

The endonuclease identifies its specific recognition sequence.

Getting rDNA in host organism​

To clone and "use" rDNA molecule, you need to introduce the rDNA into multiple hosts

Detecting levels of DNA​ part 2

Two basic options to get fluorescence signal: ​ ​ Taq-probe: probe with complementarity to your specific target with both a fluorophore and quenching molecule attached​ Non-specific dsDNA dye can also be used to detect PCR products (SYBR green)​

Generate DNA profile- STR​

Using PCR-amplified samples allows scientists to generate DNA profiles from trace (very small) samples and samples that are old or degraded​ STRs- short tandem repeats, or microsatellites, are more often used today for DNA profiling​ -Repeated motif shorter than VNTRs, 2-9 bp​ -Repeated 7 - 40 times​ -Example: D8S1179 is 4 bases TCTA repeated 7-20 times = 19 possible alleles ​ -Hundred of STR loci in genome, 20 STR loci used as core set for forensic analysis (Europe uses a 12 core set)​ -Commercial kits available, but more follow a similar method​ ​

VNTR-Based DNA Fingerprinting​

VNTR- variable number of tandem repeats, or minisatellites (chapter 12)​ -DNA loci located in non-coding regions of gDNA​ -Made of DNA sequence units between 15 -100 base pairs (bp), each unit repeated a number of times​ -Each VNTR from 1 to 20 kilobases (kb) in length​ Number of repeats at different VNTR locus varies from person to person ​ Example composed of 3 tandem repeats of a 16-nucleotide sequence​: 5'GACTGCCTGCTAAGATGACTGCCTGCTAAGATGACTGCCTGCTAAGAT 3'​ ​ Over 30 different possible alleles (repeat length) at any VNTR loci = large # genotypes​ If we examined 4 different VNTR loci within a whole population, each loci has 20 possible alleles​ There would be 420 = more than 2 billion possible genotypes, and that is only using 4 loci!​

VACCINE PRODUCTION​ part 1

Vaccines are used to stimulate the immune system to produce antibodies against disease-causing organisms to confer resistance​ Types of Vaccines (traditionally): ​ -Inactivated vaccines- prepared from killed samples of the infectious virus or bacteria​ -Attenuated vaccines- contains live viruses or bacteria that no longer reproduce but cause a mild form of the disease​ New type: Subunit vaccines- consists of one or more surface proteins from the virus or bacteria instead of whole pathogen​ -Hepatitis B vaccine components produced in yeast ​ -Human Papillomavirus vaccine (Gardasil) protects against 4 strains of HPV which cause ~70% of cervical cancers ​ ​

ETHICS & SOCIETY​part 3

What about 'incidentals'? You have your whole genome sequenced to look for something particular, but what about the rest of the information? ​ What if the analysis revealed other mutations that might be significant to the patient? Should it be disclosed to the patient? ​ Is this more information that someone wants or needs? ​ ​ What about preimplantation diagnosis, where you screen embryos created by IVF​ Will other non-disease related gene be screened for? Select other physical and mental characteristics​ ​ Genetic Information Nondiscrimination Act (GINA)- designed to prohibit the improper use of genetic information in health insurance and employment (but not health insurance!!)​

Interpreting DNA Profiles ​

What happens after the DNA profile is generated?​ Profile generated compared to profile from evidence and/or profiles in databases, does it match? ​ -No, OK move on, not a match​ -Yes, more complicated ​ Is this the same person or two people with similar profile?​ Must estimate the probability that the two profiles are a random match​ ​ Profile probability or random match probability method gives a numerical probability that a person chosen at random from a population would share the same DNA profile as the one generated. ​

Y-Chromosome STR profiling​

What if you have a mixed sample with more than one organism's DNA within a sample?​ You must be able to tell differentiate between the different DNA profiles within a sample ​ ​ STR profiling of the Y-chromosome can help to differentiate between samples​ -Over 200 STR loci on Y chromosome​ - <20 used for profiling​ -Primers are made to only amplify on Y chromosome and not X​ ​ Cannot differentiate between Father-Son & male siblings ​ -direct inheritance from father to son​ -no recombination, no genetic variability​ -Seemingly unrelated males may have same Y profile if they share a male ancestor!​ ​ Can be useful for further differentiation between samples, missing persons identification, & genetic genealogy studies ​

A plasmid contains a multiple cloning site inside the coding region of the lacZ gene and also contains an ampicillin resistance gene at a separate locus. When cells are transformed with a successfully recombinant plasmid containing a piece of DNA cloned into the multiple cloning site, what color will the colonies be when grown on an agar plate containing ampicillin and Xgal?

White

The CRISPR-Cas system of gene editing is based on what naturally occurring biological process?

bacterial defense against viral infection

CFDNA TESTING​

cfDNA from blood sequenced to analyze haplotypes to distinguish maternal vs fetal DNA​ Haplotypes are DNA variations which are inherited but do not undergo recombination during gamete formation​ Much of the preemptive genetic testing is not covered by insurance unless there is a specific family hist

When a mutation is made in an organism that leads to a loss-of-function mutation, this organism is called a ___________. If you can control the loss of function in time and location, then it is called a ________. If a mutation is made which leads to the introduction of a new gene or overexpression of a gene, this is called a __________. These mutations are made through use of a ___________, which is used as a template during ________.

knock-out., conditional knock-out, knock-in, targeting vector, NHEJ.

Recognition sequences for restriction enzymes possess the unique quality of being the same when read 5′ to 3′ on either strand. What is this property called?

palindromic sequence

CODIS (Combined DNA Index System) is a database that contains DNA profiles from all of the following EXCEPT ________.

public servants

DNA ligase ________.

reconnects the phosphodiester linkage between bases on the same strand of DNA

Nucleic acid blotting is commonly used in molecular biology. Northern blotting is used to detect the presence of which type of nucleic acid?

ribonucleic acids

Agarose gels separate DNA fragments based on what property?

size of the fragment

What is the function of a ddNTP in DNA sequencing?

termination of DNA synthesis

VNTRs are useful in DNA forensics because ________.

variation in loci