For BioChem final part 2
What kind of columns are used?
"full-sized" columns, the longer the column, the better separation (resolution)
Glycosphingolipids and cholesterol cluster together in membrane regions known as "__________". These microdomains are more __________ than the surrounding phospholipid-rich membrane due to a high content of __________ fatty acids. These regions are rich in proteins that are anchored to the membrane by covalently attached __________ and __________ groups and also those anchored by GPI linkage. Proteins aggregated in this fashion are often functionally related. Examples are (1) __________ proteins and (2) __________ proteins.
"rafts", ordered, saturated, myristoyl, palmitoyl, receptor, signaling.
What are three differences between ion channels and ion transporters?
(1) The rate of ion movement through channels is much greater; (2) ion transporters exhibit saturation, whereas ion channels do not; (3) ion channels open and close in response to external stimuli or events such as ligand-binding or changes in electrical potential across the membrane.
(a) Define "reducing sugar." (b) Sucrose is a disaccharide composed of glucose and fructose (Glc(alpha1-->2)Fru). Explain why sucrose is not a reducing sugar, even though both glucose and fructose are.
(a) A reducing sugar is one with a free carbonyl carbon that can be oxidized by Cu2+ or Fe3+. (b) The carbonyl carbon is C-1 of glucose and C-2 of fructose. When the carbonyl carbon is involved in a glycosidic linkage, it is no longer accessible to oxidizing agents. In sucrose (Glc(alpha-->2)Fru), both oxidizable carbons are involved in the glycosidic linkage.
Distinguish between simple diffusion (SD), facilitated diffusion (FD), and active transport (AT) across a membrane for the following questions (more than one may be true). (a) Which processes are energy dependent? (b) Which processes need some kind of carrier protein(s)? (c) Which processes can be saturated by substrate? (d) Which processes can establish a concentration gradient? (e) How much energy does it take to transport an uncharged substrate in, if its starting inside concentration is 10-fold greater than outside?
(a) AT only; (b) FD and AT; (c) FD and AT; (d) AT only; (e) 5.7 kJoules/mole
(a) Define the term amphipathic. (b) Diagram two types of assemblies that amphipathic molecules form in water. (c) What are the forces that contribute to the formation of the structures diagrammed in (b)?
(a) Amphipathic means having one region that is polar and another that is nonpolar. (b) The two common structures formed by lipids in water are micelles and bilayers. (See Fig. 11-4, p. 374.) (c) These lipid aggregates in water are stabilized by the energy gain from burying hydrophobic groups out of contact with water. When a hydrophobic chain is surrounded by water, it forces the formation of a cage of immobilized water molecules around it. When several hydrophobic regions cluster, the surface area exposed to water decreases, and the water molecules in the cage are released, with a gain in entropy that drives the formation of the lipid aggregates.
(a) Draw the structure of any aldohexose in the pyranose ring form. (b) Draw the structure of the anomer of the aldohexose you drew above. (c) How many asymmetric carbons (chiral centers) does each of these structures have? (d) How many stereoisomers of the aldohexoses you drew are theoretically possible?
(a) Any of the hexoses drawn with a six-membered ring, as shown in Fig. 7-7 on p. 239, is correct. The hydroxyls at C-2, C-3, and C-4 can point either up or down. (b) For the anomer, the structure should be identical to the first, except that the hydroxyl group at C-1 should point up if it pointed down in your first structure, and vice versa. (c) The number of chiral centers is 5; all are carbons except C-6. (d) The number of possible stereoisomers for a compound with n chiral centers is 2n; in this case, 25, or 32 possible isomers.
Draw the structure of the repeating basic unit of: (a) amylose (b) cellulose.
(a) For the structure of amylose, see Fig. 7-14a, p. 245. The repeating unit is alpha-D-glucose linked to alpha-D-glucose; the glycosidic bond is therefore (alpha1 --> 4). (b) Cellulose has the same structure as amylose, except that the repeating units are beta-D-glucose and the glycosidic bond is (beta1--> 4). (See Fig. 7-15a, p. 246.)
Define each in 20 words or less: (a) anomeric carbon; (b) enantiomers; (c) furanose and pyranose; (d) glycoside; (e) epimers; (f) aldose and ketose.
(a) The anomeric carbon is the carbonyl carbon atom of a sugar, which is involved in ring formation. (b) Enantiomers are stereoisomers that are nonsuperimposable mirror images of each other. (c) Furanose is a sugar with a five-membered ring; pyranose is a sugar with a six-membered ring. (d) A glycoside is an acetal formed between a sugar anomeric carbon hemi-acetal and an alcohol, which may be part of a second sugar. (e) Epimers are stereoisomers differing in configuration at only one asymmetric carbon. (f) An aldose is a sugar with an aldehyde carbonyl group; a ketose is a sugar with a ketone carbonyl group.
Define each in 20 words or fewer: (a) anomeric carbon (b) enantiomers (c) furanose and pyranose (d) glycoside (e) epimers (f) aldose and ketose
(a) The anomeric carbon is the carbonyl carbon atom of a sugar, which is involved in ring formation. (b) Enantiomers are stereoisomers that are nonsuperimposable mirror images of each other. (c) Furanose is a sugar with a five-membered ring; pyranose is a sugar with a six-membered ring. (d) A glycoside is an acetal formed between a sugar anomeric carbon hemi-acetal and an alcohol, which may be part of a second sugar. (e) Epimers are stereoisomers differing in configuration at only one asymmetric carbon. (f) An aldose is a sugar with an aldehyde carbonyl group; a ketose is a sugar with a ketone carbonyl group.
(a) What kinds of forces or bonds anchor an integral membrane protein in a biological membrane? (b) What forces hold a peripheral membrane protein to the membrane? (c) What might one do to solubilize each of the two types of membrane proteins?
(a) The forces that hold integral membrane proteins in the membrane are hydrophobic interactions between hydrophobic domains of the protein and the fatty acyl chains of the bilayer interior. (b) Peripheral membrane proteins associate with membranes primarily through ionic interactions and hydrogen bonds between charged and polar side chains of the protein and polar head groups of membrane lipids. Some peripheral membrane proteins contain a covalently bound lipid that anchors them to the bilayer. (c) To remove integral membrane proteins, it is generally necessary to use detergents, which convert membranes into "soluble" micelles. Peripheral membrane proteins can often be released by extraction with buffers of high or low salt concentration, high or low pH, or low concentrations of divalent cations.
(a) When relatively high concentrations of fatty acids are suspended in water, they form structures known as ________. (b) When relatively high concentrations of membrane phospholipids are dissolved in water, they form structures known as ________. (c) Why are the structures listed in your answers to (a) and (b) above energetically favored?
(a) micelles. (b) bilayers. (c) Micelles are favored when the polar head group has a greater cross-sectional area than the nonpolar acyl chain, making the molecule wedge-shaped; bilayers are favored when the cross-sectional area of head group and acyl chain(s) are about the same, so that the molecule is cylindrical.
(a) List the major components of membranes. (b) When a preparation of mitochondrial membranes was treated with high salt (0.5 M NaCl), it was observed that 40% of the total protein in this preparation was solubilized. What kind of membrane proteins are in this soluble extract, and what forces normally hold them to the membrane? (c) What kind of proteins constitute the insoluble 60%, and what forces hold these proteins in the membrane?
(a) phospholipids, sterols, proteins (integral and peripheral); (b) peripheral membrane proteins, which are associated with the membrane through ionic and hydrogen bonds between their charged and polar side chains and the charged head groups of phospholipids; (c) integral membrane proteins (which are held to the membrane by hydrophobic interactions between their nonpolar side chains and the hydrophobic fatty acyl chains of phospholipids), and those peripheral membrane proteins that are held to the membrane by a covalent lipid anchor.
a) What is meant by the transition temperature of a membrane? List the two characteristics of the fatty acids in a biological membrane that affect the transition temperature. Using up arrow or down arrow, show in which direction an increase in these characteristics would change the transition temperature.
(a) the transition temperature of a membrane is the temperature at which its structure changes from a paracyrstalline solid to a liquid state. (b) The two characteristics of of fatty acids that directly affect Tt are degree of unsaturation (up arrow) and chain length (down arrow).
(a) Explain why phosphoglycerides are capable of spontaneously assembling into the bilayer structure found in biological membranes but triacylglycerols are not. (b) What are the forces that drive bilayer formation?
(a): Triacylglycerols have three fatty acyl groups in ester linkage with glycerol; they are very hydrophobic because the carboxyl groups, which are involved in the ester linkages, cannot ionize. Phosphoglycerides have a polar region at their head group, where a phosphate in a phosphodiester linkage bears a full negative charge. The head group itself (serine, ethanolamine, choline, etc.) may also be charged and is polar in any case. Thus, the phospholipid is amphipathic, having both polar and nonpolar regions, and it forms lipid bilayers spontaneously in water. (b) These lipid bilayers are stabilized by the energy gained from burying hydrophobic groups out of contact with water. A hydrophobic chain in water forces the formation of a cage of immobilized water molecules around it. When several hydrophobic regions cluster in a bilayer, the surface area exposed to water decreases, and the water molecules in the cage are released, accompanied by a gain in entropy that drives the formation of the bilayer.
RH antigen
- If present >> + - If absent >> -
A blood
- red blood cells have A antigens - produces anti-B-antibodies
AB blood
- red blood cells have A antigens - red blood cells have B antigens - produces NO anti-A or B antibodies - universal recipient
B blood
- red blood cells have B antigens - produces anti-A-antibodies
O blood
- red blood cells have NO antigens - produces anti-A-antibodies - produces anti-B-antibodies - universal donor
antibody
- something your body produces to fight glycoproteins that aren't yours - attach to antigens
antigen
- specific glycoprotein located on the surface of the cells - helps to identify cells
What are the first and second laws of thermodynamics?
1) Energy is neither created nor destroyed, only conserved/exchanged; expressed as deltaU = q - w 2) Natural processes are spontaneous (deltaS > 0) leading to an increase in disorder/entropy; expressed as deltaSuni = deltaSsys + deltaSsur > 0
4. Outline the four key features of the current model for homologous recombination during meiosis in a eukaryotic cell.
1) Homologous chromosomes are aligned. (2) A double-strand break is enlarged by an exonuclease, leaving a single-strand extension with a 2) free 3' hydroxyl end. (3) The exposed 3' ends invade the homologous intact duplex DNA, followed by branch migration to create a Holliday junction. (4) Cleavage of the two crossover products creates the two recombinant products.
c) α1-6 galactosidase
1) Raffinose (found in beans, cabbages, etc.) along with other branched galactose-containing carbohydrates, is poorly digested in the small intestines of some individuals. If they are not cleaved to monosaccharides and absorbed, these sugars are instead fermented in the large intestine by bacteria, producing large amounts of hydrogen, carbon dioxide and methane gases. Pain and flatulence can be avoided by using products like Beano™. Beano™, which cleaves the glycosidic bond indicated with an arrow, contains: a) α1-2 galactosidase b) α1-4 galactosidase c) α1-6 galactosidase d) β2-4 galactosidase e) β4-6 galactosidase
Outline the mechanism of action of GLUT1 transporter
1) extracellular glucose binds to GLUT1 transporter protein 2)protein changes conformation 3)glucose disassociates inside the cell 4) GLUT1 protein returns to original conformation *broad substrate specificity
What factors influence the fluidity of a bilayer?
1) temperature- highly dependent on chain length (x) and degree of saturation (m) 2) lipid composition cholesterol serves as fluidity buffer
What are the two forms of active transport? What is the direct and ultimate source of energy for each form?
1)primary = energy directly from ATP hydrolysis 2)secondary = energy from gradient discharge
E) alpha-D-glucose and beta-D-glucose
1. Which of these pairs can readily interconvert in the process of mutarotation? A) D-glucose and D-fructose B) D-glucose and D-ribose C) D-glucose and D-glucosamine D) D-glucose and L-glucose E) alpha-D-glucose and beta-D-glucose
List three different major components of eukaryotic membranes
1. Plasma membrane 2. cytoplasm 3. smooth and rough endoplasmic reticulum
What are the common fold of transmembrane region of integral proteins?
10 fold
A) 14:1(Δ11)
13. What is the abbreviated nomenclature for a 14-carbon omega-3 fatty acid that contains no other double bonds? A) 14:1(Δ11) B) 17:1(Δ14) C) 14:1(Δ3) D) 13:1(Δ11) E) 14:0(Δ11)
E) Triacylglycerol
14. Which compound is NOT found in membranes? A) sphingolipid B) glycerophospholipid C) polypeptides D) sterol E) Triacylglycerol
What is the abbreviated nomenclature for a 14 carbon omega-3 fatty acid that contains no other double bonds? ^ = delta A) 14:1 (^11) B) 17:1 (^14) C) 14:1 (^3) D) 13:1 (^11) E) 14:0 (^11)
14:1 (^11) **"omega" indicates 1st carbon is furthest from ketone **delta = 1st is closest to ketone
What is the abbreviated nomenclature for a 14-carbon omega-3 fatty acid that contains no other double bonds?
14:1(11)
A) The secondary structure in the transmembrane region usually consists of α helices or β sheets composed of hydrophobic amino acids.
15. Which statement is generally TRUE of integral membrane proteins? A) The secondary structure in the transmembrane region usually consists of α helices or β sheets composed of hydrophobic amino acids. B) The domains that protrude on the cytoplasmic face of the plasma membrane nearly always have covalently attached oligosaccharides. C) Transmembrane domains are easily accessible, and therefore very susceptible to degradation by the protease trypsin. D) They can be removed from the membrane with high salt. E) They undergo constant rotational motion that moves a given domain from the outer face of a membrane to the inner face and then back to the outer.
Glucose, with its four chiral carbon atoms, has ________ possible stereoisomers
16
B) putting longer-chain fatty acids into its membranes.
16. When a bacterium such as E. coli is shifted from a cooler growth temperature to a warmer growth temperature, it compensates by: A) increasing its metabolic rate to generate more heat. B) putting longer-chain fatty acids into its membranes. C) putting more unsaturated fatty acids into its membranes. D) shifting from aerobic to anaerobic metabolism.
A) driven by a difference of solute concentration.
17. Facilitated diffusion through a biological membrane is: A) driven by a difference of solute concentration. B) driven by ATP. C) endergonic. D) generally irreversible. E) not specific with respect to the substrate
B) about -10 kJ/mol
18. Consider the transport of glucose into an erythrocyte by facilitated diffusion. What is the free-energy change for glucose uptake into the cell when the glucose concentrations are 5 mM on the outside and 0.1 mM on the inside? (These values may be of use to you: R = 8.315 J/mol · K; T = 298 K; Faraday constant = 96,480 J/V; N = 6.022 × 1023/mol.) A) About 2 kJ/mol B) about -10 kJ/mol C) about 30 kJ/mol D) about -30 kJ/mol E) It is impossible to calculate without knowledge of the membrane potential.
What is the abbreviated nomenclature for octadecanoic acid with two double bonds?
18:2
both flippases and floppases
19. Which transporters can be classified as active transporters? A) flippases B) floppases C) scramblases D) both flippases and floppases E) both flippases and scramblases
What is the volume of each fraction?
2 mL
C) glucose; nonenzymatically
2. Hemoglobin glycation is a process where _____ is _____ attached to hemoglobin. A) glycerol; covalently B) glucose; enzymatically C) glucose; nonenzymatically D) N-acetyl-galactosamine; enzymatically E) galactose; nonenzymatically
The shortest α helix segment in a protein that will span a membrane bilayer has about _____ amino acid residues.
20
D) both a glycerol backbone and three fatty acids.
20. Triacylglycerols (TAGs) are composed of: A) a glycerol backbone. B) three fatty acids. C) amide linkages between the fatty acids and the glycerol. D) both a glycerol backbone and three fatty acids. E) a glycerol backbone, three fatty acids, and amide linkages between the fatty acids and the glycerol. (false, it is an ester linkage)
The inner (plasma) membrane of E. coli is about 75% lipid and 25% protein by weight. How many molecules of membrane lipid are there for each molecule of protein? (Assume that the average protein is Mr 50,000 and the average lipid is 750.)
200
D) both flippases and floppases
21) Which transporters can be classified as active transporters? A) flippases B) floppases C) scramblases D) both flippases and floppases E) both flippases and scramblases
Purines have ____ ring(s), (each) containing _____ nitrogen(s), whereas pyrimidines have _____ ring(s), (each) containing _____ nitrogens.
2; 2; 1; 2
How many stereoisomers do monosaccharides have?
2^n where n = # of chiral C atoms
Raffinose is non-reducing. How many anomeric carbons participate in glycosidic bonds in raffinose? A) 0 B) 1 C) 2 D) 3 E) 4
3
In one catalytic cycle, the Na+/K+ ATPase transporter transports:
3 Na+ out, 2 K+ in, and converts 1 ATP to ADP + Pi.
D) alpha-D-glucose.
3. Starch and glycogen are both polymers of: A) fructose. B) glucose 1-phosphate. C) sucrose. D) alpha-D-glucose. E) Beta-D-glucose.
How many stereoisomers are possible for a ketopentose, ribulose?
4
A) aldose; ketose
4. In a(n) _____ the carbonyl group is at the end of the carbon chain, but in a(n) _____ the carbonyl group can be at any other position. A) aldose; ketose B) ketose; aldose C) hexose; heptose D) aldose; hexose E) ketose; tetrose
64. About what percentage of mammalian proteins are glycosylated? A) 5% B) 15% C) 50% D) 90% E) 95%
50%
D) Lectins
6) Oligosaccharide residues on cell surfaces provide recognition sites for a variety of functions, including cell-cell adhesion, movement of immune cells through capillary walls, viral attachment and infection of cells, and targeting of red blood cells and serum proteins for destruction. __________________ are the proteins involved in recognition of specific oligosaccharide structures. A) Antibodies B) Globins C) Proteoglycans D) Lectins E) Glycosylhydrolases
Hb1AC is formed by the non-enzymatic attachment of glucose to the N-terminus of hemoglobin. Since the reaction is concentration dependent, a high HbA1C indicates hyperglycemia (consistently high blood sugar).
6) Your friend mentions he had an abnormally high HbA1C (glycated hemoglobin) result on his annual physical. Explain how Hb1AC is formed, and what it indicates. (2-3 sentences).
5. The 5'-CAP of an eukaryotic mRNA is a ____ links to 5'-end of mRNA via a ______ link.
7-methylguanosine 5/,5'-triphosphate
How many stereoisomers are possible for aldopentose, ribose?
8
15. In homologous genetic recombination, RecA protein is involved in: A) formation of Holliday intermediates and branch migration. B) introduction of negative supercoils into the recombination products. C) nicking the two duplex DNA molecules to initiate the reaction. D) pairing a DNA strand from one duplex DNA molecule with sequences in another duplex, regardless of complementarity. E) resolution of the Holliday intermediate
A
8. Which of these enzymes is not directly involved in methyl-directed mismatch repair in E. coli? A) DNA glycosylase B) DNA helicase II C) DNA ligase D) DNA polymerase III E) Exonuclease I
A
A pyrimidine is joined covalently to the pentose sugar through the: A) N-1 of the base to the 1′ carbon of the pentose. B) N-9 of the base to the 1′ carbon of the pentose. C) N-1 of the base to the 5′ carbon of the pentose. D) N-9 of the base to the 5′ carbon of the pentose. E) None of the answers is correct.
A
Any sugar that has a free aldehyde group is called a(n) _____. A) reducing sugar B) non-reducing sugar C) ketose D) aldohexose E) alditol
A
Based on Chargaff's rules, which base compositions for double-stranded DNA are possible? %A %G %C %T %U A) 5 45 45 5 0 B) 20 20 20 20 20 C) 35 15 35 15 0 D) All of the answers are correct. E) None of the answers is correct.
A
Based on Chargaff's rules, which of the following are possible base compositions for double-stranded DNA? %A %G %C %T %U A) 5 45 45 5 0 B) 20 20 20 20 20 C) 35 15 35 15 0 D) All of the above E) None of the above
A
Based on the form of the cyclic sugar shown below in a Haworth projection, which Fischer projection formula could have formed this structure? A B C D
A
Bile acids are derived from which lipid? A) cholesterol B) sphingomyelin C) ceramide D) digalactosyldiacylglycerol E) phosphatidylcholine
A
DNA is _____ chemically stable than RNA due to the _____ on _____. A) more; 2′-hydroxyl groups; RNA B) more; 2′-hydroxyl groups; DNA C) more; 3′-hydroxyl groups; RNA D) less; 2′-hydroxyl groups; RNA E) less; 2′-hydroxyl groups; DNA
A
Enzymatic hydrolysis of a purified polysaccharide with a glycosidase that cleaves specifically usually occurs before analysis by: A) NMR and mass spectrometry. B) ion-exchange chromatography. C) gel-filtration chromatography. D) lectin-affinity chromatography. E) gas-liquid chromatography.
A
Facilitated diffusion through a biological membrane is: A) driven by a difference of solute concentration. B) driven by ATP. C) endergonic. D) generally irreversible. E) not specific with respect to the substrate
A
From the abbreviated name of the compound Gal(1 4)Glc, we know that: A) C-4 of glucose is joined to C-1 of galactose by a glycosidic bond. B) the compound is a D-enantiomer. C) the galactose residue is at the reducing end. D) the glucose is in its pyranose form. E) the glucose residue is the beta anomer.
A
From the abbreviated name of the compound Gal(b1 ® 4)Glc, we know that: A) C-4 of glucose is joined to C-1 of galactose by a glycosidic bond. B) the compound is a D-enantiomer. C) the galactose residue is at the reducing end. D) the glucose is in its pyranose form. E) the glucose residue is the b anomer.
A
Glucose and galactose are _____ of each other. A) epimers B) enantiomers C) diastereomers D) anomers E) none of the above
A
In a(n) _____ the carbonyl group is at the end of the carbon chain, but in a(n) _____ the carbonyl group can be at any other position. A) aldose; ketose B) ketose; aldose C) hexose; heptose D) aldose; hexose E) ketose; tetrose
A
In amylose, the most stable structure is a _____, which is stabilized by _____. A) coiled helix; interchain hydrogen bonds B) coiled helix; interchain covalent branching C) coiled helix; hydrogen bonds to surrounding water molecules D) straight, extended chain; interchain hydrogen bonds E) straight, extended chain; hydrogen bonds to surrounding water molecules
A
In glycoproteins, the carbohydrate moiety is always attached through the amino acid residues: A) asparagine, serine, or threonine. B) aspartate or glutamate. C) glutamine or arginine. D) glycine, alanine, or aspartate. E) tryptophan, aspartate, or cysteine.
A
In glycoproteins, the carbohydrate moiety is always attached through the amino acid residues: A) asparagine, serine, or threonine. B) aspartate or glutamate. C) glutamine or arginine. D) glycine, alanine, or aspartate. E) tryptophan, aspartate, or cysteine.
A
In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share which one of the following properties? A) The distance between the two glycosidic (base-sugar) bonds is the same in both base pairs, within a few tenths of an angstrom. B) The molecular weights of the two base pairs are identical. C) The number of hydrogen bonds formed between the two bases of the base pair is the same. D) The plane of neither base pair is perpendicular to the axis of the helix. E) The proton-binding groups in both base pairs are in their charged or ionized form
A
In the Watson-Crick structure of DNA, the: A) absence of 2'-hydroxyl groups allows bases to lie perpendicular to the helical axis. B) adenine content of one strand must equal the thymine content of the same strand. C) nucleotides are arranged in the A-form. D) purine content (fraction of bases that are purines) must be the same in both strands. E) two strands are parallel.
A
In the Watson-Crick structure of DNA, the: A) absence of 2'-hydroxyl groups allows bases to lie perpendicular to the helical axis. B) adenine content of one strand must equal the thymine content of the same strand. C) nucleotides are arranged in the A-form. D) purine content (fraction of bases that are purines) must be the same in both strands. E) two strands are parallel
A
Oligosaccharides differ from nucleic acids and proteins in that oligosaccharides are commonly: A) branched. B) polymeric. C) acidic. D) basic. E) None of the answers is correct.
A
Peripheral membrane proteins: A) are generally noncovalently bound to membrane lipids. B) are usually denatured when released from membranes. C) can be released from membranes only by treatment with detergent(s). D) may have functional units on both sides of the membrane. E) penetrate deeply into the lipid bilayer.
A
Several types of human joint and skeletal defects are a result of a defect in a biosynthetic enzyme responsible for synthesis of: A) glycosaminoglycans. B) glycoproteins. C) glycolipids. D) lipopolysaccharides. E) glycosphingolipids.
A
Sphingosine is NOT a component of: A) cardiolipin. B) ceramide. C) cerebrosides. D) gangliosides. E) sphingomyelin.
A
Sphingosine is not a component of: A) cardiolipin. B) ceramide. C) cerebrosides. D) gangliosides. E) sphingomyelin.
A
Tay-Sachs disease is the result of a genetic defect in the metabolism of: A) gangliosides. B) phosphatidyl ethanolamine. C) sterols. D) triacylglycerols. E) vitamin D.
A
Tay-Sachs disease is the result of a genetic defect in the metabolism of: A) gangliosides. B) phosphatidyl ethanolamine. C) sterols. D) triacylglycerols. E) vitamin D.
A
The CORRECT name for the molecule shown below is: A) 5-methylcytidine. B) C5-methylcytidine. C) 5-methyluridine. D) C5-methylthymidine. E) 5-methylthymidine.
A
The difference between a ribonucleotide and a deoxyribonucleotide is: A) a deoxyribonucleotide has an —H instead of an —OH at C-2. B) a deoxyribonucleotide has an —H instead of an —OH at C-3. C) a ribonucleotide has an extra —OH at C-4. D) a ribonucleotide has more structural flexibility than deoxyribonucleotide. E) a ribonucleotide is a pyranose, deoxyribonucleotide is a furanose.
A
The difference between a ribonucleotide and a deoxyribonucleotide is: A) a deoxyribonucleotide has an —H instead of an —OH at C-2. B) a deoxyribonucleotide has an —H instead of an —OH at C-3. C) a ribonucleotide has an extra —OH at C-4. D) a ribonucleotide has more structural flexibility than deoxyribonucleotide. E) a ribonucleotide is a pyranose, deoxyribonucleotide is a furanose
A
The image below shows a DNA sequencing gel using the Sanger method. The top of the gel is the anode and the bottom is the cathode. Which band represents the shortest and longest fragments of DNA? A) shortest = Z, longest = W B) shortest = X, longest = Z C) shortest = W, longest = Y D) shortest = Y, longest = X E) shortest = W, longest = Z
A
The phosphodiester bond that joins adjacent nucleotides in DNA: A) associates ionically with metal ions, polyamines, and proteins. B) is positively charged. C) is susceptible to alkaline hydrolysis. D) Links C-2 of one base to C-3 of the next. E) links C-3 of deoxyribose to N-1 of thymine or cytosine.
A
The phosphodiester bond that joins adjacent nucleotides in DNA: A) associates ionically with metal ions, polyamines, and proteins. B) is positively charged. C) is susceptible to alkaline hydrolysis. D) Links C-2 of one base to C-3 of the next. E) links C-3 of deoxyribose to N-1 of thymine or cytosine
A
The polysaccharide chitin is MOST chemically similar to: A) cellulose. B) dextran. C) glycogen. D) starch. E) amylose.
A
The specificity of the potassium channel for K+ over Na+ is mainly the result of the: A) differential interaction with the selectivity filter protein. B) hydrophobicity of the channel. C) phospholipid composition of the channel. D) presence of carbohydrates in the channel. E) presence of cholesterol in the channel.
A
The structures seen below would MOST likely be formed by: A) W: RNA / X: RNA / Y: DNA B) W: RNA / X: DNA / Y: DNA C) W: DNA / X: DNA / Y: RNA D) W: DNA / X: RNA / Y: RNA E) W: RNA / X: RNA / Y: RNA
A
The type of motion least common in biological membranes is: A) flip-flop diffusion of phospholipid from one monolayer to the other. B) lateral diffusion of individual lipid molecules within the plane of each monolayer. C) lateral diffusion of membrane proteins in the bilayer. D) lateral diffusion of protein molecules in the lipid bilayer E) random motion of the fatty acyl side chains in the interior of the phospholipid bilayer.
A
What is the abbreviated nomenclature for a 14-carbon omega-3 fatty acid that contains no other double bonds? A) 14:1(D11) B) 17:1(D14) C) 14:1(D3) D) 13:1(D11) E) 14:0(D11)
A
Which arrow CORRECTLY identifies the atom that will become the anomeric carbon? A) A B) B C) C D) D E) E
A
Which commonality does NOT exist between peptides, nucleic acids, and poly- and oligosaccharides? A) They are all synthesized from a template. B) They are all information-carrying molecules. C) They are all created from multiple building blocks. D) The sequence of monomers is important for function. E) All of the answer choices are commonalities between peptides, nucleic acids, and poly- and oligosaccharides.
A
Which molecule contains the GREATEST amount of stored chemical energy? A) dGTP B) GDP C) dGDP D) GMP E) cGMP
A
Which of the following best describes the cholesterol molecule? A) Amphipathic B) Nonpolar, charged C) Nonpolar, uncharged D) Polar, charged E) Polar, uncharged
A
Which of the following is a major difference between cellulose and chitin? A) chitin is produced by insects, cellulose is produced by plants B) chitin contains glucose and glucosamine, cellulose contains only glucose C) chitin contains (16) glycosidic bonds, cellulose contains (14) glycosidic bonds D) chitin is a branched polymer, cellulose is linear E) none of the above
A
Which of the following is true of sphingolipids? A) Cerebrosides and gangliosides are sphingolipids. B) Phosphatidylcholine is a typical sphingolipid. C) They always contain glycerol and fatty acids. D) They contain two esterified fatty acids. E) They may be charged, but are never amphipathic.
A
Which of the following polysaccharides cannot be digested by mammalian salivary, gastric, or pancreatic enzymes? A) cellulose B) amylopectin C) amylose D) glycogen E) starch
A
Which of the following statements about sterols is true? A) All sterols share a fused-ring structure with four rings. B) Sterols are found in the membranes of all living cells. C) Sterols are soluble in water, but less so in organic solvents such as chloroform. D) Stigmasterol is the principal sterol in fungi. E) The principal sterol of animal cells is ergosterol.
A
Which of the following statements concerning fatty acids is correct? A) One is the precursor of prostaglandins. B) Phosphatidic acid is a common one. C) They all contain one or more double bonds. D) They are a constituent of sterols. E) They are strongly hydrophilic.
A
Which of these is a general feature of the lipid bilayer in all biological membranes? A) Individual lipid molecules are free to diffuse laterally in the surface of the bilayer. B) Individual lipid molecules in one face (monolayer) of the bilayer readily diffuse (flip-flop) to the other monolayer. C) Polar, but uncharged, compounds readily diffuse across the bilayer. D) The bilayer is stabilized by covalent bonds between neighboring phospholipid molecules. E) The polar head groups face inward toward the inside of the bilayer.
A
Which of these statements about facilitated diffusion across a membrane is true? A) A specific membrane protein lowers the activation energy for movement of the solute through the membrane. B) It can increase the size of a transmembrane concentration gradient of the diffusing solute. C) It is impeded by the solubility of the transported solute in the nonpolar interior of the lipid bilayer. D) It is responsible for the transport of gases such as O2, N2, and CH4 across biological membranes. E) The rate is not saturable by the transported substrate
A
Which of these statements about the composition of biological membranes is false? Pg 372 A) In a given eukaryotic cell type (e.g., a hepatocyte), all intracellular membranes have essentially the same complement of lipids and proteins. B) The carbohydrate found in membranes is virtually all part of either glycolipids or glycoproteins. C) The plasma membranes of the cells of vertebrate animals contain more cholesterol than the mitochondrial membranes. D) The ratio of lipid to protein varies widely among cell types in a single organism. E) Triacylglycerols are not commonly found in membranes
A
Which of these statements is generally true of integral membrane proteins? A) A hydropathy plot reveals one or more regions with a high hydropathy index. B) The domains that protrude on the cytoplasmic face of the plasma membrane nearly always have covalently attached oligosaccharides. C) They are unusually susceptible to degradation by trypsin. D) They can be removed from the membrane with high salt or mild denaturing agents. E) They undergo constant rotational motion that moves a given domain from the outer face of a membrane to the inner face and then back to the outer.
A
Which single-stranded nucleic acid could form a hairpin structure? A) 5′ TTTGCGATACTCATCGCATT 3′ B) 5′ TTTGCGATACTCACGCTATT 3′ C) 5′ TTTGCGATACTCTGCGATTT 3′ D) All of the answers are correct. E) None of the answers is correct.
A
Which statement BEST describes how the volatility of lipids is increased for analysis by gas chromatography? A) The lipids are transesterified to convert fatty acids into fatty acid methyl esters. B) The lipids are cleaved with phospholipase enzymes . C) The lipids are degraded by treatment with mild acid or base. D) The lipids are dissolved in chloroform. E) The lipids are desaturated by reaction with a platinum catalyst.
A
Which statement about free glucose storage is FALSE? A) Glucose is insoluble and cannot contribute to the osmotic balance of the cell. B) Glycogen has an intracellular concentration of 0.1mM, equivalent to a glucose concentration of 0.4 M. C) The free energy difference between intra- and extracellular free glucose would be difficult to overcome for glucose uptake by the cell. D) The concentration gradient of intra- and extracellular glucose would be prohibitively large. E) All statements are true.
A
Which statement about sterols is TRUE? A) All sterols share a fused-ring structure with four rings. B) Sterols are found in the membranes of all living cells. C) Sterols are soluble in water, but less so in organic solvents such as chloroform. D) Cholesterol is the principal sterol in fungi. E) The principal sterol of animal cells is ergosterol.
A
Which statement concerning fatty acids is CORRECT? A) A fatty acid is the precursor of prostaglandins. B) Phosphatidic acid is a common fatty acid. C) Fatty acids all contain one or more double bonds. D) Fatty acids are a constituent of sterols. E) Fatty acids are strongly hydrophilic.A
A
Which statement describes a distinct difference between membrane lipids in archaea and membrane lipids in eukarya? A) Archaeal membrane lipids have alkyl acids that are ether-linked to glycerol at both ends. B) Eukaryotic membrane lipids consist of glycerol that is ester-linked to three fatty acids. C) Only eukaryotic membrane lipids are amphipathic. D) Archaeal membrane lipids always contain sphingosine. E) Eukaryotic membrane lipids always have a phosphate group attached to glycerol.
A
Which statement is FALSE about the enzyme lysozyme? A) It is the active ingredient in penicillin. B) It is found in human tears. C) It is produced by some bacterial viruses. D) It hydrolyzes the (b1®4) glycosidic bond of peptidoglycan. E) It causes osmotic lysis of bacterial cells.
A
Which statement is TRUE of sphingolipids? A) Cerebrosides and gangliosides are sphingolipids. B) Phosphatidylcholine is a typical sphingolipid. C) They always contain glycerol and fatty acids. D) They contain two esterified fatty acids. E) They may be charged, but are never amphipathic.
A
Which technique is NOT commonly used to study oligosaccharide structures? A) x-ray crystallography B) matrix-assisted laser desorption/ionization mass spectroscopy (MALDI-MS) C) nuclear magnetic resonance (NMR) D) complete chemical synthesis E) oligosaccharide microarrays
A
Which technique would you NOT use to separate and/or analyze lipids in a laboratory? A) gel electrophoresis B) thin-layer chromatography C) adsorption chromatography D) mass spectrometry E) high-performance liquid chromatography (HPLC)
A
Which term BEST describes the cholesterol molecule? A) amphipathic B) nonpolar, charged C) nonpolar, uncharged D) polar, charged E) polar, uncharged
A
n the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share which property? A) The distance between the two glycosidic (base-sugar) bonds is the same in both base pairs, within a few tenths of an angstrom. B) The molecular weights of the two base pairs are identical. C) The number of hydrogen bonds formed between the two bases of the base pair is the same. D) The plane of neither base pair is perpendicular to the axis of the helix. E) The proton-binding groups in both base pairs are in their charged or ionized form.
A
ncubation of DNA at low pH is MOST likely to cause: A) depurination. B) depyrimidination. C) mutation of cytosine to uracil. D) hydrolysis of the phosphodiester bond. E) deamination of adenine and guanine.
A
The sialic acids A) are important constituents of glycoproteins and glycolipids. B) are N-acetyl glucosamine derivatives. C) incorporate a succinic acid derivative. D) all of the above E) none of the above
A - Are important constituents of glycoproteins and glycolipids
D-Allose is an aldohexose. Methylation of which hydroxyl group on B-D-allopyranose prevents the molecule from mutarotating to a-D-allopyranose? A) C1 B) C2 C) C3 D) C4 E) C5
A - C1
Which of the following polysaccharides cannot be digested by mammalian salivary, gastric, or pancreatic enzymes? A) cellulose B) amylopectin C) amylose D) glycogen E) starch
A - Cellulose Neither can chitin
O- (no antigens) can be received without being agglutinated by recipient antibodies
A 57-year-old man is brought into the emergency department with severe trauma due to a gunshot wound to the upper right quadrant of his abdomen. He is bleeding profusely and needs an immediate transfusion of blood. Since this is an emergency and there is no time to do a blood typing screen, which blood type can you give this patient? Why can this blood type be used?
What must a buffer solution include in order to resist changes in pH on addition of acid or base?
A buffer must include a mix of weak acid, HA, and its conjugate base, A-, and can only resist small changes in pH +/- 1 of its pKa
Which statement concerning fatty acids is CORRECT?
A fatty acid is the precursor of prostaglandins.
What is a hydropathy plot? Sketch if you like, but label the axes.
A hydropathy plot is a graphical representation of the average "hydropathy" values (tendancy to prefer organic solvents over water) of contiguous groups of amino acid R-groups in a protein. Long hydrophobic sequences are characteristic of integral membrane proteins. Y-axis: "hydropathy index," values between +3 and -3. X-axis: residue number, values between 0 and total number of aa's in the protein.
A hydropathy plot is used to: A) determine the water-solubility of a protein. B) deduce the quaternary structure of a membrane protein. C) determine the water content of a native protein. D) extrapolate for the true molecular weight of a membrane protein. E) predict whether a given protein sequence contains membrane-spanning segments.
A hydropathy plot is used to: E) predict whether a given protein sequence contains membrane-spanning segments.
Which of these statements is generally true of integral membrane proteins?
A hydropathy plot reveals one or more regions with a high hydropathy index.
How does an aldose differ from a ketose?
A ketose has a ketone where an aldose has an aldehyde.
A ligand-gated ion channel (such as the nicotinic acetylcholine receptor) is: A) a charged lipid in the membrane bilayer that allows ions to pass through. B) a membrane protein that permits a ligand to pass through the membrane only when opened by the appropriate ion. C) a membrane protein that permits an ion to pass through the membrane only when opened by the appropriate ligand. D) a molecule that binds to the membrane thereby allowing ions to pass through. E) always requires a second ligand to close the channel once it is opened.
A ligand-gated ion channel (such as the nicotinic acetylcholine receptor) is: C) a membrane protein that permits an ion to pass through the membrane only when opened by the appropriate ligand.
Explain why nonpolar compounds are generally able to diffuse across biological membranes without the aid of a specific transport system.
A nonpolar compound is more soluble in nonpolar solutes, such as benzene or chloroform, than in polar solvents such as water. They generally pass through biological membranes unaided because it is energetically favorable for them to move from the aqueous solvent into the nonpolar region of the bilayer interior.
A) is generally noncovalently bound to membrane lipids.
A peripheral membrane protein: A) is generally noncovalently bound to membrane lipids. B) is usually denatured when released from membranes. C) can be released from membranes only by treatment with detergent(s). D) may have functional units on both sides of the membrane in the same polypeptide. E) penetrates deeply into the lipid bilayer.
A process not involving the fusion of two membranes or two regions of the same membrane is: A) endocytosis. B) entry of enveloped viruses into cells. C) entry of glucose into cells. D) exocytosis. E) reproductive budding in yeast
A process not involving the fusion of two membranes or two regions of the same membrane is: C) entry of glucose into cells.
Describe the structure of a proteoglycan aggregate such as is found in the extracellular matrix.
A proteoglycan aggregate is a supramolecular assembly of proteoglycan monomers. Each monomer consists of a core protein with multiple, covalently linked polysaccharide chains. Hundreds of these monomers can bind noncovalently to a single extended molecule of hyaluronic acid to form large structures.
Which of these statements about facilitated diffusion across a membrane is true?
A specific membrane protein lowers the activation energy for movement of the solute through the membrane.
What is an Epimer in monosaccharides?
A stereoisomer that differs at one chiral center
What is a diastereomer in monosaccharides?
A stereoisomer that differs at two chiral centers
Sketch the principal components of a typical proteoglycan, showing their relationships and connections to one another.
A typical proteoglycan consists of a core protein with covalently attached glycosaminoglycan polysaccharides, such as chondroitin sulfate and keratin sulfate. The polysaccharides generally attach to a serine residue in the protein via a trisaccharide (gal-gal-xyl). (See Fig. 7-24, p. 253.)
What are the chemical components of a biological wax, and what is their general structure?
A wax consists of a long-chain fatty acid in ester linkage with a long-chain fatty alcohol.
Approximately how much of the human genome encodes the exons of protein-coding sequences? A) 1.5% B) 5% C) 30% D) 100% E) 80%
A) 1.5%
What is the abbreviated nomenclature for a 14-carbon omega-3 fatty acid that contains no other double bonds? A) 14:1(Delta 11) B) 17:1(Delta 14) C) 14:1(Delta 3) D) 13:1(Delta 11) E) 14:0(Delta 11)
A) 14:1(Delta 11)
The size of the DNA region specifically recognized by Type II restriction enzymes is typically: A) 4 to 6 base pairs. B) 10 to 15 base pairs. C) 50 to 60 base pairs. D) 200 to 300 base pairs. E) about the size of an average gene.
A) 4 to 6 base pairs.
The size of the DNA region specifically recognized by type II restriction enzymes is typically: A) 4 to 6 base pairs. B) 10 to 15 base pairs. C) 50 to 60 base pairs. D) 200 to 300 base pairs. E) about the size of an average gene
A) 4 to 6 base pairs.
Which vitamin is derived from cholesterol?
A) A B) B12 C) D D) E E) K C
Which of the following is not a fat-soluble vitamin?
A) A B) C C) D D) E E) K B
What is a significant problem with regard to making cDNA libraries to analyze overall gene function in an eukaryotic organism? A) A cDNA library will only contain genes that are actively transcribed in the organism. B) Reverse transcriptase cannot be used to make cDNA libraries. C) cDNA cannot be amplified by PCR. D) cDNA libraries do not contain intron sequences. E) cDNA libraries may contain several alternatively spliced forms of the same gene.
A) A cDNA library will only contain genes that are actively transcribed in the organism.
Which statement concerning fatty acids is CORRECT? A) A fatty acid is the precursor of prostaglandins. B) Phosphatidic acid is a common fatty acid. C) Fatty acids all contain one or more double bonds. D) Fatty acids are a constituent of sterols. E) Fatty acids are strongly hydrophilic.
A) A fatty acid is the precursor of prostaglandins.
Which statement about facilitated diffusion across a membrane is TRUE? A) A specific membrane protein lowers the activation energy for movement of the solute through the membrane. B) It can increase the size of a transmembrane concentration gradient of the diffusing solute. C) It is impeded by the solubility of the transported solute in the nonpolar interior of the lipid bilayer. D) It is responsible for the transport of gases such as O2, N2, and CH4 across biological membranes. E) The rate is not saturable by the transported substrate.
A) A specific membrane protein lowers the activation energy for movement of the solute through the membrane.
Distinguish between simple diffusion (SD), facilitated diffusion (FD), and active transport (AT) across a membrane for the following questions. (More than one may be true, write the abbreviation for each if it applies as a list) (a) Which processes are energy dependent? (b) Which processes need some kind of carrier protein(s)? (c) Which processes require a mostly non-polar molecule? (d) Which processes can establish a concentration gradient?
A) Active Transport B) Active Transport, Facilitated Diffusion C) Simple Diffusion D) Active Transport
Which statement about sterols is TRUE? A) All sterols share a fused-ring structure with four rings. B) Sterols are found in the membranes of all living cells. C) Sterols are soluble in water, but less so in organic solvents such as chloroform. D) Cholesterol is the principal sterol in fungi. E) The principal sterol of animal cells is ergosterol.
A) All sterols share a fused-ring structure with four rings.
Which of the following statements about sterols is true?
A) All sterols share a fused-ring structure with four rings. B) Sterols are found in the membranes of all living cells. C) Sterols are soluble in water, but less so in organic solvents such as chloroform. D) Stigmasterol is the principal sterol in fungi. E) The principal sterol of animal cells is ergosterol. A
Which of the following best describes the cholesterol molecule?
A) Amphipathic B) Nonpolar, charged C) Nonpolar, uncharged D) Polar, charged E) Polar, uncharged A
Which statement describes a distinct difference between membrane lipids in archaea and membrane lipids in eukarya? A) Archaeal membrane lipids have alkyl acids that are ether-linked to glycerol at both ends. B) Eukaryotic membrane lipids consist of glycerol that is ester-linked to three fatty acids. C) Only eukaryotic membrane lipids are amphipathic. D) Archaeal membrane lipids always contain sphingosine. E) Eukaryotic membrane lipids always have a phosphate group attached to glycerol.
A) Archaeal membrane lipids have alkyl acids that are ether-linked to glycerol at both ends.
Which of the following molecules or substances contain, or are derived from, fatty acids?
A) Beeswax B) Prostaglandins C) Sphingolipids D) Triacylglycerols E) All of the above contain or are derived from fatty acids. E
13. From the abbreviated name of the compound Gal(β1 → 4)Glc, we know that: A) C-4 of glucose is joined to C-1 of galactose by a glycosidic bond. B) the compound is a D-enantiomer. C) the galactose residue is at the reducing end. D) the glucose is in its pyranose form. E) the glucose residue is the β anomer.
A) C-4 of glucose is joined to C-1 of galactose by a glycosidic bond.
14. From the abbreviated name of the compound Gal(B1-> 4) Glc, we know that: A) C-4 of glucose is joined to C-1 of galactose by a glycosidic bond. B) the compound is a D-enantiomer. C) the galactose residue is at the reducing end. D) the glucose is in its pyranose form. E) the glucose residue is the anomer.
A) C-4 of glucose is joined to C-1 of galactose by a glycosidic bond.
From the abbreviated name of the compound Gal(β1 → 4)Glc, we know that: A) C-4 of glucose is joined to C-1 of galactose by a glycosidic bond. B) the compound is a D-enantiomer. C) the galactose residue is at the reducing end. D) the glucose is in its pyranose form. E) the glucose residue is the β anomer.
A) C-4 of glucose is joined to C-1 of galactose by a glycosidic bond.
From the abbreviated name of the compound Gal(β1 → 4)Glc, we know that: A) C-4 of glucose is joined to C-1 of galactose by a glycosidic bond. B) the compound is a D-enantiomer. C) the galactose residue is at the reducing end. D) the glucose is in its pyranose form. E) the glucose residue is the β anomer.
A) C-4 of glucose is joined to C-1 of galactose by a glycosidic bond.
42. D-Allose is an aldohexose. Methylation of which hydroxyl group on β-D-allopyranose prevents the molecule from mutarotating to α-D-allopyranose? A) C1 B) C2 C) C3 D) C4 E) C5
A) C1
Which of the following contains an ether-linked alkyl group?
A) Cerebrosides B) Gangliosides C) Phosphatidyl serine D) Platelet-activating factor E) Sphingomyelin D
Which statement is TRUE of sphingolipids? A) Cerebrosides and gangliosides are sphingolipids. B) Phosphatidylcholine is a typical sphingolipid. C) They always contain glycerol and fatty acids. D) They contain two esterified fatty acids. E) They may be charged, but are never amphipathic.
A) Cerebrosides and gangliosides are sphingolipids.
Which of the following is true of sphingolipids
A) Cerebrosides and gangliosides are sphingolipids. B) Phosphatidylcholine is a typical sphingolipid. C) They always contain glycerol and fatty acids. D) They contain two esterified fatty acids. E) They may be charged, but are never amphipathic. A
Which of the following is not true of sterols?
A) Cholesterol is a sterol that is commonly found in mammals. B) They are commonly found in bacterial membranes. C) They are more common in plasma membranes than in intracellular membranes (mitochondria, lysosomes, etc.). D) They are precursors of steroid hormones. E) They have a structure that includes four fused rings. B
47. Which statement about free glucose storage is FALSE? A) Glucose is insoluble and cannot contribute to the osmotic balance of the cell. B) Glycogen has an intracellular concentration of 0.1uM, equivalent to a glucose concentration of 0.4 M. C) The free energy difference between intra- and extracellular free glucose would be difficult to overcome for glucose uptake by the cell. D) The concentration gradient of intra- and extracellular glucose would be prohibitively large. E) All statements are true.
A) Glucose is insoluble and cannot contribute to the osmotic balance of the cell
Which of the following statements about membrane lipids is true?
A) Glycerophospholipids are found only in the membranes of plant cells. B) Glycerophospholipids contain fatty acids linked to glycerol through amide bonds. C) Lecithin (phosphatidylcholine), which is used as an emulsifier in margarine and chocolate, is a sphingolipid. D) Some sphingolipids include oligosaccharides in their structure. E) Triacylglycerols are the principal components of erythrocyte membranes D
Which statement about the composition of biological membranes is FALSE? A) In a given eukaryotic cell type (e.g., a hepatocyte), all intracellular membranes have essentially the same complement of lipids and proteins. B) The carbohydrate found in membranes is virtually all part of either glycolipids or glycoproteins. C) The plasma membranes of the cells of vertebrate animals contain more cholesterol than the mitochondrial membranes. D) The ratio of lipid to protein varies widely among cell types in a single organism. E) Triacylglycerols are not commonly found in membranes.
A) In a given eukaryotic cell type (e.g., a hepatocyte), all intracellular membranes have essentially the same complement of lipids and proteins
Which statement describes a general feature of the lipid bilayer in all biological membranes? A) Individual lipid molecules are free to diffuse laterally in the surface of the bilayer. B) Individual lipid molecules in one face (monolayer) of the bilayer readily diffuse (flip-flop) to the other monolayer. C) Polar, but uncharged, compounds readily diffuse across the bilayer. D) The bilayer is stabilized by covalent bonds between neighboring phospholipid molecules. E) The polar head groups face inward toward the inside of the bilayer.
A) Individual lipid molecules are free to diffuse laterally in the surface of the bilayer.
Which of the following statements is true of lipids?
A) Many contain fatty acids in ester or amide linkage. B) Most are simply polymers of isoprene. C) Testosterone is an important sphingolipid found in myelin. D) They are more soluble in water than in chloroform. E) They play only passive roles as energy-storage molecules. B
Membrane lipids in tissue samples obtained from different parts of the leg of an arctic reindeer have different fatty acid compositions. Logically, what difference would you predict? A) Membrane lipids from tissue near the hooves (feet) contain a greater proportion of unsaturated fatty acids relative to that in the upper leg. B) Membrane lipids from tissue in the upper leg contain a greater proportion of unsaturated fatty acids relative to that in the hooves (feet). C) Both answers A and B are equally likely. D) Neither answer A nor B is likely.
A) Membrane lipids from tissue near the hooves (feet) contain a greater proportion of unsaturated fatty acids relative to that in the upper leg.
Which of the following statements concerning fatty acids is correct?
A) One is the precursor of prostaglandins. B) Phosphatidic acid is a common one. C) They all contain one or more double bonds. D) They are a constituent of sterols. E) They are strongly hydrophilic. A
7. A) List and explain the function of the ingredients required for a PCR reaction. B) Describe the steps of each cycle of PCR. (C) What are the two 5 nucleotides primers required to amplify the following dsDNA between the two sets of the ^ marks? (6%) 5'CATGC^GCATG------------------------------------------------------GCCGT^AATGC3' 3'GTACG^CGTAC-------------------------------------------------------CGGCA^TTACG5'
A) PCR reactions need a template DNA molecule containing a region to be amplified, synthetic DNA oligonucleotide primers to serve as the starting point for DNA polymerase to extend the template, dNTPs that serve as the raw materials to be added to the growing nucleotide chains and the energy for the reaction, and a thermostable DNA polymerase to catalyze 5¢ to 3¢ DNA synthesis. B) Step 1: Template denaturation is done at a high temperature; Step 2: the temperature of the reaction is lowered for primers to anneal to the template DNA; Step 3: the temperature is raised to the optimum temperature for the Taq (or other thermostable) DNA polymerase to catalyze DNA synthesis. (C) 5' GCATG3' and 5'ACGGC3'
Which statement is TRUE for passive transport across a biological membrane? A) Passive transport is driven by a solute electrochemical gradient. B) Passive transport is driven by ATP. C) Passive transport is irreversible. D) Passive transport is driven by both a solute electrochemical gradient ATP. E) Passive transport is driven by a solute electrochemical gradient and is irreversible.
A) Passive transport is driven by a solute electrochemical gradient.
Which statement does NOT describe a process by which the specificity of aquaporins is ensured? A) The channel contains a negatively charged Asp residue to scavenge protons and H3O+. B) The diameter of the channel narrows to 2.8 Å. C) There are carbonyl backbone residues in the channel that hydrogen bond with water. D) Arg and His residues in the channel repel protons and H3O+. E) Electric dipoles of short a helices repel protons and H3O+
A) The channel contains a negatively charged Asp residue to scavenge protons and H3O+.
Which statement BEST describes how the volatility of lipids is increased for analysis by gas chromatography? A) The lipids are transesterified to convert fatty acids into fatty acid methyl esters. B) The lipids are cleaved with phospholipase enzymes . C) The lipids are degraded by treatment with mild acid or base. D) The lipids are dissolved in chloroform. E) The lipids are desaturated by reaction with a platinum catalyst.
A) The lipids are transesterified to convert fatty acids into fatty acid methyl esters.
Which statement is generally TRUE of integral membrane proteins? A) The secondary structure in the transmembrane region consists solely of a helices or b sheets. B) The domains that protrude on the cytoplasmic face of the plasma membrane nearly always have covalently attached oligosaccharides. C) They are unusually susceptible to degradation by trypsin. D) They can be removed from the membrane with high salt or mild denaturing agents. E) They undergo constant rotational motion that moves a given domain from the outer face of a membrane to the inner face and then back to the outer.
A) The secondary structure in the transmembrane region consists solely of a helices or b sheets.
Which statement is FALSE regarding the major facilitator superfamily of transporters? A) These proteins are all secondary active transporters. B) Both GLUT1 and lactose permease belong to this family. C) These proteins contain two domains within the membrane. D) These proteins contain 12 or 14 transmembrane a helices
A) These proteins are all secondary active transporters.
Syndecans are proteoglycans that have glycosaminoglycans attached to the N-terminal domain, a single transmembrane helix and a C-terminal domain that can be phosphorylated. What type of membrane proteins are these? A) Type I B) Type II C) Type III D) Type IV E) Type V
A) Type I
Which of the following techniques is not commonly used to study oligosaccharide structures? A) X-ray crystallography B) Matrix-assisted laser desorption/ionization mass spectroscopy (MALDI-MS) C) Nuclear magnetic resonance (NMR) D) Complete chemical synthesis E) Oligosaccharide microarrays
A) X-ray crystallography
A method of comparing the relative gene expression of all the genes in an organism at two different stages of its development is: A) a DNA microarray. B) yeast two-hybrid analysis. C) tandem affinity purification. D) immunofluorescence. E) quantitiative PCR.
A) a DNA microarray.
Which method of visualizing a protein's location should you use if you want to determine its location in a living cell? A) a GFP fusion tag B) immunofluorescence C) qPCR D) Gram stain E) affinity purification
A) a GFP fusion tag
Which term BEST describes the cholesterol molecule? A) amphipathic B) nonpolar, charged C) nonpolar, uncharged D) polar, charged E) polar, uncharged
A) amphipathic
An example of a glycerophospholipid that is involved in cell signaling is
A) arachidonic acid. B) ceramide. C) phosphatidylinositol. D) testosterone. E) vitamin A (retinol). C
Peripheral membrane proteins: A) are generally noncovalently bound to membrane lipids. B) are usually denatured when released from membranes. C) can be released from membranes only by treatment with detergent(s). D) may have functional units on both sides of the membrane. E) penetrate deeply into the lipid bilayer.
A) are generally noncovalently bound to membrane lipids.
38. The sialic acids A) are important constituents of glycoproteins and glycolipids. B) are N-acetyl glucosamine derivatives. C) incorporate a succinic acid derivative. D) all of the above E) none of the above
A) are important constituents of glycoproteins and glycolipids.
18. In glycoproteins, the carbohydrate moiety is always attached through the amino acid residues: A) asparagine, serine, or threonine. B) aspartate or glutamate. C) glutamine or arginine. D) glycine, alanine, or aspartate. E) tryptophan, aspartate, or cysteine.
A) asparagine, serine, or threonine.
In glycoproteins, the carbohydrate moiety is always attached through the amino acid residues: A) asparagine, serine, or threonine. B) aspartate or glutamate. C) glutamine or arginine. D) glycine, alanine, or aspartate. E) tryptophan, aspartate, or cysteine.
A) asparagine, serine, or threonine.
Sphingosine is NOT a component of: A) cardiolipin. B) ceramide. C) cerebrosides. D) gangliosides. E) sphingomyelin.
A) cardiolipin.
Sphingosine is not a component of:
A) cardiolipin. B) ceramide. C) cerebrosides. D) gangliosides. E) sphingomyelin. A
Fatty acids are a component of
A) carotenes. B) cerebrosides. C) sterols. D) vitamin D. E) vitamin K. B
47. Which of the following polysaccharides cannot be digested by mammalian salivary, gastric, or pancreatic enzymes? A) cellulose B) amylopectin C) amylose D) glycogen E) starch
A) cellulose
Bile acids are derived from which lipid? A) cholesterol B) sphingomyelin C) ceramide D) digalactosyldiacylglycerol E) phosphatidylcholine
A) cholesterol
52. In amylose, the most stable structure is a _____, which is stabilized by _____. A) coiled helix- interchain hydrogen bonds B) coiled helix- interchain covalent branching C) coiled helix- hydrogen bonds to surrounding water molecules D) straight, extended chain- interchain hydrogen bonds E) straight, extended chain- hydrogen bonds to surrounding water molecules
A) coiled helix- interchain hydrogen bonds
The specificity of the potassium channel for K+ over Na+ is mainly the result of the: A) differential interaction with the selectivity filter protein. B) hydrophobicity of the channel. C) phospholipid composition of the channel. D) presence of carbohydrates in the channel. E) presence of cholesterol in the channel.
A) differential interaction with the selectivity filter protein.
Facilitated diffusion through a biological membrane is: A) driven by a difference of solute concentration. B) driven by ATP. C) endergonic. D) generally irreversible. E) not specific with respect to the substrate
A) driven by a difference of solute concentration.
Which technique is NOT used to make a cDNA library? A) extraction of DNA from the organism you are studying B) extraction of mRNA from the organism you are studying C) use of reverse transcriptase to copy RNA into DNA D) ligation of DNA into a cloning vector E) insertion of a cloning vector into cells
A) extraction of DNA from the organism you are studying
Tay-Sachs disease is the result of a genetic defect in the metabolism of: A) gangliosides. B) phosphatidyl ethanolamine. C) sterols. D) triacylglycerols. E) vitamin D.
A) gangliosides.
Tay-Sachs disease is the result of a genetic defect in the metabolism of
A) gangliosides. B) phosphatidyl ethanolamine. C) sterols. D) triacylglycerols. E) vitamin D. A
Which technique would you NOT use to separate and/or analyze lipids in a laboratory? A) gel electrophoresis B) thin-layer chromatography C) adsorption chromatography D) mass spectrometry E) high-performance liquid chromatography (HPLC)
A) gel electrophoresis
Which compound is NOT needed to build a cDNA library? A) genomic DNA B) mRNA C) reverse transcriptase D) dNTPs E) DNA polymerase
A) genomic DNA
63. Several types of human joint and skeletal defects are a result of a defect in a biosynthetic enzyme responsible for synthesis of: A) glycosaminoglycans. B) glycoproteins. C) glycolipids. D) lipopolysaccharides. E) glycosphingolipids.
A) glycosaminoglycans
Conserved gene order observed in the chromosomes of two distantly related organisms provides evidence of a(n) _____ relationship between genes. A) orthologous B) homologous C) paralogous D) analogous E) genologous
A) orthologous
A(n) _____ would NOT used as a heterologous host for the expression of recombinant proteins/ A) retrovirus B) bacterium such as E. coli C) eukaryote such as S. cerevisiae D) insect cell E) mammalian cell
A) retrovirus
Which factor MOST significantly determines the direction in which an ion moves through an ion channel in a membrane? A) the electrochemical gradient across the membrane B) the size and shape of the channel C) the ion selectivity of the channel. D) both the electrochemical gradient across the membrane and the size and shape of the channel E) both the size and shape of the channel and the ion selectivity of the channel
A) the electrochemical gradient across the membrane
If you want to determine which proteins might be interacting in a cell, which technique would you use to examine the interaction in a living cell? A) yeast two-hybrid analysis B) immunoprecipitation C) a DNA microarray D) immunofluorescence E) comparative genomics
A) yeast two-hybrid analysis
54. Starch is a mixture of A) α-amylose and amylopectin. B) glycogen and amylopectin. C) glycogen and α-amylose. D) glycogen and cellulose. E) α-amylose and maltose.
A) α-amylose and amylopectin.
Sphingolipids can contain of all of the following except?
A)glycerol. B) sphingosine. C) phosphate. D) a mono- or oligosaccharide. A
34. Which arrow CORRECTLY identifies the atom that will become the anomeric carbon? H-C=O A) A B) B C) C D) D E) E
A. "C" in H-C=O
(a) What kinds of forces or bonds anchor an integral membrane protein in a biological membrane? (b) What forces hold a peripheral membrane protein to the membrane? (c) What might one do to solubilize each of the two types of membrane proteins?
A. Hydrophobic interactions between hydrophobic domans of the protein and the fatty acid of the bilayer b. hydrogen bonds between charged and polar side chains c. use detergents,convdrting membranes to micelles
These three have high melting temperatures
A: 18:1 B: 18:0 C: 18:0
According to the current model for HIV infection, which of the following is not involved in the process of membrane fusion? A) A cell surface co-receptor protein B) A cell surface receptor protein C) A viral glycoprotein complex D) The viral chromosome E) The viral envelope
According to the current model for HIV infection, which of the following is not involved in the process of membrane fusion? D) The viral chromosome
55. A solution of the heteropolysaccharide _____ can be heated and cooled to form a three-dimensional matrix that traps water and supports the electrophoretic separation of nucleic acids. A) dextrose B) Agarose C) glycosaminoglycans D) amylose E) Cellulose
Agarose
Describe aldonic acids, uronic acids, alditols, deoxy sugars, and amino sugars. (all types of sugar modifications)
Aldonic Acid: Oxidizing aldehyde group to a carboxylic acid group on aldose Uronic Acid: Oxidizing primary alcohol group on aldose (at the terminal carbon) Alditols: Reducing aldoses and ketoses under mild conditions (mostly aldoses) Deoxy Sugars: Monosaccharide units with an OH group replaced by H. (instead of an interior carbon being bound to an -OH and an -H, its just bound to two -H's) Amino Sugars: One or more OH groups replaced by amino group, often acetylated. (-NH2 instead of -OH)
30. In a(n) _____ the carbonyl group is at the end of the carbon chain, but in a(n) _____ the carbonyl group can be at any other position. A) Aldose- ketose B) Ketose- aldose C) Hexose- heptose D) Aldose- hexose E) Ketose- tetrose
Aldose- ketose
38. Which modification CANNOT be made to a sugar molecule by an organism? A) oxidation of the carbonyl carbon B) replacing a hydroxyl group with an amino group C) oxidizing a carbon atom to a carboxyl group D) replacing a hydroxyl group with a hydrogen atom. E) All of the answer choices are possible sugar derivatives.
All of the answer choices are possible sugar derivatives
61. Which type of protein interaction is NOT one with the NS domains of heparan sulfate? A) conformational activation B) cell-surface localization/concentration C) enhanced protein-protein interaction D) binding extracellular signaling molecules E) All of the answer choices are types of protein interaction with heparan sulfate.
All of the answer choices are types of protein interaction with heparan sulfate
66. Under what circumstance might an organism's patterns of glycosylation NOT be altered? A) development B) genetic diseases C) cancer D) cell differentiation E) All of the answers are correct.
All of the answers are correct
73. The antiviral drugs oseltamivir (Tamiflu) and zanamivir (Relenza) do NOT work by: A) inhibiting the viral enzyme that trims the host cell's oligosaccharides. B) causing the viral particles to aggregate. C) competing with the host cell's oligosaccharides for binding. D) preventing the release of viruses from the infected cell. E) All of the answers are correct.
All of the answers are correct
43. Polysaccharides CANNOT be used by cells: A) as fuel storage molecules. B) for structural elements in cell walls. C) for structural elements in animal exoskeletons. D) for the extracellular matrix in animal cells. E) All of the answers are correct.
All of the answers are correct.
Membrane proteins: A) are sometimes covalently attached to lipid moieties. B) are sometimes covalently attached to carbohydrate moieties. C) are composed of the same 20 amino acids found in soluble proteins. D) diffuse laterally in the membrane unless they are anchored E) All of the answers are correct.
All of the answers are correct.
39. Which statement is NOT true regarding phosphorylated sugar? A) It is trapped inside the cell membrane. B) It is relatively stable at neutral pH. C) It is activated for subsequent chemical transformation D) It can be a component of a nucleotide. E) All of the statements are true.
All of the statements are true
Which molecules or substances contain, or are derived from, fatty acids?
All of these contain or are derived from fatty acids.
Which positions in the purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?
All purine ring nitrogens (N-1, N-3, N-7, and N-9) have the potential to form hydrogen bonds (see Figs 8-1, 8-11, and 2-3). However, N-1 is involved in Watson-Crick hydrogen bonding with a pyrimidine, and N-9 is involved in the N-glycosyl linkage with deoxyribose and has very limited hydrogen-bonding capacity. Thus, N-3 and N-7 are available to form further hydrogen bonds.
Which statement about sterols is TRUE?
All sterols share a fused-ring structure with four rings.
What are the similarities and differences between integrins, cadherins, and selectins?
All three are families of integral membrane proteins that are involved in cell adhesion. Integrins mediate cell adhesion to proteins of the extracellular matrix. Cadherins and selectins mediate cell-cell adhesion the former by interaction with cadherins on the surface of other cells, the latter by interaction with polysaccharides on the surface of other cells.
What is an anomer in monosaccharides?
Alpha and Beta versions of hawthorn projections are anomers of each other
1. Describe two process that allows a single gene to yield different peptides during RNA processing
Alternative splicing and Poly-A site choice
Explain why a sugar can form at least two different glycosides.
Amino sugars are frequently subject to further modifications such as acetylation at the NH2 moiety so as to generate the corresponding acetyl sugar.
Which of the following best describes the cholesterol molecule?
Amphipathic
Phospholipids are amphipathic molecules. Show how this property accounts for the impermeability of biological membranes to polar compounds and ions.
Amphipathic molecules, with both hydrophobic and hydrophilic domains, when placed in water tend to arrange themselves in a way that minimizes contact of their hydrophobic domains with water. One structure that accomplishes this is the lipid bilayer where hydrophobic fatty acyl chains point toward the center of the bilayer, forming a hydrophobic layer about 3 nm thick with the polarity of hexane. This lipid bilayer is impermeable to polar and charged compounds because it is energetically costly for these compounds to give up their favorable interactions with the polar solvent water and to dissolve in the lipid bilayer.
Polysaccharides that are digested by mammalian salivary, gastric, or pancreatic enzymes?
Amylopectin, amylose, glycogen, and starch
What is an amphipathic compound? Explain how such compounds contribute to the structure of biological membranes.
An amphipathic compound has one region or domain that is hydrophilic and another that is hydrophobic. When added to water, amphipathic compounds tend to arrange in a way that exposes their hydrophilic regions to the solvent and hides their hydrophobic domains. One structure that accomplishes this is the lipid bilayer, which forms spontaneously with phospholipids in water.
An electrogenic Na+ transporter: A) catalyzes facilitated diffusion of Na+ from a region of high Na+ concentration to one of lower Na+ concentration. B) must catalyze an electron transfer (oxidation-reduction) reaction simultaneously with Na+ transport. C) must transport both Na+ and a counterion (Cl-, for example). D) transports Na+ against its concentration gradient. E) transports Na+ without concurrent transport of any other charged species.
An electrogenic Na+ transporter: E) transports Na+ without concurrent transport of any other charged species.
An integral membrane protein can be extracted with: A) a buffer of alkaline or acid pH. B) a chelating agent that removes divalent cations. C) a solution containing detergent. D) a solution of high ionic strength. E) hot water.
An integral membrane protein can be extracted with: C) a solution containing detergent.
How can alsodes and ketoses from 6-membered (pyranose) and 5-membered (furanose) rings?
An intramolecular nucleophilic attack of hydroxyl O atom on carbonyl C atom froming a hemiacetal or heiketal group within the cyclic rings
What is the difference between an alpha and beta anomer on a Hawarth projection?
Anomers are a special class of epimers involving the stereochemical configuration only at the anomeric C atom (old carbonyl C). Alpha anomer lies below the plane opposite of CH2OH; Beta lies above on the same side of CH2OH a-D-glucopyranose and a-L-glucopyranose are enantiomers
a) What is meant by the transition temperature of a membrane? List the two characteristics of the fatty acids in a biological membrane that affect the transition temperature. Using or , show in which direction an increase in these characteristics would change the transition temperature.
Ans. (a) the transition temperature of a membrane is the temperature at which its structure changes from a paracyrstalline solid to a liquid state. (b) The two characteristics of of fatty acids that directly affect Tt are degree of unsaturation (down) and chain length (up).
The pitch of an alpha helix is 5.4 A per turn, and there are 3.6 amino acid residues per turn. If the thickness of the lipid bilayer is 30 A, how many amino acid residues are required in an alpha helix that is just long enough to span the lipid bilayer?
Ans. If the pitch is 5.4 A/turn and there are 3.6 residues per turn, then each residue lengthens the helix by 5.4/ 3.6 = 1.5 A/residue. Dividing 30 A by 1.5 A/residue gives a value of 20 residues necessary to span the lipid bilayer.
Draw a hydropathy plot for a hypothetical integral membrane protein with 3 transmembrane segments and containing 190 amino acids. Be sure to label the x- and y-axes appropriately, including numerical values.
Ans. The plot should have a y-axis that is labeled "hydropathy index" and an x-axis that is labeled "residue number" or "position in the protein." The y-axis should have values from + 3 to - 3; the x-axis should have an integral number that has a range of zero to several hundred. The plot should show three distinct peaks corresponding to the 3 transmembrane segments.
Glycosphingolipids and cholesterol cluster together in membrane regions known as "__________". These microdomains are more __________ than the surrounding phospholipid-rich membrane due to a high content of __________ fatty acids. These regions are rich in proteins that are anchored to the membrane by covalently attached __________ and __________ groups and also those anchored by GPI linkage. Proteins aggregated in this fashion are often functionally related. Examples are (1) __________ proteins and (2) __________ proteins.
Ans: "rafts", ordered, saturated, myristoyl, palmitoyl, receptor, signaling.
What chemical features distinguish a plasmalogen from a common glycerophospholipid?
Ans: (1) The long-chain acyl group attached to C-1 of glycerol is ether-linked in a plasmalogen, but is an ester-linked fatty acyl group in typical glycerophospholipids. (2) There is a double bond between C-1 and C-2 of this fatty acyl chain in plasmalogens, but not in other phospholipids. (See Fig. 10-10, p. 351.)
What are three differences between ion channels and ion transporters?
Ans: (1) The rate of ion movement through channels is much greater; (2) ion transporters exhibit saturation, whereas ion channels do not; (3) ion channels open and close in response to external stimuli or events such as ligand-binding or changes in electrical potential across the membrane.
Circle the fatty acid in each pair that has the higher melting temperature. (a) 18:19 18:29,12 (b) 18:0 18:19 (c) 18:0 16:0
Ans: (a) 18:19 (b) 18:0 (c) 18:0
In the following structure: (a) How many of the monosaccharide units are furanoses and how many are pyranoses? (b) What is the linkage between the two monosaccharide units? (c) Is this a reducing sugar? Explain.
Ans: (a) 2 pyranoses; (b) β1 → 4; (c) Yes. There is a free anomeric carbon on one of the monosaccharide units that can undergo oxidation.
(a) Define "reducing sugar." (b) Sucrose is a disaccharide composed of glucose and fructose (Glc(α1 → 2)Fru). Explain why sucrose is not a reducing sugar, even though both glucose and fructose are.
Ans: (a) A reducing sugar is one with a free carbonyl carbon that can be oxidized by Cu2+ or Fe3+. (b) The carbonyl carbon is C-1 of glucose and C-2 of fructose. When the carbonyl carbon is involved in a glycosidic linkage, it is no longer accessible to oxidizing agents. In sucrose (Glc(α1 → 2)Fru), both oxidizable carbons are involved in the glycosidic linkage.
Distinguish between simple diffusion (SD), facilitated diffusion (FD), and active transport (AT) across a membrane for the following questions (more than one may be true). (a) Which processes are energy dependent? (b) Which processes need some kind of carrier protein(s)? (c) Which processes can be saturated by substrate? (d) Which processes can establish a concentration gradient? (e) How much energy does it take to transport an uncharged substrate in, if its starting inside concentration is 10-fold greater than outside?
Ans: (a) AT only; (b) FD and AT; (c) FD and AT; (d) AT only; (e) 5.7 kJoules/mole
(a) Define the term amphipathic. (b) Diagram two types of assemblies that amphipathic molecules form in water. (c) What are the forces that contribute to the formation of the structures diagrammed in (b)?
Ans: (a) Amphipathic means having one region that is polar and another that is nonpolar. (b) The two common structures formed by lipids in water are micelles and bilayers. (See Fig. 11-4, p. 374.) (c) These lipid aggregates in water are stabilized by the energy gain from burying hydrophobic groups out of contact with water. When a hydrophobic chain is surrounded by water, it forces the formation of a cage of immobilized water molecules around it. When several hydrophobic regions cluster, the surface area exposed to water decreases, and the water molecules in the cage are released, with a gain in entropy that drives the formation of the lipid aggregates.
(a) Draw the structure of any aldohexose in the pyranose ring form. (b) Draw the structure of the anomer of the aldohexose you drew above. (c) How many asymmetric carbons (chiral centers) does each of these structures have? (d) How many stereoisomers of the aldohexoses you drew are theoretically possible?
Ans: (a) Any of the hexoses drawn with a six-membered ring, as shown in Fig. 7-7 on p. 239, is correct. The hydroxyls at C-2, C-3, and C-4 can point either up or down. (b) For the anomer, the structure should be identical to the first, except that the hydroxyl group at C-1 should point up if it pointed down in your first structure, and vice versa. (c) The number of chiral centers is 5; all are carbons except C-6. (d) The number of possible stereoisomers for a compound with n chiral centers is 2n; in this case, 25, or 32 possible isomers.
You are presented with a gram of a newly isolated animal virus. Electron microscopy reveals the presence of a typical membrane surrounding the virus, and chemical analysis shows the presence of two membrane lipids, phosphatidylethanolamine and phosphatidylserine, as well as several membrane-associated proteins. Describe briefly a simple experimental approach to answering each of the following questions: (a) Which proteins are exposed at the outer surface and which traverse the membrane, with parts of their structure in the cytoplasm and parts outside the cell? (b) Are the phosphatidylethanolamine and phosphatidylserine symmetrically disposed in the two faces of the bilayer?
Ans: (a) Briefly, two radiolabeled reagents, each of which reacts with primary amines, are used to label proteins in the intact cell. One of the reagents penetrates the plasma membrane readily and is therefore able to label intracellular domains of membrane proteins as well as their extracellular domains. The other reagent is impermeant and can label only domains on the outer face. By carefully assessing which membrane proteins are labeled by which reagent, one can determine which of them has extracellular domains and which has intracellular domains. (b) The same basic procedure can be used to label lipids, such as phosphatidylserine and phosphatidylethanolamine, which contain primary amino groups, and thus to determine their location in the membrane.
Draw the structure of the repeating basic unit of (a) amylose and (b) cellulose.
Ans: (a) For the structure of amylose, see Fig. 7-14a, p. 245. The repeating unit is α-D-glucose linked to α-D-glucose; the glycosidic bond is therefore (α1 → 4). (b) Cellulose has the same structure as amylose, except that the repeating units are β-D-glucose and the glycosidic bond is (β1 → 4). (See Fig. 7-15a, p. 246.)
(a) Draw the structures of both anomers of glucose in the pyranose ring form. (b) How many asymmetric carbons (chiral centers) does each of these structures have? (c) How many stereoisomers of the glucose are theoretically possible?
Ans: (a) See Fig. 7-7. (b) The number of chiral centers is 5; all the carbons except C-6. (c) The number of possible stereoisomers for a compound with n chiral centers is 2n; in this case, 25, or 32 possible isomers.
Define each in 20 words or fewer: (a) anomeric carbon (b) enantiomers (c) furanose (d) pyranose (e) glycoside (f) epimers (g) aldose (h) ketose
Ans: (a) The anomeric carbon is the carbonyl carbon atom of a sugar, which is involved in ring formation. Once the anomeric carbon is involved in a glycosidic bond it is the only carbon with more than one oxygen. (b) Enantiomers are stereoisomers that are nonsuperimposable mirror images of each other. (c) Furanose is a sugar with a five-membered ring. (d) Pyranose is a sugar with a six- membered ring. (e) A glycoside is an acetal formed between a sugar anomeric carbon hemi-acetal and an alcohol, which may be part of a second sugar. (f) Epimers are stereoisomers differing in configuration at only one asymmetric carbon. (g) An aldose is a sugar with an aldehyde carbonyl group. (h) A ketose is a sugar with a ketone carbonyl group.
(a) What kinds of forces or bonds anchor an integral membrane protein in a biological membrane? (b) What forces hold a peripheral membrane protein to the membrane? (c) What might one do to solubilize each of the two types of membrane proteins?
Ans: (a) The forces that hold integral membrane proteins in the membrane are hydrophobic interactions between hydrophobic domains of the protein and the fatty acyl chains of the bilayer interior. (b) Peripheral membrane proteins associate with membranes primarily through ionic interactions and hydrogen bonds between charged and polar side chains of the protein and polar head groups of membrane lipids. Some peripheral membrane proteins contain a covalently bound lipid that anchors them to the bilayer. (c) To remove integral membrane proteins, it is generally necessary to use detergents, which convert membranes into "soluble" micelles. Peripheral membrane proteins can often be released by extraction with buffers of high or low salt concentration, high or low pH, or low concentrations of divalent cations.
In cells, fatty acids are stored as triacylglycerols for energy reserves. (a) What is the molecule to which fatty acids are esterified to form triacylglycerols? (b) Define the logic behind cells storing fatty acids in esterified form.
Ans: (a) Three fatty acids are esterified to glycerol. (b) Triacylglycerols are uncharged and insoluble in water. They form lipid droplets within adipocytes, which do not contribute to the osmolarity of the cytosol in those cells, and do not require any water of hydration.
(a) When relatively high concentrations of fatty acids are suspended in water, they form structures known as ________. (b) When relatively high concentrations of membrane phospholipids are dissolved in water, they form structures known as ________. (c) Why are the structures listed in your answers to (a) and (b) above energetically favored?
Ans: (a) micelles. (b) bilayers. (c) Micelles are favored when the polar head group has a greater cross-sectional area than the nonpolar acyl chain, making the molecule wedge-shaped; bilayers are favored when the cross-sectional area of head group and acyl chain(s) are about the same, so that the molecule is cylindrical. (See Fig. 11-4, p. 374.)
(a) List the major components of membranes. (b) When a preparation of mitochondrial membranes was treated with high salt (0.5 M NaCl), it was observed that 40% of the total protein in this preparation was solubilized. What kind of membrane proteins are in this soluble extract, and what forces normally hold them to the membrane? (c) What kind of proteins constitute the insoluble 60%, and what forces hold these proteins in the membrane?
Ans: (a) phospholipids, sterols, proteins (integral and peripheral); (b) peripheral membrane proteins, which are associated with the membrane through ionic and hydrogen bonds between their charged and polar side chains and the charged head groups of phospholipids; (c) integral membrane proteins (which are held to the membrane by hydrophobic interactions between their nonpolar side chains and the hydrophobic fatty acyl chains of phospholipids), and those peripheral membrane proteins that are held to the membrane by a covalent lipid anchor.
(a) Explain why phosphoglycerides are capable of spontaneously assembling into the bilayer structure found in biological membranes but triacylglycerols are not. (b) What are the forces that drive bilayer formation?
Ans: (a): Triacylglycerols have three fatty acyl groups in ester linkage with glycerol; they are very hydrophobic because the carboxyl groups, which are involved in the ester linkages, cannot ionize. Phosphoglycerides have a polar region at their head group, where a phosphate in a phosphodiester linkage bears a full negative charge. The head group itself (serine, ethanolamine, choline, etc.) may also be charged and is polar in any case. Thus, the phospholipid is amphipathic, having both polar and nonpolar regions, and it forms lipid bilayers spontaneously in water. (b) These lipid bilayers are stabilized by the energy gained from burying hydrophobic groups out of contact with water. A hydrophobic chain in water forces the formation of a cage of immobilized water molecules around it. When several hydrophobic regions cluster in a bilayer, the surface area exposed to water decreases, and the water molecules in the cage are released, accompanied by a gain in entropy that drives the formation of the bilayer.
Storage Lipids Pages: 357-359 Difficulty: 2 Which of the following statements concerning fatty acids is correct? A. A fatty acid is the precursor of prostaglandins. B. Phosphatidic acid is a common fatty acid. C. Fatty acids all contain one or more double bonds. D. Fatty acids are a constituent of sterols. E. Fatty acids are strongly hydrophilic.
Ans: A A. A fatty acid is the precursor of prostaglandins.
Structural lipids in membranes Pages: 368-370 Difficulty: 2 Which of the following statements about sterols is true? A. All sterols share a fused-ring structure with four rings. B. Sterols are found in the membranes of all living cells. C. Sterols are soluble in water, but less so in organic solvents such as chloroform. D. Cholesterol is the principal sterol in fungi. E. The principal sterol of animal cells is ergosterol.
Ans: A A. All sterols share a fused-ring structure with four rings.
Structural lipids in membranes Page: 368 Difficulty: 2 Which of the following best describes the cholesterol molecule? A. Amphipathic B. Nonpolar, charged C. Nonpolar, uncharged D. Polar, charged E. Polar, uncharged
Ans: A A. Amphipathic
Structural lipids in membranes Pages: 366-367 Difficulty: 2 Which of the following is true of sphingolipids? A. Cerebrosides and gangliosides are sphingolipids. B. Phosphatidylcholine is a typical sphingolipid. C. They always contain glycerol and fatty acids. D. They contain two esterified fatty acids. E. They may be charged, but are never amphipathic.
Ans: A A. Cerebrosides and gangliosides are sphingolipids.
Structural lipids in membranes Pages: 362-363 Difficulty: 2 Sphingosine is not a component of: A. cardiolipin. B. ceramide. C. cerebrosides. D. gangliosides. E. sphingomyelin.
Ans: A A. cardiolipin.
Structural lipids in membranes Page: 369 Difficulty: 2 Tay-Sachs disease is the result of a genetic defect in the metabolism of: A. gangliosides. B. phosphatidyl ethanolamine. C. sterols. D. triacylglycerols. E. vitamin D.
Ans: A A. gangliosides.
What chemical features distinguish a cerebroside from a ganglioside?
Ans: A cerebroside has a single sugar residue joined to ceramide; a ganglioside has an oligosaccharide joined to ceramide. (See Fig. 10-13, p. 353.)
What is a hydropathy plot? Sketch if you like, but label the axes.
Ans: A hydropathy plot is a graphical representation of the average "hydropathy" values (tendancy to prefer organic solvents over water) of contiguous groups of amino acid R-groups in a protein. Long hydrophobic sequences are characteristic of integral membrane proteins. Y-axis: "hydropathy index," values between +3 and -3. X-axis: residue number, values between 0 and total number of aa's in the protein.
Explain why nonpolar compounds are generally able to diffuse across biological membranes without the aid of a specific transport system.
Ans: A nonpolar compound is more soluble in nonpolar solutes, such as benzene or chloroform, than in polar solvents such as water. They generally pass through biological membranes unaided because it is energetically favorable for them to move from the aqueous solvent into the nonpolar region of the bilayer interior.
Describe the structure of a proteoglycan aggregate such as is found in the extracellular matrix.
Ans: A proteoglycan aggregate is a supramolecular assembly of proteoglycan monomers. Each monomer consists of a core protein with multiple, covalently linked polysaccharide chains. Hundreds of these monomers can bind noncovalently to a single extended molecule of hyaluronic acid to form large structures.
Sketch the principal components of a typical proteoglycan, showing their relationships and connections to one another.
Ans: A typical proteoglycan consists of a core protein with covalently attached glycosaminoglycan polysaccharides, such as chondroitin sulfate and keratin sulfate. The polysaccharides generally attach to a serine residue in the protein via a trisaccharide (gal-gal-xyl). (See Fig. 7-24, p. 253.)
What are the chemical components of a biological wax, and what is their general structure?
Ans: A wax consists of a long-chain fatty acid in ester linkage with a long-chain fatty alcohol. (See Fig. 10-5, p. 348.)
Show the basic structure of all glycerophospholipids.
Ans: All glycerophospholipids have two fatty acids in ester linkage with C-1 and C-2 of glycerol; often the fatty acid at C-1 is saturated, and that at C-2 is unsaturated. C-3 of glycerol is joined to an alcohol-containing head group through a phosphodiester linkage, which is negatively charged at neutral pH. (See Fig. 10-9, p. 351.)
Describe the dependence of the melting point of a fatty acid upon (a) chain length and (b) unsaturation; (c) explain these dependencies in molecular terms.
Ans: All other things being equal, (a) the longer the acyl chain, the higher the melting temperature; and (b) the more unsaturation, the lower the melting temperature. (c) The melting temperature is a measure of the thermal energy needed to break the intermolecular interactions that stabilize the "solid" form of a lipid, which depends upon how well the individual lipid molecules fit into the nearly crystalline array of lipids. When a shorter acyl chain lies between two longer chains in a nearly crystalline array of lipid molecules, there is a cavity at the end of the short acyl group that allows freer motion to the neighboring acyl chains. A cis double bond introduces a "kink" into the acyl chain, so that it does not pack as easily with its straighter neighbors.
What are the similarities and differences between integrins, cadherins, and selectins?
Ans: All three are families of integral membrane proteins that are involved in cell adhesion. Integrins mediate cell adhesion to proteins of the extracellular matrix. Cadherins and selectins mediate cell-cell adhesion the former by interaction with cadherins on the surface of other cells, the latter by interaction with polysaccharides on the surface of other cells.
Phospholipids are amphipathic molecules. Show how this property accounts for the impermeability of biological membranes to polar compounds and ions.
Ans: Amphipathic molecules, with both hydrophobic and hydrophilic domains, when placed in water tend to arrange themselves in a way that minimizes contact of their hydrophobic domains with water. One structure that accomplishes this is the lipid bilayer where hydrophobic fatty acyl chains point toward the center of the bilayer, forming a hydrophobic layer about 3 nm thick with the polarity of hexane. This lipid bilayer is impermeable to polar and charged compounds because it is energetically costly for these compounds to give up their favorable interactions with the polar solvent water and to dissolve in the lipid bilayer.
What is an amphipathic compound? Explain how such compounds contribute to the structure of biological membranes.
Ans: An amphipathic compound has one region or domain that is hydrophilic and another that is hydrophobic. When added to water, amphipathic compounds tend to arrange in a way that exposes their hydrophilic regions to the solvent and hides their hydrophobic domains. One structure that accomplishes this is the lipid bilayer, which forms spontaneously with phospholipids in water. (See Fig. 11-4, p. 374)
The bacterium E. coli can grow at 20 °C or at 40 °C. At which growth temperature would you expect the membrane phospholipids to have a higher ratio of saturated to unsaturated fatty acids, and why?
Ans: At 40 °C, the membranes of E. coli will contain more saturated fatty acids than at 20 °C. The cell regulates fatty acid composition to achieve the same fluidity in its membranes, regardless of growth temperature. Saturated fatty acids counterbalance the fluidizing effect of high temperature.
Lipids as signals, cofactors, and pigments Pages: 373-375 Difficulty: 1 Which of the following is not a fat-soluble vitamin? A) A B) C C) D D) E E) K
Ans: B B) C
Storage Lipids Page: 361 Difficulty: 2 Which of the following is not a consequence of partial hydrogenation of vegetable oils? A) Longer shelf life B) Lower melting temperature C) Reduction of some cis double bonds to single bonds D) Conversion of some cis double bonds to trans double bonds E) Increased risk of cardiovascular disease upon consumption by humans
Ans: B B) Lower melting temperature
Structural lipids in membranes Page: 368 Difficulty: 2 Which of the following answers is not true? A) Phospholipase A1 hydrolyzes the fatty acid from the 1-position on the glycerol backbone. B) Phospholipase B1 hydrolyzes the fatty acid from the 2-position on the glycerol backbone. C) Phospholipase C hydrolyzes the complete phospho-head group from the glycerol backbone. D) Phospholipase D hydrolyzes just the head group from the phospho-glycerol backbone.
Ans: B B) Phospholipase B1 hydrolyzes the fatty acid from the 2-position on the glycerol backbone.
Storage Lipids Pages: 362 Difficulty: 2 Biological waxes are all: A) triesters of glycerol and palmitic acid. B) esters of single fatty acids with long-chain alcohols. C) triesters of glycerol and three long chain saturated fatty acids. D) sphingolipids. E) None of the above
Ans: B B) esters of single fatty acids with long-chain alcohols.
Storage Lipids Pages: 358-361 Difficulty: 2 Which of the following statements is true of lipids? A. Many contain fatty acids in ester or amide linkage. B. Most are simply polymers of isoprene. C. Testosterone is an important sphingolipid found in myelin. D. They are more soluble in water than in chloroform. E. They play only passive roles as energy-storage molecules.
Ans: B B. Most are simply polymers of isoprene.
Structural lipids in membranes Pages: 368-370 Difficulty: 2 Which of the following is not true of sterols? A. Cholesterol is a sterol that is commonly found in mammals. B. Sterols are commonly found in bacterial membranes. C. Sterols are more common in plasma membranes than in intracellular membranes (mitochondria, lysosomes, etc.). D. Serols are precursors of steroid hormones. E. Sterols have a structure that includes four fused rings.
Ans: B B. Sterols are commonly found in bacterial membranes.
Structural lipids in membranes Page: 366 Difficulty: 2 Fatty acids are a component of: A. carotenes. B. cerebrosides. C. sterols. D. vitamin D. E. vitamin K.
Ans: B B. cerebrosides.
Structural lipids in membranes Pages: 366-367 Difficulty: 2 A compound containing N-acetylneuraminic acid (sialic acid) is: A. cardiolipin. B. ganglioside GM2. C. phosphatidylcholine. D. platelet-activating factor. E. sphingomyelin.
Ans: B B. ganglioside GM2.
Lipids as signals, cofactors, and pigments Page: 371 Difficulty: 2 Non-steroidal anti-inflammatory drugs (NSAIDS) like aspirin and ibuprofen act by blocking production of: A. biological waxes B. prostaglandins C. sphingolipids D. vitamin D E. none of the above
Ans: B B. prostaglandins
The number of structurally different polysaccharides that can be made with 20 different monosaccharides is far greater than the number of different polypeptides that can be made with 20 different amino acids, if both polymers contain an equal number (say, 100) of total residues. Explain why.
Ans: Because virtually all peptides are linear (in other words, are formed with peptide bonds between the α-carboxyl and α-amino groups), the variability of peptides is limited by the number of different subunits. Polysaccharides can be linear or branched, can be α- or β-linked, and can be joined 1 → 4, 1 → 3, 1 → 6, etc. The number of different ways to arrange 20 different sugars in a branched oligosaccharide is therefore much larger than the number of different ways a peptide could be made with an equal number of residues.
Describe the differences between a proteoglycan and a glycoprotein.
Ans: Both are made up of proteins and polysaccharides. In proteoglycans, the carbohydrate moiety dominates, constituting 95% or more of the mass of the complex. In glycoproteins, the protein constitutes a larger fraction, generally 50% or more of the total mass.
Compare the structure and activity of a membrane transport protein that transports a polar substance across a membrane with a typical soluble enzyme. How are transporter and enzyme similar? How are they different?
Ans: Both proteins have domains that specifically recognize and bind to their substrates via weak interactions; they both therefore mediate processes that are stereospecific and saturable. The membrane transporter usually spans the membrane, having one or several hydrophobic domains that interact with the hydrophobic acyl chains of fatty acids in the interior of the lipid bilayer. Soluble enzymes tend to have their hydrophobic residues buried within their interiors, and their hydrophilic residues on the surface, where they interact with water.
Lipids as signals, cofactors, and pigments Pages: 373-375 Difficulty: 2 Which vitamin is derived from cholesterol? A) A B) B12 C) D D) E E) K
Ans: C C) D
Working with lipids Pages: 377-379 Difficulty: 2: Which of the following techniques is not commonly used to analyze lipid composition? A) Selective extraction using apolar solvents B) Adsorption chromatography C) X-ray crystallography D) Hydrolysis using enzymes with specificity for certain linkages E) Mass spectroscopy
Ans: C C) X-ray crystallography
Lipids as signals, cofactors, and pigments Pages: 370-371 Difficulty: 2 An example of a glycerophospholipid that is involved in cell signaling is: A. arachidonic acid. B. ceramide. C. phosphatidylinositol. D. testosterone. E. vitamin A (retinol).
Ans: C C. phosphatidylinositol.
Storage Lipids Page: 360 Difficulty: 1 Triacylglycerols are composed of: A) a glycerol backbone. B) three fatty acids. C) amide linkages between the fatty acids and the glycerol. D) A and B above. E) A, B, and C above.
Ans: D D) A and B above.
Structural lipids in membranes Page: 365 Difficulty: 2 Which of the following contains an ether-linked alkyl group? A. Cerebrosides B. Gangliosides C. Phosphatidyl serine D. Platelet-activating factor E. Sphingomyelin
Ans: D D. Platelet-activating factor
Structural lipids in membranes Pages: 362-267 Difficulty: 2 Which of the following statements about membrane lipids is true? A. Glycerophospholipids are found only in the membranes of plant cells. B. Glycerophospholipids contain fatty acids linked to glycerol through amide bonds. C. Lecithin (phosphatidylcholine), which is used as an emulsifier in margarine and chocolate, is a sphingolipid. D. Some sphingolipids include oligosaccharides in their structure. E. Triacylglycerols are the principal components of erythrocyte membranes.
Ans: D D. Some sphingolipids include oligosaccharides in their structure.
Storage Lipids Pages: 357-362 Difficulty: 2 Which of the following molecules or substances contain, or are derived from, fatty acids? A.) Beeswax B) Prostaglandins C) Sphingolipids D) Triacylglycerols E) All of the above contain or are derived from fatty acids.
Ans: E E) All of the above contain or are derived from fatty acids.
Structural lipids in membranes Page: 364 Difficulty: 1 Which of the following is not a glycerophospholipid? A) Phosphatidylcholine B) Phosphatidylethanolamine C) Phosphatidylserine D) Cardiolipin E) Ceramide
Ans: E E) Ceramide
Lipids as signals, cofactors, and pigments Page: 361 Difficulty: 2 Identify the molecule(s) derived from sterols. A. Arachidonic acid B. Gangliosides C. Phosphatidylglycerol D. Prostaglandins E. Cortisol
Ans: E E. Cortisol
Identify all the epimeric pairs in the structures shown below.
Ans: Epimeric pairs should have one carbon of altered stereochemistry compared to each other, as long as that carbon is not the anomeric carbon. Remember that all of the pyranoses shown readily interconvert to the linear version and to their opposite anomer. Therefore, C and D are anomers of each other, but are both epimers of A. Likewise, E and F are anomers of each other, but both are epimers of B.
Draw the structure of phosphatidylserine in the ionic form it would have at pH 7.
Ans: For this structure, see Fig. 10-8, p. 350. At neutral pH, there is a charge on the phosphate group, and serine is in the zwitterionic form; it has a protonated amino group and an ionized carboxyl group.
Draw the structure of phosphatidylcholine. Circle the part of the molecule that is polar and draw an arrow to the part that is nonpolar.
Ans: For this structure, see Fig. 10-9, p. 351. At neutral pH, there is a negative charge on the phosphate group, and the quaternary amino group of choline carries a fixed positive charge; this entire phosphorylcholine moiety is polar. The acyl chains attached to glycerol are the nonpolar part of the molecule.
What are some of the biochemical effects of the oligosaccharide portions of glycoproteins?
Ans: Hydrophilic carbohydrates can alter the polarity and solubility of the proteins. Steric and charge interactions may influence the conformation of regions of the polypeptide and protect it from proteolysis.
This compound is L-glyceraldehyde. Draw a stereochemically correct representation of C-1 and C-2 of D-glucose. CHO | HO—C—H | CH2OH
Ans: In D-glucose, the positions of the —H and —OH on C-2 are the reverse of those for C-2 of L- glyceraldehyde. (Compare Fig. 7-1, p. 236, with Fig. 7-2, p. 236.)
This compound is L-glyceraldehyde. Draw a stereochemically correct representation of C-1 and C-2 of D-glucose. CHO | HO—C—H | CH2OH
Ans: In D-glucose, the positions of the —H and —OH on C-2 are the reverse of those for C-2 of L-glyceraldehyde. (Compare Fig. 7-1, p. 236, with Fig. 7-2, p. 236.)
If beeswax, cholesterol, and phosphatidylglycerol were dissolved in chloroform, then subjected to thin-layer chromatography on silica gel using a mixture of chloroform/methanol/water as the developing solvent, which would move fastest?
Ans: In this chromatography, the least polar compound (beeswax) moves fastest and the most polar (phosphatidylglycerol, which has a negative charge on its head group) moves the slowest. (See Fig. 10-24, p. 364.)
Explain the differences between integral and peripheral membrane proteins.
Ans: Integral membrane proteins are very firmly associated with the membrane; their hydrophobic domains are associated with the fatty acyl groups in the interior in hydrophobic interactions. Peripheral membrane proteins are more loosely associated and usually do not penetrate the hydrophobic interior of the bilayer. Conditions that reduce ionic interactions and hydrogen bonds commonly release them. (See Fig. 11-6, p. 375.)
Match each of these vitamins with its biological role: Vitamins A, D, E, K. ____ blood clotting ____ vision ____ Ca2+ and phosphate metabolism ____ prevention of oxidative damage
Ans: K; A; D; E
What are lectins? What are some biological processes that involve lectins?
Ans: Lectins are proteins that bind to specific oligosaccharides. They interact with specific cell-surface glycoproteins thus mediating cell-cell recognition and adhesion. Several microbial toxins and viral capsid proteins, which interact with cell surface receptors, are lectins.
Explain why extraction of lipids from tissues requires organic solvents.
Ans: Lipids are either strongly hydrophobic or amphipathic. Because the solvent in tissues is water, lipids are mainly present in aggregates. This aggregation does not occur in organic solvents; as a result, the lipids are more soluble and thus extractable from the tissues.
Categorize each of the following as an aldose, a ketose, or neither.
Ans: Molecules (b) and (d) are aldoses; (a) is a ketose; (c) and (e) are neither.
Categorize each of the following as an aldose, a ketose, or neither. (pictures)
Ans: Molecules (b) and (d) are aldoses; (a) is a ketose; (c) and (e) are neither.
A plant breeder has developed a new frost-resistant variety of tomato that contains higher levels of unsaturated fatty acids in membrane lipids than those found in standard tomato varieties. However, when temperatures climb above 95 °F, this frost-resistant variety dies, whereas the standard variety continues to grow. Provide a likely explanation of the biochemical basis of increased tolerance to cold and increased susceptibility to heat of this new tomato variety.
Ans: More unsaturated fatty acids will cause an increase in membrane fluidity because unsaturated fatty acids contain "kinks" and cannot pack as tightly as saturated fatty acids. At cold temperatures, the fluidity increase from the extra unsaturated fatty acids counterbalances the tendency of lipids to solidify at low temperature. At high temperatures, the fluidizing effects of the extra unsaturated fatty acids add to the fluidizing effect of higher temperature, and the membrane of the new plant loses its integrity.
What is the effect of a double bond on fatty acid structure?
Ans: Most double bonds in fatty acids are in the cis configuration. This results in a rigid bend in the hydrocarbon chain. (See Fig. 10-1, p. 345.)
Describe the process by which "old" serum glycoproteins are removed from the mammalian circulatory system.
Ans: Newly synthesized serum glycoproteins bear oligosaccharide chains that end in sialic acid. With time, the sialic acid is removed. Glycoproteins that lack the terminal sialic acid are recognized by asialoglycoprotein receptors in the liver, internalized, and destroyed.
What is the major difference between gated and non-gated ion channels? Give an example of two different gating signals.
Ans: Non-gated channels are always open; gated channels open in response to a signal. Two possible signals are the presence of a ligand or a change in membrane poential.
Why is a hydropathy plot useful, and what are its limitations?
Ans: Peaks on a hydropathy plot indicate areas of high hydrophobicity, which may signal the presence of transmembrane helices or other integral membrane protein segments. However, because water soluble proteins have hydrophobic interiors, it is possible to get hydrophobic areas for proteins that are not membrane associated.
Draw the structure of a biological membrane as proposed by the fluid mosaic model. Indicate the positions and orientations of phospholipids, cholesterol, integral and peripheral membrane proteins, and the carbohydrate moieties of glycoproteins and glycolipids.
Ans: Phospholipids and sterols are found in both faces of the lipid bilayer. Integral membrane proteins penetrate or span the lipid bilayer, but peripheral membrane proteins associate at the membrane surface with lipid head groups or integral membrane proteins. The carbohydrate moieties of glycolipids and glycoproteins are invariably on the outside face of the plasma membrane. (See Fig. 11-3, p. 373.)
Reagents A and B both react covalently with primary amino groups such as those of phosphatidylethanolamine. Reagent A permeates erythrocytes, but reagent B is impermeant. Both A and B are available in radioisotopically labeled form. Describe a simple experiment by which you might determine whether the phosphatidylethanolamine of erythrocyte membranes is located in the outside face of the lipid bilayer, the inside face, or in both. Be brief and use diagrams to support your answer.
Ans: Reagent A will label phosphatidylethanolamine head groups in both the outer and the inner monolayer of the membrane; reagent B will label only the phosphatidylethanolamine molecules on the outer face. If phosphatidylethanolamine is equally distributed on both sides of the bilayer, twice as much labeling of phosphatidylethanolamine should be observed with reagent A as with reagent B. Deviations from this ratio indicate asymmetry in the distribution of phosphatidylethanolamine.
Give the structure of phosphatidylethanolamine containing one palmitate and one oleate. Show the ionic form expected at pH 7. How many ester bonds are there in this compound?
Ans: See Fig. 10-9, p. 351 for the phospholipid structure and Table 10-1, p. 344 for the structures of the fatty acids. There are two carboxylate esters and two phosphate esters (one phosphodiester) in the molecule.
Compare and contrast symport and antiport. Which term best describes the transport system mediated by the Na+K+ ATPase?
Ans: Symport and antiport are both types of cotransport systems in which two solutes move through the membrane simultaneously. In symport, both move in the same direction; in antiport, one solute goes in one direction, the other in the opposite direction. The Na+K+ ATPase of the plasma membrane is an antiport system. It moves K+ in and Na+ out in a ratio of 2 K+ per 3 Na+. Neither of the two ions can be transported unless the other is present, which is characteristic of cotransport systems. (See Fig. 11-34, p. 397, and Fig. 11-36, p. 399.)
If the hydrophobic interior of a membrane were about 3 nm thick, what would be the minimum number of amino acids in a stretch of transmembrane helix?
Ans: The dimensions of an helix are about 5.4 Å/turn, and there are 3.6 residues/turn, so each residue extends the helix by about 1.5 Å or 0.15 nm. To span 3 nm of lipid bilayer will therefore require a minimum of 20 residues.
Describe one biological advantage of storing glucose units in branched polymers (glycogen, amylopectin) rather than in linear polymers.
Ans: The enzymes that act on these polymers to mobilize glucose for metabolism act only on their nonreducing ends. With extensive branching, there are more such ends for enzymatic attack than would be present in the same quantity of glucose stored in a linear polymer. In effect, branched polymers increase the substrate concentration for these enzymes.
Explain how it is possible that a polysaccharide molecule, such as glycogen, may have only one reducing end, and yet have many nonreducing ends.
Ans: The molecule is branched, with each branch ending in a nonreducing end. (See Fig. 7-14c, p. 245.)
What is the biological advantage to an organism that stores its carbohydrate reserves as starch or glycogen rather than as an equivalent amount of free glucose?
Ans: The polymers are essentially insoluble and contribute little to the osmolarity of the cell, thereby avoiding the influx of water that would occur with the glucose in solution. They also make the uptake of glucose energetically more feasible than it would be with free glucose in the cell.
What are the principle features of the fluid mosaic model of membranes?
Ans: The principle features of the fluid mosaic model of membranes include: (1) a lipid bilayer in which individual lipids are free to move laterally but not across the bilayer; (2) integral membrane proteins, which penetrate or span the bilayer, associating with lipid acyl chains by hydrophobic interactions and exhibiting lateral mobility; (3) peripheral membrane proteins, which associate noncovalently with the lipid head groups and protruding domains of integral membrane proteins, and which are sometimes tethered to the membrane by a covalent lipid anchor.
The plasma membrane of an animal cell consists of 45% by weight of phospholipid and 55% protein. What is the mole ratio (moles of lipid/moles of protein) if the average molecular weight of phospholipids is 750 and the average molecular weight of membrane proteins is 50,000?
Ans: The ratio of moles lipid/moles protein is about 55. In 100 g of membrane, there are 45 g/750 g•mol-1 = 0.06 mol phospholipid, and 55 g/50,000 g•mol-1 = 1.1 10-3 mol protein. So lipid/protein = 0.06/0.0011 = 55.
Explain in molecular terms why humans cannot use cellulose as a nutrient, but goats and cattle can.
Ans: The ruminant animals have in their rumens microorganisms that produce the enzyme cellulase, which splits the (β1 → 4) linkages in cellulose, releasing glucose. Humans do not produce an enzyme with this activity; the human digestive enzyme α-amylase can split only (α1 → 4) linkages (such as those in glycogen and starch).
Show the structure of isoprene; explain what is meant by isoprenoid compounds and give an example.
Ans: The structure is shown on page 361. Isoprenoid compounds contain chains that consist of multiple isoprene units. (See Fig. 10-22, p. 362, for examples.)
Show the structure of sphingosine and indicate the relationship between sphingosine and ceramide.
Ans: The structure of sphingosine is shown in Fig. 10-13, p. 353, which also shows that the attachment of a fatty acyl group to sphingosine in amide linkage converts it to ceramide.
Describe the differences between the glycosphingolipids corresponding to the A, B and O human blood group antigens.
Ans: The type O structure is found in all three glycosphingolipids. In both type A and type B, there is an added sugar; this sugar differs between type A and B.
Explain why all mono- and disaccharides are soluble in water.
Ans: These compounds have many hydroxyl groups, each of which can hydrogen bond with water. (See Chapter 4.)
Explain the cause of hereditary diseases of sphingolipid metabolism, such as Tay-Sachs and Niemann-Pick diseases.
Ans: These diseases are the result of mutations in the genes that code for enzymes of sphingolipid breakdown. The mutant enzyme is defective and unable to catalyze its reaction in the metabolic pathway; this results in the accumulation of the metabolic intermediate that is the substrate for the enzyme. (See Box 10-2, p. 356.)
What do all these compounds have in common: vitamin A, vitamin K, ubiquinone, and dolichol?
Ans: They are all lipids with potent biological activities derived from isoprenoid precursors.
A protein is found to extend all the way through the membrane of a cell. Describe this protein in terms of the location of particular types of amino acid side chains in its structure and its ability to move within the membrane.
Ans: This integral membrane protein associates with the lipid bilayer through hydrophobic interactions between domains containing many hydrophobic amino acids and the fatty acyl chains of membrane lipids. Polar and charged residues are located on portions of the protein that protrude out of either face of the membrane. The protein is free to diffuse laterally in the plane of the membrane, but cannot move across the lipid bilayer.
Describe two ways a plant can adjust the components of its cell membranes to keep them as fluid as possible on a cold winter morning.
Ans: To compensate for the solidifying effect of low temperature on membrane lipids, it can synthesize and place in the membrane (1) a greater proportion of unsaturated fatty acids and (2) shorter-chain fatty acids. Both increase the fluidity of the lipid bilayer.
What is the most significant chemical difference between triacylglycerols and glycerophospholipids that leads to their different functions?
Ans: Triacylglycerols are nonpolar hydrophobic molecules that can be stored in specialized nonaqueous cellular compartments. Glycerophospholipids are amphipathic molecules that can serve as structural components of membranes, which have hydrophilic and hydrophobic regions.
Describe three functions of triacylglycerols in mammals and one function in higher plants.
Ans: Triacylglycerols provide mammals with (1) stored fuel, (2) insulation, and (3) a source of metabolic water. In some animals, such as camels and desert rats, the oxidation of stored lipids provides water; in hibernating animals, oxidation of stored lipids generates heat to maintain body temperature (see Chapter 4). In plants, oxidation of the triacylglycerols stored in seeds provides the energy and precursors for biosynthetic processes during germination, before photosynthetic mechanisms become functional.
The glycosaminoglycans are negatively charged at neutral pH. What components of these polymers confer the negative charge?
Ans: Uronic acids such as glucuronic acid, and sulfated hydroxyl groups, such as GalNAc4SO3- and GlcNAc6SO3-. (See Fig. 7-22, p. 250.)
Match the compounds on the left with the important roles they play listed on the right. (Answers are used only once.) (a) prostaglandins ___ blood clotting (b) sphingolipids ___ necessary for sight (c) thromboxanes ___ mediates pain and inflammation (d) vitamin A ___ important component of myelin membranes
Ans: c; d; a; b
Match these molecules with their biological roles. a) glycogen (b) starch (c) trehalose (d) chitin (e) cellulose (f) peptidoglycan (g) hyaluronate (h) proteoglycan __ viscosity, lubrication of extracellular secretions __ carbohydrate storage in plants __ transport/storage in insects __ exoskeleton of insects __ structural component of bacterial cell wall __ structural component of plant cell walls __ extracellular matrix of animal tissues __ carbohydrate storage in animal liver
Ans: g; b; c; d; f; e; h; a
Match these molecules with their biological roles. (a) glycogen (b) starch (c) trehalose (d) chitin (e) cellulose (f) peptidoglycan (g) hyaluronate (h) proteoglycan __ viscosity, lubrication of extracellular secretions __ carbohydrate storage in plants __ exoskeleton of insects __ structural component of bacterial cell wall __ structural component of plant cell walls __ extracellular matrix of animal tissues __ carbohydrate storage in animal liver
Ans: g; b; c; d; f; e; h; a
Match these molecules with their biological roles. (a) glycogen __ viscosity, lubrication of extracellular secretions (b) starch __ carbohydrate storage in plants (c) trehalose __ transport/storage in insects (d) chitin __ exoskeleton of insects (e) cellulose __ structural component of bacterial cell wall (f) peptidoglycan __ structural component of plant cell walls (g) hyaluronate __ extracellular matrix of animal tissues (h) proteoglycan __ carbohydrate storage in animal liver
Ans: g; b; c; d; f; e; h; a
Which statement describes a distinct difference between membrane lipids in archaea and membrane lipids in eukarya?
Archaeal membrane lipids have alkyl acids that are ether-linked to glycerol at both ends.
N-linked oligosaccharides can be covalently linked to proteins at which amino acid? A) Gly B) Ser C) Glu D) Tyr E) Asn
Asn
N-linked glycosylation recognition sequence
Asn-X-Ser or Asn-X-Thr X= any a.a except Pro
The bacterium E. coli can grow at 20 °C or at 40 °C. At which growth temperature would you expect the membrane phospholipids to have a higher ratio of saturated to unsaturated fatty acids, and why?
At 40 °C, the membranes of E. coli will contain more saturated fatty acids than at 20 °C. The cell regulates fatty acid composition to achieve the same fluidity in its membranes, regardless of growth temperature. Saturated fatty acids counterbalance the fluidizing effect of high temperature.
9. The role of the Dam methylase is to: A) add a methyl group to uracil, converting it to thymine. B) modify the template strand for recognition by repair systems. C) remove a methyl group from thymine. D) remove a mismatched nucleotide from the template strand. E) replace a mismatched nucleotide with the correct one.
B
A compound containing N-acetylneuraminic acid (sialic acid) is: A) cardiolipin. B) ganglioside GM2. C) phosphatidylcholine. D) platelet-activating factor. E) sphingomyelin.
B
A compound containing N-acetylneuraminic acid (sialic acid) is: A) cardiolipin. B) ganglioside GM2. C) phosphatidylcholine. D) platelet-activating factor. E) sphingomyelin.
B
A solution of the heteropolysaccharide _____ can be heated and cooled to form a three- dimensional matrix that traps water and supports the electrophoretic separation of nucleic acids. A) dextrose B) agarose C) glycosaminoglycans D) amylose E) cellulose
B
According to the sequence below (note that the DNA is written in the 5′ → 3′ direction, and the gene of interest is underlined), the BEST forward primer to use for this gene is: A) 5′ GGTTTGAATCAAATGGCTGA 3′. B) 5′ ATGACTGATACATCATCCTC 3′. C) 3′ ATGACTGATACATCATCCTC 5′. D) 5′ GAGGATGATGTATCAGTCAT 3′. E) 3′ GAGGATGATGTATCAGTCAT 5′.
B
Amylopectin contains primarily _____ glycosidic bonds with _____ glycosidic bonds as branch points. A) a(14); (12) B) a(14); (16) C) a(14); (16) D) B(14); (14) E) B(14); (16)
B
Biological waxes are all: A) triesters of glycerol and palmitic acid. B) esters of single fatty acids with long-chain alcohols. C) triesters of glycerol and three long chain saturated fatty acids. D) sphingolipids. E) None of the answers is correct.
B
Biological waxes are all: A) trimesters of glycerol and palmitic acid. B) esters of single fatty acids with long-chain alcohols. C) trimesters of glycerol and three long chain saturated fatty acids. D) sphingolipids. E) none of the above.
B
Compounds that generate nitrous acid (such as nitrites, nitrates, and nitrosamines) change DNA molecules by: A) breakage of phosphodiester bonds. B) deamination of bases. C) depurination. D) formation of thymine dimers. E) transformation of A → T.
B
Compounds that generate nitrous acid (such as nitrites, nitrates, and nitrosamines) change DNA molecules by: A) breakage of phosphodiester bonds. B) deamination of bases. C) depurination. D) formation of thymine dimers. E) transformation of A → T.
B
Consider the transport of glucose into an erythrocyte by facilitated diffusion. When the glucose concentrations are 5 mM on the outside and 0.1 mM on the inside, the free-energy change for glucose uptake into the cell is: (These values may be of use to you: R = 8.315 J/mol•K; T = 298 K; 9 (Faraday constant) = 96,480 J/V; N = 6.022 1023/mol.) A) less than 2 kJ/mol. B) about 10 kJ/mol. C) about 30 kJ/mol. D) about -30 kJoule/mol. E) impossible to calculate without knowledge of the membrane potential.
B
D-Glucose is called a reducing sugar because it undergoes an oxidation-reduction reaction at the anomeric carbon. One of the products of this reaction is: A) D-galactose. B) D-gluconate. C) D-glucuronate. D) D-ribose. E) muramic acid.
B
D-Glucose is called a reducing sugar because it undergoes an oxidation-reduction reaction at the anomeric carbon. One of the products of this reaction is: A) D-galactose. B) D-gluconate. C) D-glucuronate. D) D-ribose. E) muramic acid.
B
Double stranded regions of RNA typically take on a(n): A) A-form left-handed helix. B) A-form right-handed helix. C) B-form left-handed helix. D) B-form right-handed helix. E) Z-form left-handed helix.
B
Double stranded regions of RNA typically take on a(n): A) A-form left-handed helix. B) A-form right-handed helix. C) B-form left-handed helix. D) B-form right-handed helix. E) Z-form left-handed helix.
B
Fatty acids are a component of: A) carotenes. B) cerebrosides. C) sterols. D) vitamin D. E) vitamin K.
B
Fatty acids are a component of: A) carotenes. B) cerebrosides. C) sterols. D) vitamin D. E) vitamin K.
B
Fatty acids are attached to sphingosine by what type of chemical linkage? A) an ether linkage B) an amide linkage C) an ester linkage D) a peroxide linkage E) a alkyl linkage
B
For the process of solute transport, the constant Kt is: A) analogous to Ka for ionization of a weak acid. B) analogous to Km for an enzyme-catalyzed reaction. C) analogous to Vmax for an enzyme reaction D) proportional to the number of molecules of glucose transporter per cell. E) the maximum rate of glucose transport.
B
Hoogsteen base-pairing occurs when a third strand of DNA binds along the _____ of a double helix of DNA. A) minor groove B) major groove C) free 5′ end D) free 3′ end E) Any of these parts of a DNA double helix could participate in a Hoogsteen interaction.
B
Human adipocytes contain which enzyme that catalyzes the breakdown of triacylglycerols? A) glycerase B) lipase C) fatase D) esterase E) triacylase
B
If you wanted to analyze membrane lipids from a biological sample, which solvent would MOST effectively extract those lipids? A) benzene B) methanol C) water D) chloroform E) ethyl ether
B
In a double-stranded nucleic acid, cytosine typically base-pairs with: A) adenosine. B) guanine. C) inosine. D) thymine. E) uracil.
B
In a double-stranded nucleic acid, cytosine typically base-pairs with: A) adenosine. B) guanine. C) inosine. D) thymine. E) uracil.
B
In high-performance liquid chromatography of lipid mixtures using a column packed with a silica gel, which types of lipids will elute first? A) positively charged lipids B) neutral lipids C) negatively charged lipids D) polar lipids E) zwitterionic lipids
B
In one catalytic cycle, the Na+/K+ ATPase transporter transports: A) 2 Na+ out, 3 K+ in, and converts 1 ATP to ADP + Pi. B) 3 Na+ out, 2 K+ in, and converts 1 ATP to ADP + Pi. C) 3 Na+ in, 2 K+ out, and converts 1 ATP to ADP + Pi. D) 1 Na+ out, 1 K+ in, and converts 1 ATP to ADP + Pi. E) 2 Na+ out, 3 K+ in, and converts 1 ADP + Pi to ATP.
B
Movement of water across membranes is facilitated by proteins called: A) annexins. B) aquaporins. C) hydropermeases. D) selectins. E) transportins.
B
Non-steroidal anti-inflammatory drugs (NSAIDS) like aspirin and ibuprofen act by blocking production of: A) biological waxes B) prostaglandins C) sphingolipids D) vitamin D E) none of the above
B
Nonsteroidal anti-inflammatory drugs (NSAIDS) like aspirin and ibuprofen act by blocking production of: A) biological waxes B) prostaglandins C) sphingolipids D) vitamin D E) None of the answers is correct.
B
Platelet-activating factor is much more water soluble than most other glycerophospholipids due to which feature? A) its ether-linked alkyl chain at the C-1 of glycerol B) its ester-linked acetic acid at the C-2 of glycerol C) its ethanolamine head group D) its lack of any long alkyl chains linked to glycerol E) the presence of sphingosine, rather than glycerol, as a lipid backbone
B
The DNA oligonucleotide abbreviated pATCGAC: A) has seven phosphate groups. B) has a hydroxyl at its 3' end. C) has a phosphate on its 3' end. D) has an A at its 3' end. E) violates Chargaff's rules.
B
The DNA oligonucleotide abbreviated pATCGAC: A) has seven phosphate groups. B) has a hydroxyl at its 3' end. C) has a phosphate on its 3' end. D) has an A at its 3' end. E) violates Chargaff's rules
B
The basic structure of a proteoglycan consists of a core protein and a: A) glycolipid. B) glycosaminoglycan. C) lectin. D) lipopolysaccharide. E) peptidoglycan.
B
The basic structure of a proteoglycan consists of a core protein and a: A) glycolipid. B) glycosaminoglycan. C) lectin. D) lipopolysaccharide. E) peptidoglycan.
B
The covalent backbone of DNA and RNA consists of: A) alternating phosphate groups and nitrogenous bases. B) alternating phosphate groups and pentose residues. C) alternating pentose residues and nitrogenous bases. D) alternating pentose residues and cyclic nucleosides. E) None of the answers is correct.
B
The difference between thymine and uracil is: A) one methylene group on the pyrimidine ring. B) one methyl group on the pyrimidine ring. C) one hydroxyl group on the ribose ring. D) one amine group on the pyrimidine ring. E) one methyl group on the purine ring
B
The difference between thymine and uracil is: A) one methylene group on the pyrimidine ring. B) one methyl group on the pyrimidine ring. C) one hydroxyl group on the ribose ring. D) one amine group on the pyrimidine ring. E) one methyl group on the purine ring.
B
The enzyme _____ from _____ allows animals such as cows to derive energy from cellulose. A) chitinase; termites B) cellulase; microorganisms C) glucosyltransferase; viruses D) lactase; microorganisms E) none of the above
B
The experiment of Avery, MacLeod, and McCarty in which nonvirulent bacteria were made virulent by transformation was significant because it showed that: A) bacteria can undergo transformation. B) genes are composed of DNA only. C) mice are more susceptible to pneumonia than are humans. D) pneumonia can be cured by transformation. E) virulence is determine genetically.
B
The experiment of Avery, MacLeod, and McCarty in which nonvirulent bacteria were made virulent by transformation was significant because it showed that: A) bacteria can undergo transformation. B) genes are composed of DNA only. C) mice are more susceptible to pneumonia than are humans. D) pneumonia can be cured by transformation. E) virulence is determine genetically
B
The image below shows a Sanger DNA sequencing gel where one ingredient was left out of all sequencing reactions. The top of the gel is the anode and the bottom of the gel is the cathode. The gel was turned on and ran correctly. What is the MOST likely missing ingredient? A) dNTPs B) ddNTPs C) radioactive DNA primer D) DNA polymerase E) template DNA
B
The molecular formula for a monosaccharide is _____ where _____. A) CnH2n+2On; n 3 B) CnH2nOn; n 3 C) CnH2nOn; n 4 D) CnH2n+2On; n 4 E) none of the above
B
The severalfold greater incidence of gastric ulcers in _____ is due in part to a surface lectin in the bacterium Helicobacter pylori. A) men versus women B) people with a certain blood type C) people of a certain age D) people with autoimmune diseases E) None of the answers is correct.
B
The shortest helix segment in a protein that will span a membrane bilayer has about _____ amino acid residues. A) 5 B) 20 C) 50 D) 100 E) 200
B
The steroid hormones testosterone and beta-estradiol are derived from which lipid molecule? A) phosphatidylcholine B) cholesterol C) lipoxin A D) arachidonic acid E) geraniol
B
The study and classification of the complete set of lipids produced in an organisms is called: A) proteomics. B) lipidomics. C) genomics. D) lipidification. E) fatification.
B
The transformation of a monosaccharide into its _____ occurs easily and does not require the assistance of a catalyst. A) epimer B) anomer C) sugar alcohol D) diastereomer E) none of the above
B
Under which condition will integral protein be extracted from membrane. (a) a buffer of alkaline or acid pH. (b) a solution containing detergent (c) a solution of chelating agents which remove divalent ions (d) high ionic strength (high salt)
B
Waxes are BEST described as: A) esters of glycerol and three fatty acids. B) esters of one long-chain fatty acid and one long-chain alcohol. C) polyunsaturated long-chain fatty acids. D) esters of two long-chain fatty acids. E) ethers of glycerol and short-chain alcohols.
B
What feature do Tay-Sachs disease, Fabry disease, and Niemann-Pick disease have in common? A) defects in enzymes responsible for synthesizing membrane lipids B) defects in enzymes responsible for breaking down membrane lipids in the lysosomes C) hyperactive membrane lipid degradation enzymes D) defects in enzymes responsible for cholesterol synthesis E) All of the answers are correct.
B
What is the CORRECT name for the linkage between these monosaccharide derivatives? A) (a1®4) B) (b1®4) C) (1 4) D) (a1®b4) E) (a1®a4)
B
What would happen if blocking tags were NOT used in reversible terminator sequencing, a next-generation method of DNA sequencing? A) The DNA fragments to sequence/read would be too large. B) More than one dNTP could be incorporated to the same growing nucleotide chain during a single cycle. C) The flow cell could not immobilize DNA fragments. D) Multiple fluorescent colors could be observed across the flow cell at the same time. E) Luciferase would not react in the presence of ATP.
B
When double-stranded DNA is heated at neutral pH, which change does NOT occur? A) The absorption of ultraviolet (260 nm) light increases. B) The covalent N-glycosidic bond between the base and the pentose breaks. C) The helical structure unwinds. D) The hydrogen bonds between A and T break. E) The viscosity of the solution decreases.
B
When double-stranded DNA is heated at neutral pH, which change does not occur? A) The absorption of ultraviolet (260 nm) light increases. B) The covalent N-glycosidic bond between the base and the pentose breaks. C) The helical structure unwinds. D) The hydrogen bonds between A and T break. E) The viscosity of the solution decreases
B
Which compound can be cleaved in half to generate a molecule important in vision? A) calcitol B) beta-carotene C) arachidonic acid D) tocopherol E) isoprene
B
Which deoxyoligonucleotide will hybridize with a DNA containing the sequence (5')AGACTGGTC(3')? A) (5')CTCATTGAG(3') B) (5')GACCAGTCT(3') C) (5')GAGTCAACT(3') D) (5')TCTGACCAG(3') E) (5')TCTGGATCT(3')
B
Which eicosanoids contains a five-carbon ring as part of its structure? A) thromboxanes B) prostaglandins C) lipoxins D) leukotrienes E) arachidonates
B
Which factor is NOT a consequence of partial hydrogenation of vegetable oils? A) longer shelf life B) lower melting temperature C) reduction of some cis double bonds to single bonds D) conversion of some cis double bonds to trans double bonds E) increased risk of cardiovascular disease upon consumption by humans
B
Which factor is NOT a part of determining the complete structure of an oligosaccharide or polysaccharide? A) determination of linear sequence B) determination of lectin partners C) determination of branching positions D) determination of glycosidic linkages E) determination of monosaccharide configuration
B
Which feature allows certain lipid molecules to be used as colorful pigments in plants and animals? A) Their high oxygen content helps electrons circulate, which allows absorption of visible light. B) Their conjugated bond structures allow absorption of visible light. C) Their four-fused ring structure allows visible light reflection. D) Their hydrophobicity bends light around them. E) Their low specific gravities cause light to reflect from their surfaces.
B
Which method can be used to visualize lipids that have been separated by thin-layer chromatography by reversibly reacting with double bonds in fatty acids? A) ethanol B) iodine fumes C) low-wavelength UV light D) rhodamine E) ethidium bromide
B
Which molecule is MOST commonly used as a backbone the linkage of three fatty acids to form fats? A) glycogen B) glycerol C) sphingosine D) glucose E) phosphoglycerol
B
Which monosaccharide is NOT a six-carbon monosaccharide? A) fructose B) ribose C) mannose D) glucose E) galactose
B
Which of the following deoxyoligonucleotides will hybridize with a DNA containing the sequence (5')AGACTGGTC(3')? A) (5')CTCATTGAG(3') B) (5')GACCAGTCT(3') C) (5')GAGTCAACT(3') D) (5')TCTGACCAG(3') E) (5')TCTGGATCT(3')
B
Which of the following is a mixture of two types of polymers? A) cellulose B) starch C) chitin D) glycogen E) amylose
B
Which of the following is an epimeric pair? A) D-glucose and D-glucosamine B) D-glucose and D-mannose C) D-glucose and L-glucose D) D-lactose and D-sucrose E) L-mannose and L-fructose
B
Which of the following is not a fat-soluble vitamin? A) A B) C C) D D) E E) K
B
Which of the following is not true of sterols? A) Cholesterol is a sterol that is commonly found in mammals. B) They are commonly found in bacterial membranes. C) They are more common in plasma membranes than in intracellular membranes (mitochondria, lysosomes, etc.). D) They are precursors of steroid hormones. E) They have a structure that includes four fused rings.
B
Which of the following monosaccharides is NOT an aldose? A) erythrose B) fructose C) glucose D) glyceraldehyde E) ribose
B
Which of the following monosaccharides is not an aldose? A) erythrose B) fructose C) glucose D) glyceraldehyde E) ribose
B
Which of the following statements is true of lipids? A) Many contain fatty acids in ester or amide linkage. B) Most are simply polymers of isoprene. C) Testosterone is an important sphingolipid found in myelin. D) They are more soluble in water than in chloroform. E) They play only passive roles as energy-storage molecules.
B
Which pair is epimeric? A) D-glucose and D-glucosamine B) D-glucose and D-mannose C) D-glucose and L-glucose D) D-lactose and D-sucrose E) L-mannose and L-fructose
B
Which solvent is NOT used to dissolve lipids? A) ethyl ether B) water C) benzene D) methanol E) chloroform
B
Which statement BEST describes why lipids typically float on water? A) Lipids are nonpolar, while water is polar. B) Lipids have lower specific gravities than water does. C) Lipids have higher melting temperature than water does. D) Lipids store more energy than water does. E) Lipids contain carbon, while water does not.
B
Which statement about N-linked glycosylation is correct? A) N-linked oligosaccharides are attached to proteins one sugar at the time in the endoplasmic reticulum. B) N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation in the endoplasmic reticulum. C) N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation in the cytoplasm. D) N-linked sugars are attached to proteins as a 14 residue oligosaccharide after translation in the Golgi apparatus. E) N-linked oligosaccharides are attached to proteins one sugar at the time in the Golgi apparatus.
B
Which statement about dextrans is FALSE? A) Dextrans are bacterial and yeast polysaccharides. B) All dextrans are made up of (a1®4)-linked poly-D-glucose. C) All dextrans have (a1®3) branches. D) Some dextrans have (a1®2) branches. E) All statements are true.
B
Which statement is FALSE regarding proteoglycans? A) Both syndecans and glypicans can be shed into the extracellular space. B) Proteoglycan shedding is unregulated in cells. C) A protease or phospholipase is responsible for releasing proteoglycans. D) Proteoglycan shedding is activated in cancerous cells. E) Cell features such as proteoglycans can be changed quickly.
B
Which statement is NOT true about base stacking when nucleic acids are in a double-stranded conformation? A) Stacking interactions occur when two or more bases are positioned with their rings parallel to each other. B) Stacking interactions are hydrophilic in nature. C) Stacking involves a combination of van der Waals and dipole-dipole interactions between bases. D) Base stacking helps to minimize contact of the bases with water. E) Base stacking interactions are important in stabilizing the three-dimensional structure of nucleic acids.
B
Which statement is NOT true of sterols? A) Cholesterol is a sterol that is commonly found in mammals. B) Sterols are commonly found in bacterial membranes. C) Sterols are more common in plasma membranes than in intracellular membranes (mitochondria, lysosomes, etc.). D) Serols are precursors of steroid hormones. E) Sterols have a structure that includes four fused rings.
B
Which statement is NOT true? A) Phospholipase A1 hydrolyzes the fatty acid from the 1-position on the glycerol backbone. B) Phospholipase B1 hydrolyzes the fatty acid from the 2-position on the glycerol backbone. C) Phospholipase C hydrolyzes the complete phospho-head group from the glycerol backbone. D) Phospholipase D hydrolyzes just the head group from the phospho-glycerol backbone.
B
Which statement is TRUE of lipids? A) Many contain fatty acids in ester or amide linkage. B) Most are simply polymers of isoprene. C) Testosterone is an important sphingolipid found in myelin. D) They are more soluble in water than in chloroform. E) They play only passive roles as energy-storage molecules.
B
Which type of damage to DNA structure is MOST likely to be caused by UV light? A) deamination B) pyrimidine dimers C) depurination D) depyrimidination E) hydrolysis of the phosphodiester bond
B
Which types of membrane lipids are modified to determine blood type in humans? A) phosphatidylserines B) glycosphingolipids C) galactolipids D) plasmalogens E) sphingomyelins
B
Which types of signaling lipids are produced by platelets to aid in the formation of blood clots? A) prostaglandins B) thromboxanes C) arachidonates D) lipoxins E) leukotrienes
B
Which vitamin is NOT fat soluble? A) A B) C C) D D) E E) K
B
Why is methyl iodide used in the classical method of exhaustive methylation to determine the positions of glycosidic bonds in a linear polysaccharide? A) All free hydroxyls become unstable, allowing hydrolysis of only glycosidic bonds to occur in acid. B) All free hydroxyls become stable, allowing hydrolysis of only glycosidic bonds to occur in acid. C) All glycosidic bonds react with methyl iodide. D) All glycosidic bonds become stable for treatment with acid. E) All glycosidic bonds are hydrolyzed with methyl iodide.
B
_____ are secreted or membrane proteins that contain large numbers of O-linked oligosaccharide chains. A) Gangliosides B) Mucins C) Glycins D) Aminoglycans E) Immunoglobulins
B
_____ could be used to determine human blood group type. A) Lipopolysaccharides B) Globoside C) Glycoproteins D) Lipoproteins E) Mucins
B
Which statement about N-linked glycosylation is correct? A) N-linked oligosaccharides are attached to proteins one sugar at the time in the endoplasmic reticulum. B) N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation in the endoplasmic reticulum. C) N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation in the cytoplasm. D) N-linked sugars are attached to proteins as a 14 residue oligosaccharide after translation in the Golgi apparatus. E) N-linked oligosaccharides are attached to proteins one sugar at the time in the Golgi apparatus.
B - N-linked sugars are attached to proteins as a 14 residue oligosacch. during translation in the ER
The reaction between an alcohol and an anomeric carbon of a carbohydrate forms a _____ bond. A) anomeric B) glycosidic C) hemiacetal D) ester E) ether
B and C
42. What is the CORRECT name for the linkage between these monosaccharide derivatives? A) (a1->4) B) (B1->4) C) (1 4) D) (a1->B4) E) (a1->a4)
B) (B1->4)
GLUT1 has a Kt of 1.5 mM for glucose and a Kt of 30 mM for galactose. What concentration of galactose would be required to reach the same rate of import as 5mM glucose? A) 3 mM B) 10 mM C) 15 mM D) 30 mM E) 100 mM
B) 10 mM
The shortest a helix segment in a protein that will span a membrane bilayer has about _____ amino acid residues. A) 5 B) 20 C) 50 D) 100 E) 200
B) 20
In one catalytic cycle, the Na+/K+ ATPase transporter transports: A) 2 Na+ out, 3 K+ in, and converts 1 ATP to ADP + Pi. B) 3 Na+ out, 2 K+ in, and converts 1 ATP to ADP + Pi. C) 3 Na+ in, 2 K+ out, and converts 1 ATP to ADP + Pi. D) 1 Na+ out, 1 K+ in, and converts 1 ATP to ADP + Pi. E) 2 Na+ out, 3 K+ in, and converts 1 ADP + Pi to ATP.
B) 3 Na+ out, 2 K+ in, and converts 1 ATP to ADP + Pi.
13. How many stereoisomers are possible for a ketopentose such as ribulose? A) 2 B) 4 C) 8 D) 16 E) 32
B) 4
Chimpanzees and humans differ by approximately how much due to transposons, base-pair changes, and chromosome segment duplications and rearrangements across their entire genomic sequences? A) 1.5% B) 4% C) 95% D) 10% E) 0.1%
B) 4%
44. Which statement about dextrans is FALSE? A) Dextrans are bacterial and yeast polysaccharides. B) All dextrans are made up of (a1->4)-linked poly-D-glucose. C) All dextrans have (a1->3) branches. D) Some dextrans have (a1->2) branches. E) All statements are true.
B) All dextrans are made up of (a1->4)-linked poly-D-glucose
76. Why is methyl iodide used in the classical method of exhaustive methylation to determine the positions of glycosidic bonds in a linear polysaccharide? A) All free hydroxyls become unstable, allowing hydrolysis of only glycosidic bonds to occur in acid. B) All free hydroxyls become stable, allowing hydrolysis of only glycosidic bonds to occur in acid. C) All glycosidic bonds react with methyl iodide. D) All glycosidic bonds become stable for treatment with acid. E) All glycosidic bonds are hydrolyzed with methyl iodide.
B) All free hydroxyls become stable, allowing hydrolysis of only glycosidic bonds to occur in acid.
If you wanted to compare the sequence of a gene you isolated in the laboratory with a database of other genetic sequences, which tool would you use? A) linkage analysis B) BLAST C) forensic DNA analysis D) haplotype identification E) quantitative PCR
B) BLAST
Which vitamin is NOT fat soluble? A) A B) C C) D D) E E) K
B) C
If you wanted to study the effects of inactivating a specific gene on development of a mouse, which technique or system would you use to inactivate that gene? A) transfection B) CRISPR/Cas9 C) tandem affinity purification D) yeast two-hybrid E) oligonucleotide-directed mutagenesis
B) CRISPR/Cas9
Which protein forms a complex with a guide RNA to target DNA for cleavage and destruction? A) RecA B) Cas9 C) EcoRI D) Gal4p E) GST
B) Cas9
Which statement about caveolin is FALSE? A) Caveolin is an integral membrane protein. B) Caveolin induces outward membrane curvature. C) Caveolin is palmitoylated. D) Caveolin associates with cholesterol rich regions. E) Caveolin is involved in membrane trafficking and cellular signaling.
B) Caveolin induces outward membrane curvature.
11. D-Glucose is called a reducing sugar because it undergoes an oxidation-reduction reaction at the anomeric carbon. One of the products of this reaction is: A) D-galactose. B) D-gluconate. C) D-glucuronate. D) D-ribose. E) muramic acid.
B) D-gluconate.
D-Glucose is called a reducing sugar because it undergoes an oxidation-reduction reaction at the anomeric carbon. One of the products of this reaction is: A) D-galactose. B) D-gluconate. C) D-glucuronate. D) D-ribose. E) muramic acid
B) D-gluconate.
5. Which pair is epimeric? A) D-glucose and D-glucosamine B) D-glucose and D-mannose C) D-glucose and L-glucose D) D-lactose and D-sucrose E) L-mannose and L-fructose
B) D-glucose and D-mannose
Which of the following is an epimeric pair? * Refer to the structures in the lecture notes: A) D-glucose and D-glucosamine B) D-glucose and D-mannose C) D-glucose and L-glucose D) D-lactose and D-sucrose E) L-mannose and L-fructose
B) D-glucose and D-mannose
Which statement about the polymerase chain reaction (PCR) is FALSE? A) DNA amplified by PCR can be cloned. B) DNA amplification is linear in magnitude. C) Newly synthesized DNA must be heat-denatured before the next round of DNA synthesis begins. D) The boundaries of the amplified DNA segment are determined by the synthetic oligonucleotides used to prime DNA synthesis. E) The technique is sufficiently sensitive that DNA sequences can be amplified from a single animal or human hair.
B) DNA amplification is linear in magnitude.
Which of the following statements about the polymerase chain reaction (PCR) is false? A) DNA amplified by PCR can be cloned. B) DNA is amplified at many points within a cellular genome. C) Newly synthesized DNA must be heat-denatured before the next round of DNA synthesis begins. D) The boundaries of the amplified DNA segment are determined by the synthetic oligonucleotides used to prime DNA synthesis. E) The technique is sufficiently sensitive that DNA sequences can be amplified from a single animal or human hair.
B) DNA is amplified at many points within a cellular genome.
Which of the following monosaccharides is not an aldose? A) Erythrose B) Fructose C) Glucose D) Glyceraldehyde E) Ribose
B) Fructose
Which DNA sequence is a palindrome? A) AATGCC B) GGATCC C) GATATG D) CCCGCG E) AGTAGT
B) GGATCC
Which statement is TRUE regarding lipid anchors? A) Palmitoylations and prenylations both occur via thioester linkages. B) GPI anchors and prenylations are both attached to the C-terminal end of the mature protein. C) Myristoylations and palmitoylations are both reversible modifications. D) Prenylations occur exclusively on the outside leaflet of the plasma membrane.
B) GPI anchors and prenylations are both attached to the C-terminal end of the mature protein.
Which of the following does not apply to the construction or use of a DNA library? A) Determining the location of a particular DNA sequence in a DNA library requires a suitable hybridization probe. B) Genomic libraries are better for expressing gene products than cDNA libraries. C) Many segments of DNA from a cellular genome are cloned. D) Specialized DNA libraries can be made by cloning DNA copies of mRNAs. E) The DNA copies of mRNA found in a cDNA library are made by reverse transcriptase.
B) Genomic libraries are better for expressing gene products than cDNA libraries.
Which statement does NOT apply to the construction or use of a DNA library? A) Determining the location of a particular DNA sequence in a DNA library requires a suitable hybridization probe. B) Genomic libraries are better for expressing gene products than cDNA libraries. C) Many segments of DNA from a cellular genome are cloned. D) Specialized DNA libraries can be made by cloning DNA copies of mRNAs. E) The DNA copies of mRNA found in a cDNA library are made by reverse transcriptase.
B) Genomic libraries are better for expressing gene products than cDNA libraries.
Which amino acid when repeated six to ten times at the N- or C-terminal ends of a protein allows that protein to bind to Ni2+ ions? A) Glu B) His C) Ala D) Tyr E) Asp
B) His
What is meant by the term "positive-inside rule"? A) The typical transmembrane potential for plasma membranes is positive on the inside. B) Integral plasma membrane proteins commonly have positively charge amino acids on the cytosolic side. C) Concentrations of cations are usually higher inside than outside of cells. D) All of the answers are correct. E) None of the answers is correct.
B) Integral plasma membrane proteins commonly have positively charge amino acids on the cytosolic side.
Which statement BEST describes why lipids typically float on water? A) Lipids are nonpolar, while water is polar. B) Lipids have lower specific gravities than water does. C) Lipids have higher melting temperature than water does. D) Lipids store more energy than water does. E) Lipids contain carbon, while water does not.
B) Lipids have lower specific gravities than water does.
For what reason is the mitochondrial genome and the Y chromosome the easiest portions of human DNA to use to trace human evolutionary lineages? A) All human cells have mitochondria and Y chromosomes. B) Mitochondrial DNA and the Y chromosome do not undergo significant meiotic recombination. C) The size of the mitochondrial genome and the Y chromosome is small. D) Mitochondrial DNA and the Y chromosome exhibit very unstable haplotypes. E) Mitochondrial DNA is inherited along both the male and female human evolutionary. lineages
B) Mitochondrial DNA and the Y chromosome do not undergo significant meiotic recombination.
Which statement is TRUE of lipids? A) Many contain fatty acids in ester or amide linkage. B) Most are simply polymers of isoprene. C) Testosterone is an important sphingolipid found in myelin. D) They are more soluble in water than in chloroform. E) They play only passive roles as energy-storage molecules.
B) Most are simply polymers of isoprene.
59. Which statement about N-linked glycosylation is correct? A) N-linked oligosaccharides are attached to proteins one sugar at the time in the endoplasmic reticulum. B) N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation in the endoplasmic reticulum. C) N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation in the cytoplasm. D) N-linked sugars are attached to proteins as a 14 residue oligosaccharide after translation in the Golgi apparatus. E) N-linked oligosaccharides are attached to proteins one sugar at the time in the Golgi apparatus.
B) N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation in the endoplasmic reticulum.
Which statement is NOT true? A) Phospholipase A1 hydrolyzes the fatty acid from the 1-position on the glycerol backbone. B) Phospholipase B1 hydrolyzes the fatty acid from the 2-position on the glycerol backbone. C) Phospholipase C hydrolyzes the complete phospho-head group from the glycerol backbone. D) Phospholipase D hydrolyzes just the head group from the phospho-glycerol backbone.
B) Phospholipase B1 hydrolyzes the fatty acid from the 2-position on the glycerol backbone.
60. Which statement is FALSE regarding proteoglycans? A) Both syndecans and glypicans can be shed into the extracellular space. B) Proteoglycan shedding is unregulated in cells. C) A protease or phospholipase is responsible for releasing proteoglycans. D) Proteoglycan shedding is activated in cancerous cells. E) Cell features such as proteoglycans can be changed quickly.
B) Proteoglycan shedding is unregulated in cells
Which statement is NOT true of sterols? A) Cholesterol is a sterol that is commonly found in mammals. B) Sterols are commonly found in bacterial membranes. C) Sterols are more common in plasma membranes than in intracellular membranes (mitochondria, lysosomes, etc.). D) Serols are precursors of steroid hormones. E) Sterols have a structure that includes four fused rings.
B) Sterols are commonly found in bacterial membranes.
Which statement is NOT true about the chloride-bicarbonate exchanger (AE)? A) The AE protein increases the rate of bicarbonate transport across the membrane. B) The AE protein uses ATP as an energy source to drive bicarbonate transport. C) The AE protein transports chloride ions across the membrane. D) The AE protein is classified as an anti-porter. E) The AE protein spans the membrane at least 12 times.
B) The AE protein uses ATP as an energy source to drive bicarbonate transport.
Which statement is TRUE regarding the SERCA pump? A) The E1 conformation has a higher Kd value for Ca2+ than the E2 conformation. B) The P domain contains a high-energy acyl phosphate structure when it is phosphorylated. C) Three calcium ions are moved in each cycle of the transporter. D) This protein can be classified as an antiport. E) None of the statements is true.
B) The P domain contains a high-energy acyl phosphate structure when it is phosphorylated.
If a monovalent cation is being imported into a cell in the absence of a concentration gradient (i.e., the concentration for the transported cation is equal on both sides of the membrane), what could you predict about DGt? Assume the transmembrane potential is 50mV (inside negative). A) The value of DGt will have a positive sign. B) The value of DGt will have a negative sign. C) The value of DGt will likely be close to zero. D) It is impossible to predict anything about the value of DGt.
B) The value of DGt will have a negative sign.
Which feature allows certain lipid molecules to be used as colorful pigments in plants and animals? A) Their high oxygen content helps electrons circulate, which allows absorption of visible light. B) Their conjugated bond structures allow absorption of visible light. C) Their four-fused ring structure allows visible light reflection. D) Their hydrophobicity bends light around them. E) Their low specific gravities cause light to reflect from their surfaces.
B) Their conjugated bond structures allow absorption of visible light.
Which statement does NOT describe a characteristic of valinomycin? A) This can act as an antibiotic. B) This molecule is a small protein. C) This compound preferentially transports potassium ions over sodium ions. D) This compound has carbonyl groups that form coordination bonds to ions.
B) This molecule is a small protein
What common protein tertiary structure does green fluorescent protein contain? A) an a helix B) a B barrel C) a coiled coil D) a Greek key E) a four-helix bundle
B) a B barrel
What is a polylinker? A) a type of cloning vector B) a DNA fragment with multiple recognition sequences for restriction endonucleases C) a type of expression vector D) an enzyme that joins DNA molecules together E) a method of getting DNA into a cell
B) a DNA fragment with multiple recognition sequences for restriction endonucleases
The E. coli recombinant plasmid pBR322 has been widely utilized in genetic engineering experiments. pBR322 has all of the following features except: A) a number of conveniently located recognition sites for restriction enzymes. B) a number of palindromic sequences near the EcoRI site, which permit the plasmid to assume a conformation that protects newly inserted DNA from nuclease degradation. C) a replication origin, which permits it to replicate autonomously. D) resistance to two different antibiotics, which permits rapid screening for recombinant plasmids containing foreign DNA. E) small overall size, which facilitates entry of the plasmid into host cells.
B) a number of palindromic sequences near the EcoRI site, which permit the plasmid to assume a conformation that protects newly inserted DNA from nuclease degradatio
The E. coli recombinant plasmid pBR322 has been widely utilized in genetic engineering experiments. Which feature does pBR322 NOT have? A) a number of conveniently located recognition sites for restriction enzymes B) a number of palindromic sequences near the EcoRI site, which permit the plasmid to assume a conformation that protects newly inserted DNA from nuclease degradation C) a replication origin, which permits it to replicate autonomously D) resistance to two different antibiotics, which permits rapid screening for recombinant plasmids containing foreign DNA E) small overall size, which facilitates entry of the plasmid into host cells
B) a number of palindromic sequences near the EcoRI site, which permit the plasmid to assume a conformation that protects newly inserted DNA from nuclease degradation
A common cloning strategy for introducing foreign genes into plants with Agrobacterium employs all the following features except: A) a selectable antibiotic marker such as kanamycin resistance. B) a shuttle vector with 25 bp T-DNA repeats flanking the foreign gene of choice. C) a Ti plasmid lacking its T-DNA segment. D) active vir gene products from the altered Ti plasmid. E) an ability to induce crown gall formation in infected leaves.
B) a shuttle vector with 25 bp T-DNA repeats flanking the foreign gene of choice.
If you want to determine what other proteins might be interacting with the protein you have been studying, what type of fusion tag would you add to your protein to aid in purification of both the protein you have been studying and the proteins interacting with it? A) a green fluorescent protein fusion tag B) a tandem affinity purification tag C) a maltose-binding protein tag D) an epitope tag E) a B-galactosidase tag
B) a tandem affinity
Consider the transport of glucose into an erythrocyte by facilitated diffusion. What is the free-energy change for glucose uptake into the cell when the glucose concentrations are 5 mM on the outside and 0.1 mM on the inside? (These values may be of use to you: R = 8.315 J/mol · K; T = 298 K; Á (Faraday constant) = 96,480 J/V; N = 6.022 × 1023 /mol.) A) less than 2 kJ/mol B) about 10 kJ/mol C) about 30 kJ/mol D) about -30 kJoule/mol E) It is impossible to calculate without knowledge of the membrane potential.
B) about 10 kJ/mol
The fluorophore in GFP is derived from covalent modifications of which structures located at the interior of the protein? A) coenzymes B) amino acids C) prosthetic groups D) metal ions E) nucleotides
B) amino acids
What kind of bond can link a myristoyl anchor to a polypeptide? A) an ester bond to an internal serine B) an amide bond to a glycine C) a thioester to a cysteine D) an ester bond to the C-terminus E) a thioether bond to a cysteine side chain
B) an amide bond to a glycine
Fatty acids are attached to sphingosine by what type of chemical linkage? A) an ether linkage B) an amide linkage C) an ester linkage D) a peroxide linkage E) a alkyl linkage
B) an amide linkage
For the process of solute transport, the constant Kt is: A) analogous to Ka for ionization of a weak acid. B) analogous to Km for an enzyme-catalyzed reaction. C) analogous to Vmax for an enzyme reaction D) proportional to the number of molecules of glucose transporter per cell. E) the maximum rate of glucose transport.
B) analogous to Km for an enzyme-catalyzed reaction.
31. The transformation of a monosaccharide into its ______ occurs easily and does not require the assistance of a catalyst. A) epimer B) anomer C) sugar alcohol D) diastereomer E) none of the above
B) anomer
Movement of water across membranes is facilitated by proteins called: A) annexins. B) aquaporins. C) hydropermeases. D) selectins. E) transportins.
B) aquaporins.
Which compound can be cleaved in half to generate a molecule important in vision? A) calcitol B) beta-carotene C) arachidonic acid D) tocopherol E) isoprene
B) beta-carotene
Fatty acids are a component of: A) carotenes. B) cerebrosides. C) sterols. D) vitamin D. E) vitamin K.
B) cerebrosides.
The steroid hormones testosterone and beta-estradiol are derived from which lipid molecule? A) phosphatidylcholine B) cholesterol C) lipoxin A D) arachidonic acid E) geraniol
B) cholesterol
What feature do Tay-Sachs disease, Fabry disease, and Niemann-Pick disease have in common? A) defects in enzymes responsible for synthesizing membrane lipids B) defects in enzymes responsible for breaking down membrane lipids in the lysosomes C) hyperactive membrane lipid degradation enzymes D) defects in enzymes responsible for cholesterol synthesis E) All of the answers are correct.
B) defects in enzymes responsible for breaking down membrane lipids in the lysosomes
The biological role of restriction enzymes is to: A) aid recombinant DNA research. B) degrade foreign DNA that enters a bacterium. C) make bacteria resistant to antibiotics. D) restrict the damage to DNA by ultraviolet light. E) restrict the size of DNA in certain bacteria.
B) degrade foreign DNA that enters a bacterium.
The biological role of restriction enzymes is to: A) aid recombinant DNA research. B) degrade foreign DNA that enters a bacterium. C) make bacteria resistant to antibiotics. D) restrict the damage to DNA by ultraviolet light. E) restrict the size of DNA in certain bacteria.
B) degrade foreign DNA that enters a bacterium.
To make an DNA copy of a RNA sequence, you need the reverse transcriptase enzyme and an oligonucleotide primer made of which nucleotide? A) deoxyadenosine B) deoxythymine C) deoxycytosine D) deoxyuridine E) deoxyguanosine
B) deoxythymine
Waxes are BEST described as: A) esters of glycerol and three fatty acids. B) esters of one long-chain fatty acid and one long-chain alcohol. C) polyunsaturated long-chain fatty acids. D) esters of two long-chain fatty acids. E) ethers of glycerol and short-chain alcohols.
B) esters of one long-chain fatty acid and one long-chain alcohol.
Biological waxes are all: A) triesters of glycerol and palmitic acid. B) esters of single fatty acids with long-chain alcohols. C) triesters of glycerol and three long chain saturated fatty acids. D) sphingolipids. E) None of the answers is correct.
B) esters of single fatty acids with long-chain alcohols.
A compound containing N-acetylneuraminic acid (sialic acid) is: A) cardiolipin. B) ganglioside GM2. C) phosphatidylcholine. D) platelet-activating factor. E) sphingomyelin.
B) ganglioside GM2.
Which molecule is MOST commonly used as a backbone the linkage of three fatty acids to form fats? A) glycogen B) glycerol C) sphingosine D) glucose E) phosphoglycerol
B) glycerol
20. The basic structure of a proteoglycan consists of a core protein and a: A) glycolipid. B) glycosaminoglycan. C) lectin. D) lipopolysaccharide. E) peptidoglycan.
B) glycosaminoglycan
17. The basic structure of a proteoglycan consists of a core protein and a: A) glycolipid. B) glycosaminoglycan. C) lectin. D) lipopolysaccharide. E) peptidoglycan.
B) glycosaminoglycan.
The basic structure of a proteoglycan consists of a core protein and a: A) glycolipid. B) glycosaminoglycan. C) lectin. D) lipopolysaccharide. E) peptidoglycan.
B) glycosaminoglycan.
Which types of membrane lipids are modified to determine blood type in humans? A) phosphatidylserines B) glycosphingolipids C) galactolipids D) plasmalogens E) sphingomyelins
B) glycosphingolipids
Groups of single nucleotide polymorphisms that are usually inherited together from one parent are called: A) genotypes. B) haplotypes. C) phenotypes. D) karyotypes. E) cytotypes.
B) haplotypes.
Which method can be used to visualize lipids that have been separated by thin-layer chromatography by reversibly reacting with double bonds in fatty acids? A) ethanol B) iodine fumes C) low-wavelength UV light D) rhodamine E) ethidium bromide
B) iodine fumes
Platelet-activating factor is much more water soluble than most other glycerophospholipids due to which feature? A) its ether-linked alkyl chain at the C-1 of glycerol B) its ester-linked acetic acid at the C-2 of glycerol C) its ethanolamine head group D) its lack of any long alkyl chains linked to glycerol E) the presence of sphingosine, rather than glycerol, as a lipid backbone
B) its ester-linked acetic acid at the C-2 of glycerol
Human adipocytes contain which enzyme that catalyzes the breakdown of triacylglycerols? A) glycerase B) lipase C) fatase D) esterase E) triacylase
B) lipase
The study and classification of the complete set of lipids produced in an organisms is called: A) proteomics. B) lipidomics. C) genomics. D) lipidification. E) fatification.
B) lipidomics.
Which factor is NOT a consequence of partial hydrogenation of vegetable oils? A) longer shelf life B) lower melting temperature C) reduction of some cis double bonds to single bonds D) conversion of some cis double bonds to trans double bonds E) increased risk of cardiovascular disease upon consumption by humans
B) lower melting temperature
If you wanted to analyze membrane lipids from a biological sample, which solvent would MOST effectively extract those lipids? A) benzene B) methanol C) water D) chloroform E) ethyl ether
B) methanol
In high-performance liquid chromatography of lipid mixtures using a column packed with a silica gel, which types of lipids will elute first? A) positively charged lipids B) neutral lipids C) negatively charged lipids D) polar lipids E) zwitterionic lipids
B) neutral lipids
What is the CORRECT order of steps in vesicle fusion to a cell? A) outer leaflet lipid mixing, content release, inner leaflet lipid mixing B) outer leaflet lipid mixing, inner leaflet lipid mixing, content release C) inner leaflet lipid mixing, content release, outer leaflet lipid mixing D) inner-leaflet lipid mixing, outer leaflet lipid mixing, content release E) content release, inner leaflet lipid mixing, outer leaflet lipid mixing
B) outer leaflet lipid mixing, inner leaflet lipid mixing, content release
Genes that have sequence and functional relationships to each other within a single species are called: A) orthologs. B) paralogs. C) analogs. D) homologs. E) lincolnlogs.
B) paralogs.
74. The severalfold greater incidence of gastric ulcers in _____ is due in part to a surface lectin in the bacterium Helicobacter pylori. A) men versus women B) people with a certain blood type C) people of a certain age D) people with autoimmune diseases E) None of the answers is correct.
B) people with a certain blood type
Nonsteroidal anti-inflammatory drugs (NSAIDS) like aspirin and ibuprofen act by blocking production of: A) biological waxes B) prostaglandins C) sphingolipids D) vitamin D E) None of the answers is correct.
B) prostaglandins
Which eicosanoids contains a five-carbon ring as part of its structure? A) thromboxanes B) prostaglandins C) lipoxins D) leukotrienes E) arachidonates
B) prostaglandins
Which technique can be used to estimate the relative copy numbers of particular DNA sequences in a sample? A) reverse transcriptase PCR B) quantitative PCR C) some gel based analysis such as with the Bioanalyzer and Fragment Analyzer gel band density are used in calculating concentration in a lot of labs. D) normal PCR E) in vitro transcription
B) quantitative PCR
Current estimates indicate that _____% of the human genome is translated into protein. A) less than 0.5 B) roughly 1.5 C) roughly 10 D) roughly 25 E) more than 50
B) roughly 1.5
53. Which of the following is a mixture of two types of polymers? A) cellulose B) starch C) chitin D) glycogen E) amylose
B) starch
Which tag is NOT used to study protein function? A) green fluorescent protein (GFP) B) synteny tag C) tandem affinity purification (TAP) D) Gal4p DNA binding domain E) Gal4p activation domain
B) synteny tag
Compensatory mutations in genes for noncoding RNAs indicate that: A) these genes are not important for the function of the organism. B) the secondary structure of the noncoding RNA is important for its function. C) the noncoding RNA is not undergoing accelerated evolution. D) All of the answers are correct. E) None of the answers is correct.
B) the secondary structure of the noncoding RNA is important for its function.
Which types of signaling lipids are produced by platelets to aid in the formation of blood clots? A) prostaglandins B) thromboxanes C) arachidonates D) lipoxins E) leukotrienes
B) thromboxanes
Which solvent is NOT used to dissolve lipids? A) ethyl ether B) water C) benzene D) methanol E) chloroform
B) water
A method of determining if proteins are interacting in vivo that makes use of a transcription factor involved in regulating galactose metabolism genes is: A) a DNA microarray. B) yeast two-hybrid analysis. C) tandem affinity purification. D) immunofluorescence. E) quantitiative PCR.
B) yeast two-hybrid analysis.
52. Which polysaccharide is found in a helically coiled conformation? A) chitin B) α-amylose C) cellulose D) lignin E) none of the above
B) α-amylose
31. The transformation of a monosaccharide into its ______ occurs easily and does not require the assistance of a catalyst. A) epimer B) anomer C) sugar alcohol D) diastereomer E) none of the above
B- Anomer
Which of the following is a mixture of two types of polymers? A) cellulose B) starch C) chitin D) glycogen E) amylose
B- Starch is a mixture of a- amylose and amylopectin
Which polysaccharide is found in a helically coiled conformation? A) chitin B) α-amylose C) cellulose D) lignin E) none of the above
B- a-amylose
Lactose monomers
B-Galactose + B-Glucose via a 1-4 linkage
How many stereoisomers are possible for a ketopentose such as ribulose? A. 2 B. 4 C. 8 D. 16
B. 4
Which of the following characterizes an asymmetric carbon? A. It has four identical groups attached to it B. It has four different groups attached to it C. It has at least one carboxyl and one amino group attached to it D. It has two heavy groups on one side and two light groups on the other
B. It has four different groups attached to it
D) short-chain fatty acids and decreasing the saturation of their membrane lipids.
Bacterial cells change the fluidity of their lipid membranes to adapt to growth at lower temperatures by increasing the synthesis of: A) long-chain fatty acids and increasing the saturation of their membrane lipids. B) both long- and short-chain fatty acids. C) long-chain fatty acids and decreasing the saturation of their membrane lipids. D) short-chain fatty acids and decreasing the saturation of their membrane lipids.
When cloning a foreign DNA fragment into a plasmid, it is often useful to insert the fragment at a site that interrupts a selectable marker (such as the tetracycline-resistance gene of pBR322). The loss of function of the interrupted gene can be used to identify clones containing recombinant plasmids with foreign DNA. With a yeast artificial chromosome (YAC) vector, it is not necessary to do this; the researcher can still distinguish vectors that incorporate large foreign DNA fragments from those that do not. How are these recombinant vectors identified?
Bacteriophage λ DNA can be packaged into infectious phage particles only if it is between 40,000 and 53,000 bp long. The two essential pieces of the bacteriophage λ vector have about 30,000 bp in all, so the vector is not packaged into phage particles unless the additional, foreign DNA is of sufficient length: 10,000 to 23,000 bp.
3. Briefly explain the difference between base-excision repair and nucleotide-excision repair.
Base excision involves removing only the defective base from the DNA by cleavage of the Nglycosidic linkage of the base to deoxyribose. This leaves an apurinic or apyrimidinic site. In a subsequent step, the abasic nucleotide is removed and the missing nucleotide is replaced by DNA polymerase 1. Nucleotide excision involves removing the defective base together with its deoxyribose and phosphate (as well as some neighboring nucleotides) by cleavage of phosphodiester bonds in the DNA chain in the first step.
Explain why the oligosaccharides of glycoproteins are more complicated to describe than amino acids or nucleotide sequences.
Because different molecules of the same glycoprotein may differ in sequences, locations, and numbers of covalently attached carbohydrates
Why is this statement false. The lipid composition (type and percent) of all membranes of eukaryotic cells is essentially the same.
Because it cannot be the same for tissues, organisms and organelles
The number of structurally different polysaccharides that can be made with 20 different monosaccharides is far greater than the number of different polypeptides that can be made with 20 different amino acids, if both polymers contain an equal number (say 100) of total residues. Explain why.
Because virtually all peptides are linear (i.e., are formed with peptide bonds between the alpha-carboxyl and alpha-amino groups), the variability of peptides is limited by the number of different subunits. Polysaccharides can be linear or branched, can be alpha- or beta-linked, and can be joined 1--> 4, 1 --> 3, 1--> 6, etc. The number of different ways to arrange 20 different sugars in a branched oligosaccharide is therefore much larger than the number of different ways a peptide could be made with an equal number of residues.
red blood cells
Blood cells that carry oxygen to body cells and take away carbon dioxide. Contain a lot of iron that make blood red/orange and allow blood to be seen and respond to indicator tests.
white blood cells
Blood cells that perform the function of destroying disease-causing microorganisms. Their nuclei contain DNA
Why does the Na+/K+ antiporter and the Ca2+ antiporter carry out unidirectional transport with respect to each ion across the plasma membrane?
Both are building up potential energy for physiological functions by creating a concentration gradient. Na+/K+ coupled with SGLT for the cell to intake glucose Ca2+ used to prepare for rapid Ca2+ influx needed in muscle contraction, neurotransmitter release, and glycogen breakdown
Describe the differences between a proteoglycan and a glycoprotein.
Both are made up of proteins and polysaccharides. In proteoglycans, the carbohydrate moiety dominates, constituting 95% or more of the mass of the complex. In glycoproteins, the protein constitutes a larger fraction, generally 50% or more of the total mass.
Triacylglycerols are composed of:
Both glycerol backbone and three fatty acids
How are a nucleoside and a nucleotide similar and how are they different?
Both have a nitrogenous base and a pentose; nucleotides also have a phosphate group, which nucleosides lack.
What is an amphipathic compound? Explain how such compounds contribute to the structure of biological membranes.
Both hydrophilic and hydrophobic. dissolves in water and forms aggregate or membrane
Compare the structure and activity of a membrane transport protein that transports a polar substance across a membrane with a typical soluble enzyme. How are transporter and enzyme similar? How are they different?
Both proteins have domains that specifically recognize and bind to their substrates via weak interactions; they both therefore mediate processes that are stereospecific and saturable. The membrane transporter usually spans the membrane, having one or several hydrophobic domains that interact with the hydrophobic acyl chains of fatty acids in the interior of the lipid bilayer. Soluble enzymes tend to have their hydrophobic residues buried within their interiors, and their hydrophilic residues on the surface, where they interact with water.
16. Which statement about starch and glycogen is FALSE? A) Amylose is unbranched, amylopectin and glycogen contain many (a1 ->6) branches. B) Both are homopolymers of glucose. C) Both serve primarily as structural elements in cell walls. D) Both starch and glycogen are stored intracellularly as insoluble granules. E) Glycogen is more extensively branched than starch.
Both serve primarily as structural elements in cell walls
Which of the following statements about starch and glycogen is false?
Both serve primarily as structural elements in cell walls.
10. In base-excision repair, the first enzyme to act is: A) AP endonuclease. B) Dam methylase. C) DNA glycosylase. D) DNA ligase. E) DNA polymerase.
C
3. When performing PCR, what is the advantage to using a DNA polymerase isolated from a thermophilic organism? A) The PCR reaction does not need to be cooled below the denaturation step. B) The PCR reaction does not need primers to proceed. C) The PCR reaction does not need to have fresh enzyme added after each cycle. D) The PCR reaction does not need to have fresh dNTPs added after each cycle. E) The PCR reaction does not need to have fresh template DNA added after each cycle.
C
4. How did the addition of different-colored fluorescent tags on each ddNTP improve the Sanger DNA sequencing method? A) Scientists did not need to use a heat-stable DNA polymerase. B) A DNA primer was no longer needed. C) All four ddNTPs could be incorporated into a single reaction. D) Scientists could now use short tandem repeats to assist their sequencing. E) The template DNA could now be double stranded.
C
A ligand-gated ion channel (such as the nicotinic acetylcholine receptor) is: A) a charged lipid in the membrane bilayer that allows ions to pass through. B) a membrane protein that permits a ligand to pass through the membrane only when opened by the appropriate ion. C) a membrane protein that permits an ion to pass through the membrane only when opened by the appropriate ligand. D) a molecule that binds to the membrane thereby allowing ions to pass through. E) always requires a second ligand to close the channel once it is opened.
C
A process not involving the fusion of two membranes or two regions of the same membrane is: A) endocytosis. B) entry of enveloped viruses into cells. C) entry of glucose into cells. D) exocytosis. E) reproductive budding in yeast
C
A tetraplex of DNA is MOST likely to form with which residue? A) Adenosine B) Thymidine C) Guanosine D) Cytidine E) A tetraplex is equally likely with all bases.
C
About what percentage of mammalian proteins are glycosylated? A) 5% B) 15% C) 50% D) 90% E) 95%
C
According to the sequence below (note that the DNA is written in the 5′ → 3′ direction, and the gene of interest is underlined), the BEST reverse primer to use for this gene is: A) 5′ ATTGAATCCTTGGCT GGTGA 3′. B) ′ ATTGAATCCTTGGCT GGTGA 5′. C) 5′ TCACCAGCCAAGGATTCAAT 3′. D) 3′ TCACCAGCCAAGGATTCAAT 5′. E) 3′ GGTGAGTCGG TTCAATTCGT 5′.
C
An example of a glycerophospholipid that is involved in cell signaling is: A) arachidonic acid. B) ceramide. C) phosphatidylinositol. D) testosterone. E) vitamin A (retinol).
C
An example of a glycerophospholipid that is involved in cell signaling is: A) arachidonic acid. B) ceramide. C) phosphatidylinositol. D) testosterone. E) vitamin A (retinol).
C
An integral membrane protein can be extracted with: A) a buffer of alkaline or acid pH. B) a chelating agent that removes divalent cations. C) a solution containing detergent. D) a solution of high ionic strength. E) hot water.
C
Assuming 20 common amino acids and 20 different monosaccharide subunits that are available for construction of polypeptides and oligosaccharides, respectively, compare the possible variations of these macromolecules using a hypothetical hexameric oligomer. A) 206 possible variations for both polypeptides and oligosaccharides B) 6 20 variations for both polypeptide and oligosaccharides C) 206 variations for polypeptides and orders of magnitude greater for oligosaccharides D) 206 variations for oligosaccharides and orders of magnitude greater for polypeptides E) It cannot be determined from the information given.
C
At equilibrium in solution, D-glucose consists of a mixture of its anomers. Which statement most accurately describes the solution? A) consists of approximately equal amounts of the - and -anomers B) the -anomer is more stable and is slightly preferred over the -anomer C) the -anomer predominates over the -anomer by a ratio of approximately 2:1 D) straight-chain form is present in high concentration E) none of the above
C
Commercial vegetable oils can be converted from liquid forms to solid forms and have their shelf lives increased due to which process? A) partial desaturation B) unsaturation C) partial hydrogenation D) hydrolysis E) complete esterification
C
Double-stranded DNA was isolated from a cryophilic bacterium. Which choice is MOST likely to represent a possible composition of its bases? A) 30% A:T, 70% G:C B) 50% A:T, 50% G:C C) 70% A:T, 30% G:C D) Any of these choices is a likely composition. E) None of these choices is a likely composition.
C
Double-stranded regions of RNA: A) are less stable than double-stranded regions of DNA. B) can be observed in the laboratory, but probably have no biological relevance. C) can form between two self-complementary regions of the same single strand of RNA. D) do not occur. E) have the two strands arranged in parallel (unlike those of DNA, which are antiparallel).
C
Double-stranded regions of RNA: A) are less stable than double-stranded regions of DNA. B) can be observed in the laboratory, but probably have no biological relevance. C) can form between two self-complementary regions of the same single strand of RNA. D) do not occur. E) have the two strands arranged in parallel (unlike those of DNA, which are antiparallel).
C
During which process are chemical bonds NOT broken? A) mutarotation B) interconverting between two configurations C) interconverting between two conformations D) interconverting between two anomers E) None of the answers is correct: all involve breaking a chemical bond.
C
Following complete hydrolysis of a sample of glycogen and a sample of cellulose, which statement must be TRUE? A) The glycogen sample is more soluble than the cellulose sample. B) The cellulose sample is more soluble than the glycogen sample. C) Both samples consist of a mixture of a-D-glucose and b-D-glucose. D) The glycogen sample has a higher ratio of a-D-glucose than the cellulose sample. E) The cellulose sample contains only b-D-glucose.
C
For the helix in double-stranded B-form DNA, the majority of the stability can be attributed to: A) base-pairing interactions via H-bonds. B) interactions along the phosphate backbone. C) base-stacking interactions via van-der-Waals interactions. D) covalent bonds between adjacent bases in one strand. E) ionic interactions with metal ions.
C
For the helix in double-stranded B-form DNA, the majority of the stability can be attributed to: A) base-pairing interactions via H-bonds. B) interactions along the phosphate backbone. C) base-stacking interactions via van-der-Waals interactions. D) covalent bonds between adjacent bases in one strand. E) ionic interactions with metal ions.
C
Hemoglobin glycation is a process where _____ is _____ attached to hemoglobin. A) glycerol; covalently B) glucose; enzymatically C) glucose; nonenzymatically D) N-acetyl-galactosamine; enzymatically E) galactose; nonenzymatically
C
Hemoglobin glycation is a process where is attached to hemoglobin. A) glycerol; covalently B) glucose; enzymatically C) glucose; non-enzymatically D) N-acetyl-galactosamine; enzymatically E) galactose; non-enzymatically
C
How did the addition of different-colored fluorescent tags on each ddNTP improve the Sanger DNA sequencing method? A) Scientists did not need to use a heat-stable DNA polymerase. B) A DNA primer was no longer needed. C) All four ddNTPs could be incorporated into a single reaction. D) Scientists could now use short tandem repeats to assist their sequencing. E) The template DNA could now be double stranded.
C
In nucleotides and nucleic acids, syn and anti conformations relate to: A) base stereoisomers. B) rotation around the phosphodiester bond. C) rotation around the sugar-base bond. D) sugar pucker. E) sugar stereoisomers.
C
In nucleotides and nucleic acids, syn and anti conformations relate to: A) base stereoisomers. B) rotation around the phosphodiester bond. C) rotation around the sugar-base bond. D) sugar pucker. E) sugar stereoisomers
C
Integrins are: A) membrane proteins that are involved in ion transport. B) membrane proteins that are involved in sugar transport. C) membrane proteins that mediate cell adhesion. D) proteins of the extracellular matrix that bind to cell surface proteins. E) proteins that are found at the membrane-cytoplasm interface.
C
It is useful to analyze hemoglobin glycation to determine a(n): A) single-time measurement of blood glucose levels. B) single-time measurement of blood glycogen levels. C) average blood glucose level over days or weeks. D) average blood glycogen level over days or weeks. E) None of the answers is correct.
C
The 5′ → 3′ orientation of a DNA or RNA chain refers to the: A) linkage of the phosphodiester bonds between the nucleotides. B) location of the attachment of the nitrogenous base on the pentose sugar. C) positions of the chain that do not have a nucleotide attached. D) positions of the chain that do not have a phosphate group attached. E) respective net charges found at each end of the chain.
C
The MOST striking difference between A-, B-, and Z-form DNA is that: A) A -orm does not contain a major and minor groove. B) B-form has the smallest helical diameter. C) Z-form is left handed. D) B-form has the greatest number of base pairs per helical turn. E) A-form maximizes base stacking interactions.
C
The chemical difference between a nucleotide and a nucleoside is that: A) a different nitrogenous base is added to each. B) nucleotides do not contain phosphate groups. C) nucleosides do not contain phosphate groups. D) nucleotides do not contain pentose sugars E) nucleosides do not contain pentose sugars.
C
The chemical moiety of nucleotides that allows quantification of concentration via UV absorbance is the: A) phosphate group(s). B) pentose sugar. C) nitrogenous base. D) hydroxyl group(s) on the pentose sugar. E) None of the answers is correct.
C
The fluidity of the lipid side chains in the interior of a bilayer is generally increased by: A) a decrease in temperature. B) an increase in fatty acyl chain length. C) an increase in the number of double bonds in fatty acids. D) an increase in the percentage of phosphatidyl ethanolamine E) the binding of water to the fatty acyl side chains.
C
The inner (plasma) membrane of E. coli is about 75% lipid and 25% protein by weight. How many molecules of membrane lipid are there for each molecule of protein? (Assume that the average protein is Mr 50,000 and the average lipid is 750.) Pg 372 A) 1 B) 50 C) 200 D) 10,000 E) 50,000
C
The reference compound for naming D and L isomers of sugars is: A) fructose. B) glucose. C) glyceraldehyde. D) ribose. E) sucrose.
C
The reference compound for naming D and L isomers of sugars is: A) fructose. B) glucose. C) glyceraldehyde. D) ribose. E) sucrose.
C
To possess optical activity, a compound must be: A) a carbohydrate. B) a hexose. C) asymmetric. D) colored. E) D-glucose.
C
To possess optical activity, a compound must be: A) a carbohydrate. B) a hexose. C) asymmetric. D) colored. E) D-glucose.
C
What is the abbreviated nomenclature for octadecanoic acid with two double bonds? A) 16:1 B) 14:2 C) 18:2 D) 18:0 E) 18:1
C
When a bacterium such as E. coli is shifted from a warmer growth temperature to a cooler growth temperature, it compensates by: A) increasing its metabolic rate to generate more heat. B) putting longer-chain fatty acids into its membranes. C) putting more unsaturated fatty acids into its membranes. D) shifting from aerobic to anaerobic metabolism. E) synthesizing thicker membranes to insulate the cell.
C
When performing PCR, what is the advantage to using a DNA polymerase isolated from a thermophilic organism? A) The PCR reaction does not need to be cooled below the denaturation step. B) The PCR reaction does not need primers to proceed. C) The PCR reaction does not need to have fresh enzyme added after each cycle. D) The PCR reaction does not need to have fresh dNTPs added after each cycle. E) The PCR reaction does not need to have fresh template DNA added after each cycle.
C
When the linear form of glucose cyclizes, the product is a(n): A) anhydride. B) glycoside. C) hemiacetal. D) lactone. E) oligosaccharide.
C
When the linear form of glucose cyclizes, the product is a(n): A) anhydride. B) glycoside. C) hemiacetal. D) lactone. E) oligosaccharide.
C
Which conformation is NOT permitted due to steric interference? A) purine in syn conformation B) purine in anti conformation C) pyrimidine in syn conformation D) pyrimidine in anti conformation E) All of these conformations are permitted.
C
Which glycerophospholipid has a net charge of zero at pH 7? A) phosphatidylserine B) phasphatidic acid C) phosphatidylcholine D) phosphatidylglycerol E) phosphatidylinositol 4,5-bisphosphate
C
Which glycosaminoglycan is found in the synovial fluid of joints? A) chondroitin sulfate B) dermatan sulfate C) hyaluronan D) keratin sulfate E) heparan sulfate
C
Which membrane lipid serves as a reservoir of messenger molecules for signal transduction? A) taruocholic acid (TA) B) phosphatidylserine (PS) C) phosphatidylinositol 4,5-bisphosphate (PIP2 ) D) thromboxane A2 (TXA2 ) E) sphingomyelin (SM)
C
Which monosaccharides is NOT a carboxylic acid? A) 6-phospho-gluconate B) gluconate C) glucose D) glucuronate E) muramic acid
C
Which of the following is a heteropolysaccharide? A) amylopectin B) cellulose C) pectin D) chitin E) none of the above
C
Which of the following is not true of all naturally occurring DNA? A) Deoxyribose units are connected by 3',5'-phosphodiester bonds. B) The amount of A always equals the amount of T. C) The ratio A+T/G+C is constant for all natural DNAs. D) The two complementary strands are antiparallel. E) Two hydrogen bonds form between A and T.
C
Which of the following monosaccharides is not a carboxylic acid? A) 6-phospho-gluconate B) gluconate C) glucose D) glucuronate E) muramic acid
C
Which of the following polysaccharides cannot be digested by mammalian salivary, gastric, or pancreatic enzymes? A) amylopectin B) amylose C) chitin D) glycogen E) starch
C
Which of the following statements about starch and glycogen is false? A) Amylose is unbranched; amylopectin and glycogen contain many (alpha1→ 6) branches. B) Both are homopolymers of glucose. C) Both serve primarily as structural elements in cell walls. D) Both starch and glycogen are stored intracellularly as insoluble granules. E) Glycogen is more extensively branched than starch.
C
Which of the following statements concerning the tautomeric forms of bases such as uracil is correct? A) The double-lactim form contains a ketone group. B) The lactam form contains an alcohol group. C) The lactam form predominates at neutral pH. D) Formation of the lactim from the lactam is irreversible. E) The lactim and double-lactim forms are stabilized at high pH
C
Which of these is not an artificial sweetener? A) saccharine B) aspartame C) maltose D) acesulfame E) alitame
C
Which of these statements about the composition of membranes is true? A) All biological membranes contain cholesterol. B) Free fatty acids are major components of all membranes. C) The inner and outer membranes of mitochondria have different protein compositions. D) The lipid composition of all membranes of eukaryotic cells is essentially the same. E) The lipid:protein ratio varies from about 1:4 to 4:1
C
Which one of the following statements about membranes is true? Pg 372 A) Most plasma membranes contain more than 70% proteins. B) Sterol lipids are common in bacterial plasma membranes. C) Sterol lipids are common in human cell plasma membranes. D) Sterol lipids are common in plant cell plasma membranes. E) The plasma membranes of all cell types within a particular organism have basically the same lipid and protein composition.
C
Which sequence is the CORRECT one for leukocyte extravasion in the inflammatory response? A) integrin binding ® selectin binding ® adhesion ® arrest ® extravasion B) adhesion ® integrin binding ® selectin binding ® arrest ® extravasion C) selectin binding ® integrin binding ® adhesion ® arrest ® extravasion D) integrin binding ® adhesion ® selectin binding ® arrest ® extravasion E) selectin binding ® adhesion ® integrin binding ® arrest ® extravasion
C
Which solvent is a commonly used to extract all the lipids from homogenized tissue samples and subsequent separation of the lipids from the proteins and sugars present in those samples? A) ethanol B) benzene C) a mixture of chloroform, methanol, and water D) water E) a mixture of chloroform and benzene
C
Which statement about cellulose is TRUE? A) Cellulose is the main storage polysaccharide of animal cells. B) Cellulose is a highly branched polysaccharide. C) Cellulose is a homopolysaccharide. D) Cellulose glucose residues contain the same configuration as amylose glucose residues. E) Cellulose cannot be broken down by invertebrate animals.
C
Which statement about heparan sulfate is NOT true? A) Sulfation of heparan sulfate to form NS domains is important for its role as an anticoagulant. B) Heparan sulfate can promote protein-protein interactions via the NS domains. C) The secondary structure of heparan sulfate is completely random. D) The NA domains of heparan sulfate contain no sulfation. E) The core repeating structure of heparan sulfate is made up of alternating GlcNAc and GlcA.
C
Which statement about starch and glycogen is FALSE? A) Amylose is unbranched; amylopectin and glycogen contain many (a1 ® 6) branches. B) Both are homopolymers of glucose. C) Both serve primarily as structural elements in cell walls. D) Both starch and glycogen are stored intracellularly as insoluble granules. E) Glycogen is more extensively branched than starch.
C
Which statement accurately describes the interactions between the molecules thrombin, antithrombin, and heparan sulfate? A) In the absence of heparan sulfate, antithrombin binds tightly to thrombin, inhibiting blood coagulation. B) In the absence of heparan sulfate, antithrombin cannot bind to thrombin, inhibiting blood coagulation. C) In the presence of heparan sulfate, antithrombin binds tightly to thrombin, inhibiting blood coagulation. D) In the presence of heparan sulfate, antithrombin cannot bind to thrombin, enabling blood coagulation. E) In the presence of heparan sulfate, antithrombin binds tightly to thrombin, enabling blood coagulation.
C
Which statement concerning sialic acid residues on glycoproteins is TRUE? A) Sialic residues on erythrocytes are recognized by lectins, leading to removal of the erythrocytes. B) Sialic residues on ceruloplasmin are recognized by lectins, leading to removal of ceruloplasmin. C) Sialic residues are removed by neuraminidases. D) The antiviral drug oseltamavir accelerates the removal of sialic acid residues. E) All of the statements are true.
C
Which statement concerning the tautomeric forms of bases such as uracil is CORRECT? A) The double-lactim form contains a ketone group. B) The lactam form contains an alcohol group. C) The lactam form predominates at neutral pH. D) Formation of the lactim from the lactam is irreversible. E) The lactim and double-lactim forms are stabilized at high pH.
C
Which statement is NOT true of all naturally occurring DNA? A) Deoxyribose units are connected by 3',5'-phosphodiester bonds. B) The amount of A always equals the amount of T. C) The ratio A+T/G+C is constant for all natural DNAs. D) The two complementary strands are antiparallel. E) Two hydrogen bonds form between A and T.
C
Which technique is NOT commonly used to analyze lipid composition? A) selective extraction using apolar solvents B) adsorption chromatography C) x-ray crystallography D) hydrolysis using enzymes with specificity for certain linkages E) mass spectroscopy
C
Which technique used to analyze lipids is the fastest but may not be the most accurate? A) thin-layer chromatography B) high-performance chromatography C) nuclear magnetic resonance D) direct mass spectrometry E) gas chromatography
C
Which term BEST describes the polarity of membrane lipids? A) ambidextrous B) completely nonpolar C) amphipathic D) completely polar E) amphibolic
C
Which type of chemical linkage is used to join fatty acids to glycerol? A) an ether linkage B) a peptide bond C) an ester linkage D) a double bond E) a peroxide bond
C
Which types of membrane lipids make up 70% to 80% of the total membrane lipids in a vascular plant? A) phosphatidylserines B) glycosphingolipids C) galactolipids D) plasmalogens E) sphingomyelins
C
Which vitamin is NOT fat soluble?
C
Which vitamin is derived from cholesterol? A) A B) B12 C) D D) E E) K
C
Which vitamin is derived from cholesterol? A) A B) B12 C) D D) E E) K
C
Why are ruminant animals like cows able to digest cellulose? A) Their teeth are able to grind the polysaccharide into smaller saccharides. B) Their stomachs secrete the enzyme cellulose. C) They have a stomach compartment that houses symbiotic microorganisms that can hydrolyze cellulose. D) Their small intestine contains an environment suitable to hydrolyze cellulose. E) All animals can digest cellulose.
C
You are working in a laboratory trying to design a drug that specifically binds to the surface of certain cells. To which membrane lipid constituents should your drug bind in order to achieve this specificity? A) sphingomyelins B) phosphatidylcholines C) gangliosides D) triacylglycerols E) sterols
C
_____ is the determination of the full component and function of sugar-containing molecules in a cell or tissue. A) Genomics B) Proteomics C) Glycomics D) Metabolomics E) Lipidomics
C
Which of these is not an artificial sweetener? A) saccharine B) aspartame C) maltose D) acesulfame E) alitame
C - Maltose
Which of the following sugars is not a reducing sugar? A) glucose B) ribose C) sucrose D) starch E) galactose
C - Sucrose
The bonding of alcohols to the anomeric center of a carbohydrate results in the formation of a(n) __________ bond. A) anomeric B) amide C) glycosidic D) ester E) hydrogen
C - glycosidic
Cellulose is (asked for Chitin but they are both B 1-4) A) a linear copolymer of glucose and galactose. B) a branched polymer of glucose. C) a linear polymer of glucose with β(1-->4) linkages. D) a linear polymer of glucose with α(14) linkages. E) sometimes called starch.
C - linear polymer of glucose with B(1-->4) linkages
A saccharide that has free aldehyde group is called a(n) _____________. A) ketose B) nonreducing sugar C) reducing sugar D) aldohexose E) alditol
C - reducing sugar
Due primarily to single nucleotide polymorphisms, each human differs from every other human, on average, by what percentage of the human genome? A) 6% B) 15% C) 0.1% D) 98% E) 1.5%
C) 0.1%
What is the abbreviated nomenclature for octadecanoic acid with two double bonds? A) 16:1 B) 14:2 C) 18:2 D) 18:0 E) 18:1
C) 18:2
The inner (plasma) membrane of E. coli is about 75% lipid and 25% protein by weight. How many molecules of membrane lipid are there for each molecule of protein? (Assume that the average protein is Mr 50,000 and the average lipid is 750.) A) 1 B) 50 C) 200 D) 10,000 E) 50,000
C) 200
71. Assuming 20 common amino acids and 20 different monosaccharide subunits that are available for construction of polypeptides and oligosaccharides, respectively, compare the possible variations of these macromolecules using a hypothetical hexameric oligomer. A) 206 possible variations for both polypeptides and oligosaccharides B) 620 variations for both polypeptide and oligosaccharides C) 206 variations for polypeptides and orders of magnitude greater for oligosaccharides D) 206 variations for oligosaccharides and orders of magnitude greater for polypeptides E) It cannot be determined from the information given.
C) 206 variations for polypeptides and orders of magnitude greater for oligosaccharides
Current estimates indicate that humans have about _____ genes. A) 3,000 B) 10,000 C) 30,000 D) 100,000 E) 300,000
C) 30,000
Current estimates indicate that humans have about ________ genes. A) 3,000 B) 10,000 C) 30,000 D) 100,000 E) 300,000
C) 30,000
12. How many stereoisomers are possible for an aldopentose such as ribose? A) 2 B) 4 C) 8 D) 16 E) 32
C) 8
Which statement about transposons is NOT correct? A) They are a form of molecular parasite. B) They have played a major role in human evolution. C) All transposons are active and move around the human genome. D) Some transposons move to another genomic location via an RNA intermediate. E) They often contain genes that encode proteins that catalyze transposon movement.
C) All transposons are active and move around the human genome.
18. Following complete hydrolysis of a sample of glycogen and a sample of cellulose, which statement must be TRUE? A) The glycogen sample is more soluble than the cellulose sample. B) The cellulose sample is more soluble than the glycogen sample. C) Both samples consist of a mixture of a-D-glucose and B-D-glucose. D) The glycogen sample has a higher ratio of -D-glucose than the cellulose sample. E) The cellulose sample contains only -D-glucose.
C) Both samples consist of a mixture of a-D-glucose and B-D-glucose.
Following complete hydrolysis of a sample of glycogen and a sample of cellulose, which of the following must be true? A) The glycogen sample is more soluble than the cellulose sample. B) The cellulose sample is more soluble than the glycogen sample. C) Both samples consist of a mixture of alpha-D-glucose and beta-D-glucose. D) The glycogen sample has a higher ratio of alpha-D-glucose than the cellulose sample. E) The cellulose sample contains only beta-D-glucose.
C) Both samples consist of a mixture of alpha-D-glucose and beta-D-glucose.
15. Which of the following statements about starch and glycogen is false? A) Amylose is unbranched--amylopectin and glycogen contain many (α1 → 6) branches. B) Both are homopolymers of glucose. C) Both serve primarily as structural elements in cell walls. D) Both starch and glycogen are stored intracellularly as insoluble granules. E) Glycogen is more extensively branched than starch.
C) Both serve primarily as structural elements in cell walls.
Which of the following statements about starch and glycogen is false? A) Amylose is unbranched; amylopectin and glycogen contain many (α1 → 6) branches. B) Both are homopolymers of glucose. C) Both serve primarily as structural elements in cell walls. D) Both starch and glycogen are stored intracellularly as insoluble granules. E) Glycogen is more extensively branched than starch.
C) Both serve primarily as structural elements in cell walls.
Which of the following statements about starch and glycogen is false? A) Amylose is unbranched; amylopectin and glycogen contain many (α1 → 6) branches. B) Both are homopolymers of glucose. C) Both serve primarily as structural elements in cell walls. D) Both starch and glycogen are stored intracellularly as insoluble granules. E) Glycogen is more extensively branched than starch.
C) Both serve primarily as structural elements in cell walls.
Which vitamin is derived from cholesterol? A) A B) B12 C) D D) E E) K
C) D
When cloning a gene into a plasmid, which enzyme would you use to covalently attach the gene to the plasmid DNA? A) DNA polymerase B) exonuclease III C) DNA Ligase D) alkaline phosphatase E) a restriction endonuclease
C) DNA Ligase
The PCR reaction mixture does NOT include: A) all four deoxynucleoside triphosphates. B) DNA containing the sequence to be amplified. C) DNA ligase. D) heat-stable DNA polymerase. E) oligonucleotide primer(s).
C) DNA ligase.
The PCR reaction mixture does not include: A) all four deoxynucleoside triphosphates. B) DNA containing the sequence to be amplified. C) DNA ligase. D) heat-stable DNA polymerase. E) oligonucleotide primer(s).
C) DNA ligase.
Which list ranks the organisms in order from smallest genome (number of base pairs of DNA) to largest genome? A) Human, fruit fly, E. coli bacterium B) E. coli bacterium, human, fruit fly C) E. coli bacterium, fruit fly, human D) fruit fly, E. coli bacterium, human E) fruit fly, human, E. coli bacterium
C) E. coli bacterium, fruit fly, human
62. Which statement accurately describes the interactions between the molecules thrombin, antithrombin, and heparan sulfate? A) In the absence of heparan sulfate, antithrombin binds tightly to thrombin, inhibiting blood coagulation. B) In the absence of heparan sulfate, antithrombin cannot bind to thrombin, inhibiting blood coagulation. C) In the presence of heparan sulfate, antithrombin binds tightly to thrombin, inhibiting blood coagulation. D) In the presence of heparan sulfate, antithrombin cannot bind to thrombin, enabling blood coagulation. E) In the presence of heparan sulfate, antithrombin binds tightly to thrombin, enabling blood coagulation.
C) In the presence of heparan sulfate, antithrombin binds tightly to thrombin, inhibiting blood coagulation.
_____ is NOT a commonly used tag for affinity purification of cloned proteins. A) Glutathione-S-transferase B) Maltose binding protein C) Nickel D) Protein A E) Chitin-binding domain
C) Nickel
Which statement does NOT describe a characteristic of the fluid mosaic model of membranes? A) Hydrophobic interactions predominate between lipids in the membrane. B) Proteins and lipids are able to move laterally at different rates. C) Protein structures are able to move from one leaflet to another. D) Noncovalent forces predominate in intermolecular interactions.
C) Protein structures are able to move from one leaflet to another.
25. Which statement concerning sialic acid residues on glycoproteins is TRUE? A) Sialic residues on erythrocytes are recognized by lectins, leading to removal of the erythrocytes. B) Sialic residues on ceruloplasmin are recognized by lectins, leading to removal of ceruloplasmin. C) Sialic residues are removed by neuraminidases. D) The antiviral drug oseltamavir accelerates the removal of sialic acid residues. E) All of the statements are true.
C) Sialic residues are removed by neuraminidases
Which of the following statements concerning sialic acid residues on glycoproteins is true? A) Sialic residues on erythrocytes are recognized by lectins, leading to removal of the erythrocytes. B) Sialic residues on ceruloplasmin are recognized by lectins, leading to removal of ceruloplasmin. C) Sialic residues are removed by neuraminidases. D) The anti-viral drug oseltamavir accelerates the removal of sialic acid residues. E) Both A and B above
C) Sialic residues are removed by neuraminidases.
Which analytical technique does NOT help illuminate a gene's cellular function? A) DNA microarray analysis B) protein chip analysis C) Southern blotting D) two-dimensional gel electrophoresis E) two-hybrid analysis
C) Southern blotting
Which one of the following analytical techniques does not help illuminate a gene's cellular function? A) DNA microarray analysis B) Protein chip analysis C) Southern blotting D) Two-dimensional gel electrophoresis E) Two-hybrid analysis
C) Southern blotting
Which statement about membranes is TRUE? A) Most plasma membranes contain more than 70% proteins. B) Sterol lipids are common in bacterial plasma membranes. C) Sterol lipids are common in human cell plasma membranes. D) Sterol lipids are common in plant cell plasma membranes. E) The plasma membranes of all cell types within a particular organism have basically the same lipid and protein composition.
C) Sterol lipids are common in human cell plasma membranes.
Which statement about the composition of membranes is TRUE? A) All biological membranes contain cholesterol. B) Free fatty acids are major components of all membranes. C) The inner and outer membranes of mitochondria have different protein compositions. D) The lipid composition of all membranes of eukaryotic cells is essentially the same. E) The lipid:protein ratio varies from about 1:4 to 4:1.
C) The inner and outer membranes of mitochondria have different protein compositions.
21. Which statement about heparan sulfate is NOT true? A) Sulfation of heparan sulfate to form NS domains is important for its role as an anticoagulant. B) Heparan sulfate can promote protein-protein interactions via the NS domains. C) The secondary structure of heparan sulfate is completely random. D) The NA domains of heparan sulfate contain no sulfation. E) The core repeating structure of heparan sulfate is made up of alternating GlcNAc and GlcA.
C) The secondary structure of heparan sulfate is completely random
Which of the following statements about heparan sulfate is not true? A) Sulfation of heparan sulfate to form NS domains is important for its role as an anti-coagulant. B) Heparan sulfate can promote protein-protein interactions via the NS domains. C) The secondary structure of heparan sulfate is completely random. D) The NA domains of heparan sulfate contain no sulfation. E) The core repeating structure of heparan sulfate is made up of alternating GlcNAc and GlcA.
C) The secondary structure of heparan sulfate is completely random.
50. Why are ruminant animals like cows able to digest cellulose? A) Their teeth are able to grind the polysaccharide into smaller saccharides. B) Their stomachs secrete the enzyme cellulose. C) They have a stomach compartment that houses symbiotic microorganisms that can hydrolyze cellulose. D) Their small intestine contains an environment suitable to hydrolyze cellulose. E) All animals can digest cellulose.
C) They have a stomach compartment that houses symbiotic microorganisms that can hydrolyze cellulose
What prevents proton translocation through aquaporins? A) Asp and Glu residues bind to protons to prevent their translocation. B) Carbonyl groups in the selectivity filter interact with water molecules. C) Two side chain amide groups act as hydrogen bond donors to a single water molecule. D) All of the answers are correct. E) None of the answers is correct.
C) Two side chain amide groups act as hydrogen bond donors to a single water molecule.
Which statement regarding Type I and Type II restriction endonucleases is NOT accurate? A) Type I endonucleases cleave DNA at random sites. B) Type II endonucleases recognize small (4-6 bp) palindromic sequences. C) Type II endonucleases always make staggered cuts in DNA strands. D) Type I endonucleases require ATP. E) Type I endonucleases are generally large, multisubunit complexes.
C) Type II endonucleases always make staggered cuts in DNA strands.
51. Cellulose is A) a linear copolymer of glucose and galactose. B) a branched polymer of glucose. C) a linear polymer of glucose with β(1→4) linkages. D) a linear polymer of glucose with α(1→4) linkages. E) sometimes called starch.
C) a linear polymer of glucose with β(1→4) linkages.
A ligand-gated ion channel (such as the nicotinic acetylcholine receptor) is: A) a charged lipid in the membrane bilayer that allows ions to pass through. B) a membrane protein that permits a ligand to pass through the membrane only when opened by the appropriate ion. C) a membrane protein that permits an ion to pass through the membrane only when opened by the appropriate ligand. D) a molecule that binds to the membrane thereby allowing ions to pass through. E) always requires a second ligand to close the channel once it is opened.
C) a membrane protein that permits an ion to pass through the membrane only when opened by the appropriate ligand.
Which solvent is a commonly used to extract all the lipids from homogenized tissue samples and subsequent separation of the lipids from the proteins and sugars present in those samples? A) ethanol B) benzene C) a mixture of chloroform, methanol, and water D) water E) a mixture of chloroform and benzene
C) a mixture of chloroform, methanol, and water
You have discovered a protein that transports Ca2+ up a concentration gradient, from the cytoplasm into the endoplasmic reticulum. No other ions move during this transport. What type of transport protein does this appear to be? A) a Ca2+ channel B) a Ca2+ ion porin C) a primary active uniporter D) a secondary active uniporter E) an ionophore
C) a primary active uniporter
An integral membrane protein can be extracted with: A) a buffer of alkaline or acid pH. B) a chelating agent that removes divalent cations. C) a solution containing detergent. D) a solution of high ionic strength. E) hot water.
C) a solution containing detergent.
Which term BEST describes the polarity of membrane lipids? A) ambidextrous B) completely nonpolar C) amphipathic D) completely polar E) amphibolic
C) amphipathic
Which type of chemical linkage is used to join fatty acids to glycerol? A) an ether linkage B) a peptide bond C) an ester linkage D) a double bond E) a peroxide bond
C) an ester linkage
The fluidity of the lipid side chains in the interior of a bilayer is generally increased by: A) a decrease in temperature. B) an increase in fatty acyl chain length. C) an increase in the number of double bonds in fatty acids. D) an increase in the percentage of phosphatidyl ethanolamine E) the binding of water to the fatty acyl side chains.
C) an increase in the number of double bonds in fatty acids.
Restriction enzymes: A) act at the membrane to restrict the passage of certain molecules into the cell. B) are highly specialized ribonucleases that degrade mRNA soon after its synthesis. C) are sequence-specific DNA endonucleases. D) are very specific proteases that cleave peptides at only certain sequences. E) catalyze the addition of a certain amino acid to a specific tRNA.
C) are sequence-specific DNA endonucleases.
Restriction enzymes: A) act at the membrane to restrict the passage of certain molecules into the cell. B) are highly specialized ribonucleases that degrade mRNA soon after its synthesis. C) are sequence-specific DNA endonucleases. D) are very specific proteases that cleave peptides at only certain sequences. E) catalyze the addition of a certain amino acid to a specific tRNA.
C) are sequence-specific DNA endonucleases.
To possess optical activity, a compound must be: A) a carbohydrate. B) a hexose. C) asymmetric. D) colored. E) D-glucose.
C) asymmetric.
40. It is useful to analyze hemoglobin glycation to determine a(n): A) single-time measurement of blood glucose levels. B) single-time measurement of blood glycogen levels. C) average blood glucose level over days or weeks. D) average blood glycogen level over days or weeks. E) None of the answers is correct.
C) average blood glucose level over days or weeks.
48. Which of the following polysaccharides cannot be digested by mammalian salivary, gastric, or pancreatic enzymes? A) amylopectin B) amylose C) chitin D) glycogen E) starch
C) chitin
A process NOT involving the fusion of two membranes or two regions of the same membrane is: A) endocytosis. B) entry of enveloped viruses into cells. C) entry of glucose into cells. D) exocytosis. E) reproductive budding in yeast.
C) entry of glucose into cells.
Which enzymes are NOT involved in moving phospholipids from one leaflet to another? A) flippases that move phosphatidylethanolamine and phosphatidylserine B) floppases that move phospholipids from the cytosolic leaflet to the extracellular leaflet C) flip-floppases that allow phospholipids to move back and forth between the inner and outer leaflets D) scramblases that allow phospholipids to move down their concentration gradient E) phosphatidylinositol transfer proteins that play a role in lipid signaling
C) flip-floppases that allow phospholipids to move back and forth between the inner and outer leaflets
Which types of membrane lipids make up 70% to 80% of the total membrane lipids in a vascular plant? A) phosphatidylserines B) glycosphingolipids C) galactolipids D) plasmalogens E) sphingomyelins
C) galactolipids
You are working in a laboratory trying to design a drug that specifically binds to the surface of certain cells. To which membrane lipid constituents should your drug bind in order to achieve this specificity? A) sphingomyelins B) phosphatidylcholines C) gangliosides D) triacylglycerols E) sterols
C) gangliosides
3. The reference compound for naming D and L isomers of sugars is: A) fructose. B) glucose. C) glyceraldehyde. D) ribose. E) sucrose.
C) glyceraldehyde.
39. The bonding of alcohols to the anomeric center of a carbohydrate results in the formation of a(n) __________ bond. A) anomeric B) amide C) glycosidic D) ester E) hydrogen
C) glycosidic
When the linear form of glucose cyclizes, the product is a(n): A) anhydride. B) glycoside. C) hemiacetal. D) lactone. E) oligosaccharide.
C) hemiacetal.
P-type ATPase transporters such as the SERCA pumps can be classified as enzymes. As what enzyme class would they be classified? A) oxidoreductases B) transferases C) hydrolases D) lyases E) ligases
C) hydrolases
In genetic engineering, in vitro packaging is used to: A) cut a desired region out of the host bacterium's chromosome. B) ensure that genetically engineered bacteria are not accidentally released into the environment. C) incorporate recombinant DNA into infectious bacteriophage particles. D) place an antibiotic resistance gene in a plasmid. E) splice a desired gene into a plasmid.
C) incorporate recombinant DNA into infectious bacteriophage particles.
Mutations in which genetic sequences are NOT likely to have a phenotypic effect? A) noncoding RNAs B) exons C) interspersed nuclear elements D) All of the answers are correct. E) None of the answers is correct.
C) interspersed nuclear elements
FRAP experiments are generally used in membrane studies to examine: A) transverse diffusion rates. B) active transport rates. C) lateral diffusion rates. D) both transverse diffusion rates and active transport rates. E) both transverse diffusion rates and lateral diffusion rates.
C) lateral diffusion rates.
Certain restriction enzymes produce cohesive (sticky) ends. This means that they: A) cut both DNA strands at the same base pair. B) cut in regions of high GC content, leaving ends that can form more hydrogen bonds than ends of high AT content. C) make a staggered double-strand cut, leaving ends with a few nucleotides of single-stranded DNA protruding. D) make ends that can anneal to cohesive ends generated by any other restriction enzyme. E) stick tightly to the ends of the DNA they have cut.
C) make a staggered double-strand cut, leaving ends with a few nucleotides of single-stranded DNA protruding.
Certain restriction enzymes produce cohesive (sticky) ends. This means that they: A) cut both DNA strands at the same base pair. B) cut in regions of high GC content, leaving ends that can form more hydrogen bonds than ends of high AT content. C) make a staggered double-strand cut, leaving ends with a few nucleotides of single-stranded DNA protruding. D) make ends that can anneal to cohesive ends generated by any other restriction enzyme. E) stick tightly to the ends of the DNA they have cut.
C) make a staggered double-strand cut, leaving ends with a few nucleotides of single-stranded DNA protruding.
45. Which of these is not an artificial sweetener? A) saccharine B) aspartame C) maltose D) acesulfame E) alitame
C) maltose
Integrins are: A) membrane proteins that are involved in ion transport. B) membrane proteins that are involved in sugar transport. C) membrane proteins that mediate cell adhesion. D) proteins of the extracellular matrix that bind to cell surface proteins. E) proteins that are found at the membrane-cytoplasm interface.
C) membrane proteins that mediate cell adhesion
If you wanted to create specific DNA sequence changes to a plasmid in the coding sequence for a protein you are researching, but there are no suitably located restriction sites nearby, which technique would you use? A) error-prone PCR B) site-directed mutagenesis C) oligonucleotide-directed mutagenesis D) exposing the plasmid DNA to UV light E) exposing the cells containing the plasmid DNA to chemical mutagens
C) oligonucleotide-directed mutagenesis
Commercial vegetable oils can be converted from liquid forms to solid forms and have their shelf lives increased due to which process? A) partial desaturation B) unsaturation C) partial hydrogenation D) hydrolysis E) complete esterification
C) partial hydrogenation
57. Bacterial cell walls are composed of _____. A) pectin B) chondroitin sulfate chains C) peptidoglycans D) heparin E) proteoglycans
C) peptidoglycans
Which glycerophospholipid has a net charge of zero at pH 7? A) phosphatidylserine B) phasphatidic acid C) phosphatidylcholine D) phosphatidylglycerol E) phosphatidylinositol 4,5-bisphosphate
C) phosphatidylcholine
Which membrane lipid serves as a reservoir of messenger molecules for signal transduction? A) taruocholic acid (TA) B) phosphatidylserine (PS) C) phosphatidylinositol 4,5-bisphosphate (PIP2) D) thromboxane A2 (TXA2) E) sphingomyelin (SM)
C) phosphatidylinositol 4,5-bisphosphate (PIP2)
An example of a glycerophospholipid that is involved in cell signaling is: A) arachidonic acid. B) ceramide. C) phosphatidylinositol. D) testosterone. E) vitamin A (retinol).
C) phosphatidylinositol.
A convenient cloning vector with which to introduce foreign DNA into E. coli is a(n): A) E. coli chromosome. B) messenger RNA. C) plasmid. D) yeast "ARS" sequence. E) yeast transposable element.
C) plasmid.
A convenient cloning vector with which to introduce foreign DNA into E. coli is a(n): A) E. coli chromosome. B) messenger RNA. C) plasmid. D) yeast "ARS" sequence. E) yeast transposable element.
C) plasmid.
Which phrase BEST describes the term "amphitropic"? A) cytosolic lipid-linked proteins B) GPI-linked proteins C) proteins that are reversibly membrane-associated or cytosolic D) proteins that are either integral or lipid-linked
C) proteins that are reversibly membrane-associated or cytosolic
When a bacterium such as E. coli is shifted from a warmer growth temperature to a cooler growth temperature, it compensates by: A) increasing its metabolic rate to generate more heat. B) putting longer-chain fatty acids into its membranes. C) putting more unsaturated fatty acids into its membranes. D) shifting from aerobic to anaerobic metabolism. E) synthesizing thicker membranes to insulate the cell.
C) putting more unsaturated fatty acids into its membranes.
41. A saccharide that has free aldehyde group is called a(n) _____________. A) ketose B) nonreducing sugar C) reducing sugar D) aldohexose E) alditol
C) reducing sugar
Which type of DNA sequence is NOT found in the human genome? A) long repetitive repeats B) introns C) retro-palindromes D) simple sequence repeats E) transposons
C) retro-palindromes
34. Which of the following sugars is not a reducing sugar? A) glucose B) ribose C) sucrose D) starch E) galactose
C) sucrose
Which process represents the HIGHEST energy state in membrane fusion? A) formation of coiled-coils in SNARE proteins B) formation of the fusion pore C) the hemifusion state D) the expansion of the fusion pore E) lipid mixing in both outer and inner leaflets
C) the hemifusion state
The process of linkage analysis does NOT rely on which technique to determine the genetic causes of diseases? A) analysis of family pedigrees B) identification of SNPs that are most often inherited with the disease-causing gene C) the sequence of the entire chromosome where the disease-causing gene is located to directly identify it D) comparing the DNA of people who have the disease with the DNA of people who don't have the disease E) obtaining many sequences of a region of the chromosome that is associated with the disease
C) the sequence of the entire chromosome where the disease-causing gene is located to directly identify it
Which technique is NOT commonly used to analyze lipid composition? A) selective extraction using apolar solvents B) adsorption chromatography C) x-ray crystallography D) hydrolysis using enzymes with specificity for certain linkages E) mass spectroscopy
C) x-ray crystallography
If you are comparing the total gene expression of a black panther during its early development and later adult life and have labeled the cDNA you obtained from its early development stages with a green fluorophore and the cDNA you obtained from its adult life stages with a red fluorophore, what color would you expect to see on your DNA microarray for genes that are equally expressed in both the early development and adult life stages? A) green B) red C) yellow D) brown E) magenta
C) yellow
Which four elements occur virtually in all biological molecules?
C,H,O,N - carbon, hydrogen, oxygen, nitrogen
From the abbreviated name of the compound Gal(β1 → 4)Glc, we know that:
C-4 of glucose is joined to C-1 of galactose by a glycosidic bond.
How many stereoisomers are possible for an aldopentose such as ribose? A. 2 B. 4 C. 8 D. 16
C. 8
Biological role of Vitamin D
Ca2+ and phosphate metabolism
Compare and contrast the structures and functions of cellulose, chitin, starch, and glycogen. Know the linkages.
Cellulose (primary structural component of plant cell walls) is a beta 1-4 linkage of 2 glucoses Chitin (principal structural component of the exoskeletons of invertebrates) is a beta 1-4 linkage of 2 N-acetylglucosamines Starch (Amylose) (prinicpal energy reserve in plants) is an alpha 1-4 linkage of D-glucose Glycogen (storage polysaccharide in animals) has 5 alpha 1-4 linkages and an alpha 1-6 linkages that forms a branch
45. Which statement about cellulose is TRUE? A) Cellulose is the main storage polysaccharide of animal cells. B) Cellulose is a highly branched polysaccharide. C) Cellulose is a homopolysaccharide. D) Cellulose glucose residues contain the same configuration as amylose glucose residues. E) Cellulose cannot be broken down by invertebrate animals.
Cellulose is a homopolysaccharide
Be able to draw cellulose, chitin, starch, and glycogen
Cellulose: beta 1-4 glucoses Chitin: beta 1-4 GlcNAc's Starch: alpha 1-4 glucoses Glycogen: 5 alpha 1-4 glucoses on the bottom, 2 on the top, and #2 and #3 are connected by an alpha 1-6
Which statement is TRUE of sphingolipids?
Cerebrosides and gangliosides are sphingolipids.
Define chemical potential of a substance. How is it related to its concentration?
Chemical potential (u) of a substance is a physical property related to its concentration (proportional to the concentration difference across membrane) that describes the amount of potential energy stored that can be used to do useful work aka, concentration difference creates chemical potential difference delta{u} = RTln([A]cyt/[A]ext)
___ is a homopolymer composed of β(1-4) linked N-acetyl-D-glucosamine residues that is the principle structural component of the exoskeleton of various groups of invertebrates
Chitin
-1717.5 j/mol
Consider the transport of glucose into an erythrocyte. What is the free-energy change for glucose uptake into the cell when the glucose concentrations are 4.0 mM on the outside and 2.0 mM on the inside? (These values may be of use to you: R = 8.315 J/mol·K; T = 298 K; Faraday constant=96,480 J/V*mol; membrane potential= -0.07 V).
1. In DNA sequencing by the Sanger (dideoxy) method: A) radioactive dideoxy ATP is included in each of four reaction mixtures before enzymatic synthesis of complementary strands. B) specific enzymes are used to cut the newly synthesized DNA into small pieces, which are then separated by electrophoresis. C) the dideoxynucleotides must be present at high levels to obtain long stretches of DNA sequence. D) the role of the dideoxy CTP is to occasionally terminate enzymatic synthesis of DNA where Gs occur in the template strands. E) the template DNA strand is radioactive.
D
11. The ABC excinuclease is essential in: A) base-excision repair. B) methyl-directed repair. C) mismatch repair. D) nucleotide-excision repair. E) SOS repair.
D
13. In homologous recombination in E. coli, the protein that moves along a double-stranded DNA, unwinding the strands ahead of it and degrading them, is: A) chi. B) DNA ligase. C) RecA protein. D) RecBCD enzyme. E) RuvC protein (resolvase).
D
14. In homologous recombination in E. coli, the protein that assembles into long, helical filaments that coat a region of DNA is: A) DNA methylase. B) DNA polymerase. C) histone. D) RecA protein. E) RecBCD enzyme
D
17. Which of the following is not a feature of homologous recombination during meiosis? A) A double strand break B) Cleavage of two crossover events C) Alignment of homologous chromosomes D) Formation of a single Holliday intermediate E) Exposed 3' ends invade the intact duplex DNA of the homolog
D
18. Which of the following is not a feature of site-specific recombination? A) A specific recombinase enzyme is required. B) The energy of the phosphodiester bond is preserved in covalent enzyme-DNA linkage. 4 C) Recombination sites have non-palindromic sequences. D) Formation of Holliday intermediates is required. E) Insertions or deletions can result from site-specific recombination.
D
2. In the chemical synthesis of DNA: A) the dimethoxytrityl (DMT) group catalyzes formation of the phosphodiester bond. B) the direction of synthesis is 5' to 3'. C) the maximum length of oligonucleotide that can be synthesized is 8-10 nucleotides. D) the nucleotide initially attached to the silica gel support will become the 3' end of the finished product. E) the protecting cyanoethyl groups are removed after each step.
D
5. A next-generation method of DNA sequencing, 454 sequencing, uses pyrosequencing in which the addition of nucleotides is detected by a: A) radioactive signal. B) fluorescently labeled dNTP. C) pulse from a laser. D) flash of light. E) nano-ruler's physical movement of 4.54 nm detected by laser
D
6. The Ames test is used to: A) detect bacterial viruses. B) determine the rate of DNA replication. C) examine the potency of antibiotics. D) measure the mutagenic effects of various chemical compounds. E) quantify the damaging effects of UV light on DNA molecules.
D
A glycoconjugate molecule may include a carbohydrate as well as: A) an amino acid. B) a lipid. C) a saccharide. D) both an amino acid and a lipid. E) an amino acid, a lipid, and a saccharide.
D
A microarray of oligosaccharides can be used to determine: A) specificity of lectin binding. B) affinity of lectin binding. C) conformational flexibility of lectin binding. D) both specificity and affinity of lectin binding. E) both specificity and conformational flexibility of lectin binding.
D
A next-generation method of DNA sequencing, 454 sequencing, uses pyrosequencing in which the addition of nucleotides is detected by a: A) radioactive signal. B) fluorescently labeled dNTP. C) pulse from a laser. D) flash of light. E) nano-ruler's physical movement of 4.54 nm detected by laser.
D
A patient you are treating appears to be deficient in vitamin D. You have previously prescribed vitamin D supplements, but they do not appear to be working. Which organs and/or tissues should you check to make sure that the enzymes they produce are functioning appropriately? A) the liver B) the kidneys C) the pancreas D) both a the liver and the kidneys E) the liver, the kidneys, and the pancreas
D
According to the current model for HIV infection, which of the following is not involved in the process of membrane fusion? A) A cell surface co-receptor protein B) A cell surface receptor protein C) A viral glycoprotein complex D) The viral chromosome E) The viral envelope
D
Advantages to using triacylglycerols, rather than polysaccharaides, to store energy include which reason(s)? A) The carbon atoms of triacylglycerols are more reduced. B) Triacylglycerols contain more oxygen than polysaccharides and therefore are more efficient to oxidize. C) Since triacylglycerols are hydrophobic, excess water does not need to be stored along with them. D) The carbon atoms of triacylglycerols are more reduced, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them. E) Triacylglycerols contain more oxygen than polysaccharides and therefore are more efficient to oxidize, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them.
D
B-form DNA in vivo is a _____-handed helix, _____ Å in diameter, with a rise of _____ Å per base pair. A) left; 20; 3.9 B) right; 18; 3.4 C) right; 18; 3.6 D) right; 20; 3.4 E) right; 23; 2.6
D
B-form DNA in vivo is a ________-handed helix, _____ Å in diameter, with a rise of ____ Å per base pair. A) left; 20; 3.9 B) right; 18; 3.4 C) right; 18; 3.6 D) right; 20; 3.4 E) right; 23; 2.6
D
Chitin differs from cellulose due to A) inversion of configuration at the anomeric carbon. B) sulfonation of the C2 OH group. C) a much greater prevalence of branching. D) replacement of the C2 OH group by an acetamido group. E) replacement of the C6 OH group by an amino group.
D
Consider the transport of K+ from the blood (where its concentration is about 4 mM) into an erythrocyte that contains 150 mM K+. The transmembrane potential is about 60 mV, inside negative relative to outside. The free-energy change for this transport process is: (These values may be of use to you: R = 8.315 J/mol.K; T = 298 K; 9 (Faraday constant) = 96,480 J/V; N = 6.022 1023/mol.) A) about 5 J/mol. B) about 15 J/mol. C) about 5 kJ/mol. D) about 15 kJ/mol. E) impossible to calculate with the information given.
D
For the oligoribonucleotide pACGUAC, the nucleotide at the: A) 3' end has a phosphate at its 3' hydroxyl. B) 3' end is a purine. C) 5' end has a 5' hydroxyl. D) 5' end has a phosphate on its 5' hydroxyl. E) 5' end is a pyrimidine.
D
For the oligoribonucleotide pACGUAC: A) the nucleotide at the 3' end has a phosphate at its 3' hydroxyl. B) the nucleotide at the 3' end is a purine. C) the nucleotide at the 5' end has a 5' hydroxyl. D) the nucleotide at the 5' end has a phosphate on its 5' hydroxyl. E) the nucleotide at the 5' end is a pyrimidine
D
Glucose transport into erythrocytes is an example of: A) active transport. B) antiport. C) electrogenic uniport D) facilitated diffusion. E) symport.
D
High-performance liquid chromatography (HPLC) can be used to determine the: A) position(s) of glycosidic bonds in a polysaccharide. B) sequence of monosaccharides from a polysaccharide. C) sequence of monosaccharides, as well as position and configuration of glycosidic bonds. D) types and amounts of monosaccharide units in a polysaccharide. E) None of the answers is correct.
D
If a patient you are treating has asthmatic attacks due to the overproduction of leukotrienes, which drug would you prescribe to help treat that condition? A) testosterone B) ibuprofen C) aspirin D) prednisone E) warfarin
D
In DNA sequencing by the Sanger (dideoxy) method: A) radioactive dideoxy ATP is included in each of four reaction mixtures before enzymatic synthesis of complementary strands. B) specific enzymes are used to cut the newly synthesized DNA into small pieces, which are then separated by electrophoresis. C) the dideoxynucleotides must be present at high levels to obtain long stretches of DNA sequence. D) the role of the dideoxy CTP is to occasionally terminate enzymatic synthesis of DNA where Gs occur in the template strands. E) the template DNA strand is radioactive.
D
In DNA sequencing by the Sanger (dideoxy) method: A) radioactive dideoxy ATP is included in each of four reaction mixtures before enzymatic synthesis of complementary strands. B) specific enzymes are used to cut the newly synthesized DNA into small pieces, which are then separated by electrophoresis. C) the dideoxynucleotides must be present at high levels to obtain long stretches of DNA sequence. D) the role of the dideoxy CTP is to occasionally terminate enzymatic synthesis of DNA where Gs occur in the template strands. E) the template DNA strand is radioactive
D
In a nucleoside, the pentose sugar is in its _____ form, and the ring is _____. A) α-furanose; planar B) α-pyranose; puckered C) β-furanose; planar D) β-furanose; puckered E) β-pyranose; planar
D
In most cases, in order for an informational carbohydrate to become a biologically active molecule, it must: A) be an asymmetric molecule. B) contain a reducing sugar. C) contain an O-glycosidic bond. D) be covalently joined to a protein or lipid. E) be present in the extracellular matrix.
D
In the Watson-Crick model for the DNA double helix, which of the following is not true? A) The two strands run anti-parallel to one another. B) The base-pairing occurs on the inside of the double helix. C) The double helix is right-handed. D) There are two equally sized grooves that run up the sides of the helix. F) The two strands have complementary sequences.
D
In the Watson-Crick model for the DNA double helix, which statement is NOT true? A) The two strands run anti-parallel to one another. B) The base-pairing occurs on the inside of the double helix. C) The double helix is right-handed. D) There are two equally sized grooves that run up the sides of the helix. E) The two strands have complementary sequences.
D
In the chemical synthesis of DNA: A) the dimethoxytrityl (DMT) group catalyzes formation of the phosphodiester bond. B) the direction of synthesis is 5' to 3'. C) the maximum length of oligonucleotide that can be synthesized is 8-10 nucleotides. D) the nucleotide initially attached to the silica gel support will become the 3' end of the finished product. E) the protecting cyanoethyl groups are removed after each step.
D
In the chemical synthesis of DNA: A) the dimethoxytrityl (DMT) group catalyzes formation of the phosphodiester bond. B) the direction of synthesis is 5' to 3'. C) the maximum length of oligonucleotide that can be synthesized is 8-10 nucleotides. D) the nucleotide initially attached to the silica gel support will become the 3' end of the finished product. E) the protecting cyanoethyl groups are removed after each step.
D
Membrane fusion leading to neurotransmitter release requires the action of: A) cadherins. B) selectins. C) flipases. D) tSNARE and vSNARE. E) none of the above.
D
Nonsteroidal antiinflammatory drugs (NSAIDs) inhibit the synthesis of which signaling lipids from arachidonic acid? A) prostaglandins B) thromboxanes C) leukotrienes D) both prostaglandins and thromboxanes E) both thromboxanes and leukotrienes
D
O-linked oligosaccharides are commonly attached to the —OH group of _____. A) ribose B) tyrosine C) lysine D) threonine E) glycine
D
Phospholipase C hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP2 ) to form which signaling molecule that triggers Ca2+ release from the endoplasmic reticulum? A) diacylglycerolphosphate (DAGP) B) inositol 5-monophosphate (IP1 ) C) diacylglycerol (DAG) D) inositol 1,4,5-triphosphate (IP3 ) E) inositol 4,5-bisphosphate (IP2 )
D
Specific hydrolysis of phosphatidylcholine can be achieved by which technique? A) treatment of the lipid with phospholipase C B) treatment of the lipid with mild acid C) dissolving the lipid in chloroform D) treatment of the lipid with both phospholipase C and mild acid E) both treatment of the lipid with phospholipase C and dissolving the lipid in chloroform
D
Starch and glycogen are both polymers of: A) fructose. B) glucose1-phosphate. C) sucrose. D) a-D-glucose. E) b-D-glucose.
D
Starch and glycogen are both polymers of: A) fructose. B) glucose1-phosphate. C) sucrose. D) alpha-D-glucose. E) beta-D-glucose.
D
The alkaline hydrolysis of RNA does NOT produce: A) 2'- AMP. B) 2',3'-cGMP. C) 2'-CMP. D) 3',5'-cAMP. E) 3'-UMP.
D
The alkaline hydrolysis of RNA does not produce: A) 2'- AMP. B) 2',3'-cGMP. C) 2'-CMP. D) 3',5'-cAMP. E) 3'-UMP
D
The biochemical property of lectins that is the basis for most of their biological effects is their ability to bind to: A) amphipathic molecules. B) hydrophobic molecules. C) specific lipids. D) specific oligosaccharides. E) specific peptides.
D
The biochemical property of lectins that is the basis for most of their biological effects is their ability to bind to: A) amphipathic molecules. B) hydrophobic molecules. C) specific lipids. D) specific oligosaccharides. E) specific peptides.
D
The difference in interchain stability between the polysaccharides glycogen and cellulose is due to: A) the different glycosidic linkages of the molecules. B) the different hydrogen bonding partners of the individual chains. C) the incorporation of complex ions in the three dimensional structures of both polysaccharides. D) both the different glycosidic linkages of the molecules and the different hydrogen bonding partners of the individual chains. E) None of the answers is correct.
D
The double helix of DNA in the B-form is stabilized by: A) covalent bonds between the 3' end of one strand and the 5' end of the other. B) hydrogen bonding between the phosphate groups of two side-by-side strands. C) hydrogen bonds between the riboses of each strand. D) nonspecific base-stacking interaction between two adjacent bases in the same strand. E)
D
The double helix of DNA in the B-form is stabilized by: A) covalent bonds between the 3' end of one strand and the 5' end of the other. B) hydrogen bonding between the phosphate groups of two side-by-side strands. C) hydrogen bonds between the riboses of each strand. D) nonspecific base-stacking interaction between two adjacent bases in the same strand. E) ribose interactions with the planar base pairs.
D
The fluidity of a lipid bilayer will be increased by: F) decreasing the number of unsaturated fatty acids. C) decreasing the temperature. G) increasing the length of the alkyl chains. D) increasing the temperature. E) substituting 18:0 (stearic acid) in place of 18:2 (linoleic acid).
D
The image below shows a DNA sequencing gel using the Sanger method. The top of the gel is the anode and the bottom is the cathode. What is the sequence of the template DNA? A) 5′ ACTAGTGACCGT 3′ B) 5′ TGCCAGTGATCA 3′ C) 5′ ACGGTCACTAGT 3′ D) 5′ TGATCACTGGCA 3′ E) It cannot be determined from this information.
D
The nucleic acid bases: A) absorb ultraviolet light maximally at 280 nm. B) are all about the same size. C) are relatively hydrophilic. D) are roughly planar. E) can all stably base-pair with one another.
D
The nucleic acid bases: A) absorb ultraviolet light maximally at 280 nm. B) are all about the same size. C) are relatively hydrophilic. D) are roughly planar. E) can all stably base-pair with one another
D
The ribonucleotide polymer (5')GTGATCAAGC(3') could only form a double-stranded structure with: A) (5')CACTAGTTCG(3'). B) (5')CACUAGUUCG(3'). C) (5')CACUTTCGCCC(3'). D) (5')GCTTGATCAC(3'). E) (5')GCCTAGTTUG(3').
D
The ribonucleotide polymer (5')GTGATCAAGC(3') could only form a double-stranded structure with: A) (5')CACTAGTTCG(3'). B) (5')CACUAGUUCG(3'). C) (5')CACUTTCGCCC(3'). D) (5')GCTTGATCAC(3'). E) (5')GCCTAGTTUG(3').
D
The scientists who used x-ray crystallography to shed light on the three-dimensional structure of DNA were: A) Erwin Chargaff and colleagues. B) Alfred D. Hershey and Martha Chase. C) James Watson and Francis Crick. D) Rosalind Franklin and Maurice Wilkins. E) Oswald T. Avery, Colin MacLeod, and Maclyn McCarty.
D
The two monosaccharides shown below could BEST be described as: A) ketoses. B) anomers. C) rotamers. D) epimers. E) enantiomers.
D
The type of membrane transport that uses ion gradients as the energy source is: A) facilitated diffusion B) passive transport. C) primary active transport. D) secondary active transport. E) simple diffusion.
D
Triacylglycerols are composed of: A) a glycerol backbone. B) three fatty acids. C) amide linkages between the fatty acids and the glycerol. D) both a glycerol backbone and three fatty acids. E) a glycerol backbone, three fatty acids, and amide linkages between the fatty acids and the glycerol.
D
Triple-helical DNA structures can result from Hoogsteen (non Watson-Crick) interactions. These interactions are primarily: A) covalent bonds involving deoxyribose. B) covalent bonds involving the bases. C) hydrogen bonds involving deoxyribose. D) hydrogen bonds involving the bases. E) hydrophobic interactions involving the bases.
D
Triple-helical DNA structures can result from Hoogsteen (non Watson-Crick) interactions. These interactions are primarily: A) covalent bonds involving deoxyribose. B) covalent bonds involving the bases. C) hydrogen bonds involving deoxyribose. D) hydrogen bonds involving the bases. E) hydrophobic interactions involving the bases
D
Under which condition will peripheral protein be extracted from membrane. (a) a buffer of alkaline or acid pH. (b) a solution of chelating agents which remove divalent ions (c) high ionic strength (high salt) (d) all of the above
D
What is the MOST likely length of an mRNA that will code for a polypeptide with 150 amino acids? A) 50 nucleotides B) 150 nucleotides C) 450 nucleotides D) >450 nucleotides E) All of these lengths are possible depending on the organism in which the mRNA is found.
D
What is the only monosaccharide that is achiral? A) glyceraldehyde B) ribose C) galactose D) dihydroxyacetone E) fructose
D
When drawing a Haworth perspective formula from a Fisher projection, which statement is TRUE regarding anomers? A) It is a if the hydroxyl group on the anomeric carbon is up. B) It is a if the hydroxyl group on the anomeric carbon is down C) It is a if the hydroxyl group on the anomeric carbon on the same side of the ring as the C6 D) It is a if the hydroxyl group on the anomeric carbon on the opposite side of the ring as the C6 E) None of the answers is correct.
D
When forming the disaccharide maltose from two glucose monosaccharides: A) water is eliminated. B) a hemiacetal is converted to an acetal. C) the resulting dissacharide is no longer a reducing sugar. D) water is eliminated and a hemiacetal is converted to an acetal. E) None of the answers is correct.
D
When two carbohydrates are epimers: A) one is a pyranose, the other a furanose. B) one is an aldose, the other a ketose. C) they differ in length by one carbon. D) they differ only in the configuration around one carbon atom. E) they rotate plane-polarized light in the same direction.
D
When two carbohydrates are epimers: A) one is a pyranose, the other a furanose. B) one is an aldose, the other a ketose. C) they differ in length by one carbon. D) they differ only in the configuration around one carbon atom. E) they rotate plane-polarized light in the same direction.
D
Which DNA primer would have the HIGHEST melting temperature? A) GCATCGGC B) AATCGGAT C) ATACAGATCGGC D) ACCGGCAGGTCGGC E) ATACGCAGATCGGC
D
Which base compositions for single-stranded RNA are possible? %A %G %C %T %U A) 5 45 45 0 5 B) 25 25 25 0 25 C) 35 10 30 0 25 D) All of the answers are correct. E) None of the answers is correct.
D
Which compound is a heteropolysaccharide? A) cellulose B) chitin C) glycogen D) hyaluronate E) starch
D
Which compound(s) is/are a dominant feature of the outer membrane of the cell wall of gram- negative bacteria? A) amylose B) cellulose C) glycoproteins D) lipopolysaccharides E) lipoproteins
D
Which description of a ganglioside is MOST accurate? A) the dominant surface feature of gram-negative bacteria. B) the dominant surface feature of gram-positive bacteria. C) an oligosaccharide chain attached to a newly synthesized protein in the ER D) a membrane lipid in which the polar head group is a complex oligosaccharide containing at least one sialic acid E) a membrane lipid in which the oligosaccharide is attached to a mucin
D
Which drug is NOT lipid based? A) prednisone B) warfarin C) erythromycin D) aspirin E) lovastatin
D
Which health effect is NOT associated with consumption of trans fats? A) lowering of HDL cholesterol B) increased inflammatory response in the body C) raising of LDL cholesterol D) increased joint flexibility due to additional membrane fluidity E) increased risk of heart disease
D
Which of following is an anomeric pair? A) D-glucose and D-fructose B) D-glucose and L-fructose C) D-glucose and L-glucose D) alpha-D-glucose and beta-D-glucose E) alpha-D-glucose and beta-L-glucose
D
Which of the following are possible base compositions for single-stranded RNA? %A %G %C %T %U A) 5 45 45 0 5 B) 25 25 25 0 25 C) 35 10 30 0 25 D) All of the above E) None of the above
D
Which of the following contains an ether-linked alkyl group? A) Cerebrosides B) Gangliosides C) Phosphatidyl serine D) Platelet-activating factor E) Sphingomyelin
D
Which of the following is a dominant feature of the outer membrane of the cell wall of gram negative bacteria? A) Amylose B) Cellulose C) Glycoproteins D) Lipopolysaccharides E) Lipoproteins
D
Which of the following is a heteropolysaccharide? A) Cellulose B) Chitin C) Glycogen D) Hyaluronate E) Starch
D
Which of the following is a palindromic sequence? A) AGGTCC TCCAGG B) CCTTCC GCAAGG C) GAATCC CTTAGG D) GGATCC CCTAGG E) GTATCC CATAGG
D
Which of the following is the major difference between glycogen and amylopectin? A) glycogen contains -glycosidic bonds, amylopectin contains -glycosidic bonds B) glycogen is branched, amylopectin is linear C) glycogen contains a reducing end, amylopectin does not D) glycogen contains about twice the number of branch points as amylopectin E) glycogen is found in plants, amylopectin is found in animals
D
Which of the following sequences represents a recognition site for N-linked glycosylation where X is any amino acid except Pro? A) Gln—X—Ser B) His—X—Ser C) Arg—X—Ser D) Asn—X—Ser E) Asp—X—Ser
D
Which of the following statements about membrane lipids is true? A) Glycerophospholipids are found only in the membranes of plant cells. B) Glycerophospholipids contain fatty acids linked to glycerol through amide bonds. C) Lecithin (phosphatidylcholine), which is used as an emulsifier in margarine and chocolate, is a sphingolipid. D) Some sphingolipids include oligosaccharides in their structure. E) Triacylglycerols are the principal components of erythrocyte membranes.
D
Which of the following statements applies to all artificial sweeteners? A) Artificial sweeteners cannot be readily metabolized. B) Artificial sweeteners are peptides and provide important amino acids. C) Artificial sweeteners have fewer calories than sucrose. D) Artificial sweeteners are much sweeter than sucrose. E) all of the above
D
Which of the following would be positively charged at physiological pH? A) glucuronic acid B) fructose-6-phosphate C) xylitol D) glucosamine E) all of the above
D
Which of these polysaccharides is a branched polymer? A) chitin B) amylose C) cellulose D) amylopectin E) hyaluronic acid
D
Which one of the following is true of the pentoses found in nucleic acids? A) C-5 and C-1 of the pentose are joined to phosphate groups. B) The pentoses are in a planar configuration. C) The bond that joins nitrogenous bases to pentoses is an O-glycosidic bond. D) The pentoses are always in the β-furanose forms. E) The straight-chain and ring forms undergo constant interconversion
D
Which pair is anomeric? A) D-glucose and D-fructose B) D-glucose and L-fructose C) D-glucose and L-glucose D) a-D-glucose and b-D-glucose E) a-D-glucose and b-L-glucose
D
Which polysaccharide is NOT a homopolysaccharide? A) glycogen B) chitin C) amylose D) glycosaminoglycan E) dextran
D
Which reason is the MOST plausible for why most hexoses of living organisms are D isomers? A) D isomers are more energetically favorable. B) D isomers are also used by amino acids. C) Sugars must be opposite isomers from amino acids. D) Evolving enzymes were made to remain with an initial preference. E) Evolving enzymes switch preference often to find the best isomer.
D
Which sequence is palindromic? A) AGGTCC TCCAGG B) CCTTCC GCAAGG C) GAATCC CTTAGG D) GGATCC CCTAGG E) GTATCC CATAGG
D
Which statement about hydrogen bonding in glycogen and cellulose is TRUE? A) Glycogen forms more internal H-bonds than cellulose. B) Extensive internal hydrogen bonding makes cellulose more water soluble than glycogen. C) Extensive hydrogen bonding with water makes cellulose more soluble than glycogen. D) Glycogen primarily forms hydrogen bonds within a single chain. E) The hydrogen bonding in cellulose favors a helical conformation.
D
Which statement about membrane lipids is TRUE? A) Glycerophospholipids are found only in the membranes of plant cells. B) Glycerophospholipids contain fatty acids linked to glycerol through amide bonds. C) Lecithin (phosphatidylcholine), which is used as an emulsifier in margarine and chocolate, is a sphingolipid. D) Some sphingolipids include oligosaccharides in their structure. E) Triacylglycerols are the principal components of erythrocyte membranes.
D
Which statement describes a function of the addition of methyl groups to DNA? A) Methylation is used by E. coli as part of a defense mechanism to distinguish its DNA from foreign DNA. B) Methylation serves as a marker during repair of DNA during replication. C) Methylation of DNA occurs in some animals when infected with certain bacteriophages. D) All of the statements describe a function of DNA methylation. E) None of the statements describes a function of DNA methylation.
D
Which statement is NOT a reason that it is difficult to study oligosaccharide composition from biological systems? A) Oligosaccharides are often branched. B) Oligosaccharides often have a high negative charge density. C) Oligosaccharides have a variety of linkages (e.g., a1®6 or b1®4). D) Oligosaccharides have too much conformational flexibility. E) There are no specific glycosidase enzymes that can be used to selectively digest oligosaccharides.
D
Which statement is TRUE about fatty acids? A) Fatty acids with longer chains have higher melting points. B) Fatty acids with longer chains have lower solubility in water. C) Fatty acids with more double bonds have higher melting points. D) Fatty acids with longer chains have higher melting points and lower solubility in water. E) None of the statements is true.
D
Which statement is TRUE of the pentoses found in nucleic acids? A) C-5 and C-1 of the pentose are joined to phosphate groups. B) The pentoses are in a planar configuration. C) The bond that joins nitrogenous bases to pentoses is an O-glycosidic bond. D) The pentoses are always in the β-furanose forms. E) The straight-chain and ring forms undergo constant interconversion.
D
Which statement provides the MOST compelling reason to devote resources to study cellulose- degrading enzymes? A) Humans could use cellulose as a food source. B) Biomass could be converted to crude oil under high pressure. C) Symbiotic microorganisms in digestive tracts could be used as treatments in some GI tract diseases. D) Biomass could be converted more easily to bioenergy. E) None of the answers is correct.
D
Which technique separates lipids based on their affinity for a silica gel material? A) thin-layer chromatography B) adsorption chromatography C) mass spectrometry D) both thin-layer and absorption chromatography E) both thin-layer chromatography and mass spectrometry
D
Which types of lipids would NOT have their fatty acids completely hydrolyzed by treatment with acid or alkali? A) triacylglycerols B) galactolipids C) sphingomyelins D) plasmalogens E) phosphatidylcholines
D
Which vitamin is derived from cholesterol?
D
Why is it surprising that the side chains of tryptophan residues in lectins can interact with sugars? A) because the side chain of tryptophan is hydrophilic and sugars are hydrophobic B) because the side chain of tryptophan is (-) charged and sugars are generally (+) charged or neutral C) because the side chain of tryptophan can make hydrogen bonds and sugars cannot D) because the side chain of tryptophan is hydrophobic and sugars are generally hydrophilic E) None of the answers is correct.
D
_____ contain(s) an ether-linked alkyl group. A) Cerebrosides B) Gangliosides C) Phosphatidyl serine D) Platelet-activating factor E) Sphingomyelin
D
_____ is NOT a biological use of waxes. A) Energy storage B) Lubrication C) Structure D) Insulation E) Waterproofing
D
What is an Enantiomer in monosaccharides?
D & L conformations are enantiomers of each other
Which of the following statements applies to all artificial sweeteners? A) Artificial sweeteners cannot be readily metabolized. B) Artificial sweeteners are peptides and provide important amino acids. C) Artificial sweeteners have fewer calories than sucrose. D) Artificial sweeteners are much sweeter than sucrose. E) all of the above
D - Artificial sweeteners are much sweeter than sucrose
Which of these polysaccharides is a branched polymer? A) chitin B) amylose C) cellulose D) amylopectin E) hyaluronic acid
D - amylopectin
Chitin differs from cellulose due to A) inversion of configuration at the anomeric carbon. B) sulfonation of the C2 OH group. C) a much greater prevalence of branching. D) replacement of the C2 OH group by an acetamido group. E) replacement of the C6 OH group by an amino group.
D - replaces the C2 OH group with an acetamido group
A restriction endonuclease that has a recognition sequence of 8 bp in length would be expected to cut dsDNA on average once in how many base pairs? A) 256 B) 1024 C) 4096 D) 65536 E) 1048576
D) 65536
A good expression vector for protein expression in E. coli should have which feature(s)? A) an origin of replication B) a selectable marker C) a promoter, operator, and ribosome-binding site D) All of the answers are correct. E) None of the answers is correct.
D) All of the answers are correct.
Common problems with expression of eukaryotic proteins in bacteria may include proteins: A) aggregating into inclusion bodies. B) not folding correctly due to absence of chaperones. C) not undergoing posttranslational modification. D) All of the answers are correct. E) None of the answers is correct.
D) All of the answers are correct.
During their multiple migrations from Africa to the rest of the world, gene flow likely occurred between which populations of early humanoids? A) between Neanderthals and modern humans B) between Denisovans and modern humans C) between Neanderthals and Denisovans D) All of the answers are correct. E) None of the answers is correct.
D) All of the answers are correct.
Which factor is required to accurately determine the relative amount of gene expression of two or more genes in an organism using qPCR? A) a "no template" control B) an oligonucleotide probe labeled with a fluorophore and a quenching molecule at its ends C) use of reverse transcriptase to copy the RNA products into DNA D) All of the answers are correct. E) None of the answers is correct.
D) All of the answers are correct.
Yeast two-hybrid analysis functions due to which reason? A) The DNA-binding domain and transcriptional activation domain of a separated transcription factor are only brought into close proximity when the two proteins of interest interact with each other. B) The DNA-binding domain and the transcriptional activation domain of a separated transcription factor may remain stable independent of each other. C) Yeast can be grown as either a haploid or a diploid cell. D) All of the answers are correct. E) None of the answers is correct.
D) All of the answers are correct.
Why are hydropathy plots NOT usually used to detect transmembrane b strands in porins? A) The length of a transmembrane b strand is typically shorter than that of an a helix. B) Amino acids in transmembrane b strands in porins may not be exclusively hydrophobic. C) Amino acid side chains project away from the polypeptide in a b sheet D) Answers A and B are both correct. E) All of the answers are correct.
D) Answers A and B are both correct. (the length of transmembrane b amino acid side chains project)
46. Which of the following statements applies to all artificial sweeteners? A) Artificial sweeteners cannot be readily metabolized. B) Artificial sweeteners are peptides and provide important amino acids. C) Artificial sweeteners have fewer calories than sucrose. D) Artificial sweeteners are much sweeter than sucrose. E) all of the above
D) Artificial sweeteners are much sweeter than sucrose.
60. Which of the following sequences represents a recognition site for N-linked glycosylation where X is any amino acid except Pro? A) Gln—X—Ser B) His—X—Ser C) Arg—X—Ser D) Asn—X—Ser E) Asp—X—Ser
D) Asn—X—Ser
51. Which statement provides the MOST compelling reason to devote resources to study cellulose-degrading enzymes? A) Humans could use cellulose as a food source. B) Biomass could be converted to crude oil under high pressure. C) Symbiotic microorganisms in digestive tracts could be used as treatments in some GI tract diseases. D) Biomass could be converted more easily to bioenergy. E) None of the answers is correct.
D) Biomass could be converted more easily to bioenergy
When forming the disaccharide maltose from two glucose monosaccharides: A) water is eliminated. B) a hemiacetal is converted to an acetal. C) the resulting dissacharide is no longer a reducing sugar. D) Both A and B E) A, B, and C above
D) Both A and B
Which restriction endonuclease cuts DNA in a way that leaves blunt ends? A) EcoRI B) HindIII C) BamHI D) EcoRV E) PstI
D) EcoRV
Which statement is TRUE about fatty acids? A) Fatty acids with longer chains have higher melting points. B) Fatty acids with longer chains have lower solubility in water. C) Fatty acids with more double bonds have higher melting points. D) Fatty acids with longer chains have higher melting points and lower solubility in water. E) None of the statements is true.
D) Fatty acids with longer chains have higher melting points and lower solubility in water.
17. Which statement about hydrogen bonding in glycogen and cellulose is TRUE? A) Glycogen forms more internal H-bonds than cellulose. B) Extensive internal hydrogen bonding makes cellulose more water soluble than glycogen. C) Extensive hydrogen bonding with water makes cellulose more soluble than glycogen. D) Glycogen primarily forms hydrogen bonds within a single chain. E) The hydrogen bonding in cellulose favors a helical conformation.
D) Glycogen primarily forms hydrogen bonds within a single chain
Which of the following statements about hydrogen bonding in glycogen and cellulose is true? A) Glycogen forms more internal H-bonds than cellulose. B) Extensive internal hydrogen bonding makes cellulose more water soluble than glycogen. C) Extensive hydrogen bonding with water makes cellulose more soluble than glycogen. D) Glycogen primarily forms hydrogen bonds within a single chain. E) The hydrogen bonding in cellulose favors a helical conformation.
D) Glycogen primarily forms hydrogen bonds within a single chain.
Which statement is NOT correct? A) Humans and chimpanzees share a common ancestor. B) Orangutans are an outgroup when compared with humans and chimpanzees. C) Humans and chimpanzees differ over approximately 4% of their genomes. D) Humans evolved from chimpanzees. E) Humans have 23 pairs of chromosomes, while chimpanzees have 24 pairs of chromosomes.
D) Humans evolved from chimpanzees.
16. Which of the following is a heteropolysaccharide? A) Cellulose B) Chitin C) Glycogen D) Hyaluronate E) Starch
D) Hyaluronate
Which of the following is a heteropolysaccharide? A) Cellulose B) Chitin C) Glycogen D) Hyaluronate E) Starch
D) Hyaluronate
Which of the following is a heteropolysaccharide? A) Cellulose B) Chitin C) Glycogen D) Hyaluronate E) Starch
D) Hyaluronate is a heteropolysaccharide. (made of alternating residues of D-glucuronic acid and N-acetylglucosamine)
_____ is NOT a biological use of waxes. A) Energy storage B) Lubrication C) Structure D) Insulation E) Waterproofing
D) Insulation
36. When drawing a Haworth perspective formula from a Fisher projection, which statement is TRUE regarding anomers? A) It is -a- if the hydroxyl group on the anomeric carbon is up. B) It is -a- if the hydroxyl group on the anomeric carbon is down C) It is -a- if the hydroxyl group on the anomeric carbon on the same side of the ring as the C6 D) It is -a- if the hydroxyl group on the anomeric carbon on the opposite side of the ring as the C6 E) None of the answers is correct.
D) It is -a- if the hydroxyl group on the anomeric carbon on the opposite side of the ring as the C6
19. Which of the following is a dominant feature of the outer membrane of the cell wall of gram negative bacteria? A) Amylose B) Cellulose C) Glycoproteins D) Lipopolysaccharides E) Lipoproteins
D) Lipopolysaccharides
Which of the following is a dominant feature of the outer membrane of the cell wall of gram-negative bacteria? A) Amylose B) Cellulose C) Glycoproteins D) Lipopolysaccharides E) Lipoproteins
D) Lipopolysaccharides
Which of the following is a dominant feature of the outer membrane of the cell wall of gram negative bacteria? A) Amylose B) Cellulose C) Glycoproteins D) Lipopolysaccharides E) Lipoproteins
D) Lipopolysaccharides is a dominant feature of the outer membrane of the cell wall of gram negative bacteria.
Which of the following is not a reason that it is difficult to study oligosaccharide composition from biological systems? A) Oligosaccharides are often branched. B) Oligosaccharides often have a high negative charge density. C) Oligosaccharides have a variety of linkages (e.g., alpha1->6 or beta1->4). D) Oligosaccharides have too much conformational flexibility. E) There are no specific glycosidase enzymes that can be used to selectively digest oligosaccharides.
D) Oligosaccharides have too much conformational flexibility.
_____ contain(s) an ether-linked alkyl group. A) Cerebrosides B) Gangliosides C) Phosphatidyl serine D) Platelet-activating factor E) Sphingomyelin
D) Platelet-activating factor
Integral membrane proteins tend to be enriched for regular secondary structures in the transmembrane portions of their structures. Which statement explains this observation? A) Regular secondary structures allow for polar amino acids to interact with lipid head groups. B) Regular secondary structures allow the polypeptide to interact with the membrane core. C) Regular secondary structures are energetically favorable for polypeptides. D) Regular secondary structures satisfy hydrogen-bonding potential of the backbone in a hydrophobic environment.
D) Regular secondary structures satisfy hydrogen-bonding potential of the backbone in a hydrophobic environment.
Which statement about membrane lipids is TRUE? A) Glycerophospholipids are found only in the membranes of plant cells. B) Glycerophospholipids contain fatty acids linked to glycerol through amide bonds. C) Lecithin (phosphatidylcholine), which is used as an emulsifier in margarine and chocolate, is a sphingolipid. D) Some sphingolipids include oligosaccharides in their structure. E) Triacylglycerols are the principal components of erythrocyte membranes.
D) Some sphingolipids include oligosaccharides in their structure.
Advantages to using triacylglycerols, rather than polysaccharaides, to store energy include which reason(s)? A) The carbon atoms of triacylglycerols are more reduced. B) Triacylglycerols contain more oxygen than polysaccharides and therefore are more efficient to oxidize. C) Since triacylglycerols are hydrophobic, excess water does not need to be stored along with them. D) The carbon atoms of triacylglycerols are more reduced, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them. E) Triacylglycerols contain more oxygen than polysaccharides and therefore are more efficient to oxidize, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them.
D) The carbon atoms of triacylglycerols are more reduced, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them.
Which statement is TRUE concerning the chloride-bicarbonate exchanger? A) This transporter is electrogenic. B) The exchanger is a passive antiporter. C) This protein is involved in carbon dioxide transport in the blood stream. D) The exchanger is a passive antiporter, and this protein is involved in carbon dioxide transport in the blood stream. E) This transporter is electrogenic, and the exchanger is a passive antiporter.
D) The exchanger is a passive antiporter, and this protein is involved in carbon dioxide transport in the blood stream.
27. At equilibrium in solution, D-glucose consists of a mixture of its anomers. Which statement most accurately describes this solution? A) The solution consists of approximately equal amounts of the α- and β-anomers. B) The straight-chain form is present in high concentration. C) The α-anomer is more stable and is slightly preferred over the β-anomer. D) The β-anomer predominates over the α-anomer by a ratio of approximately 2:1. E) None of the answers above is correct.
D) The β-anomer predominates over the α-anomer by a ratio of approximately 2:1.
Which of the following statements about type II restriction enzymes is false? A) Many make staggered (off-center) cuts within their recognition sequences. B) Some cut DNA to generate blunt ends. C) They are part of a bacterial defense system in which foreign DNA is cleaved. D) They cleave and ligate DNA. E) They cleave DNA only at recognition sequences specific to a given restriction enzyme
D) They cleave and ligate DNA.
Which statement about Type II restriction enzymes is FALSE? A) Many make staggered (off-center) cuts within their recognition sequences. B) Some cut DNA to generate blunt ends. C) They are part of a bacterial defense system in which foreign DNA is cleaved. D) They cleave and ligate DNA. E) They cleave DNA only at recognition sequences specific to a given restriction enzyme.
D) They cleave and ligate DNA.
The gene for green fluorescent protein was originally isolated from which species? A) a panda B) a firefly C) a mushroom D) a jellyfish E) a glowworm
D) a jellyfish
69. Which description of a ganglioside is MOST accurate? A) the dominant surface feature of gram-negative bacteria. B) the dominant surface feature of gram-positive bacteria. C) an oligosaccharide chain attached to a newly synthesized protein in the ER D) a membrane lipid in which the polar head group is a complex oligosaccharide containing at least one sialic acid E) a membrane lipid in which the oligosaccharide is attached to a mucin
D) a membrane lipid in which the polar head group is a complex oligosaccharide containing at least one sialic acid
If you want to clone a gene by using E. coli and then transfer that cloned gene into yeast to express the protein the gene encodes, what type of self-replicating DNA should you use for your cloning process? A) a bacmid B) a plasmid C) a yeast artificial chromosome D) a shuttle vector E) a bacterial artificial chromosome
D) a shuttle vector
If you wanted to clone a large fragment of DNA into a unicellular eukaryotic host, what would you use? A) a bacmid B) a plasmid C) a bacterial artificial chromosome D) a yeast artificial chromosome E) a virus
D) a yeast artificial chromosome
6. Which pair is anomeric? A) D-glucose and D-fructose B) D-glucose and L-fructose C) D-glucose and L-glucose D) a-D-glucose and B-D-glucose E) a-D-glucose and B-L-glucose
D) a-D-glucose and B-D-glucose
Consider the transport of K+ from the blood (where its concentration is about 4 mM) into an erythrocyte that contains 150 mM K+. The transmembrane potential is about 60 mV, inside negative relative to outside. What is the free-energy change for this transport process? (These values may be of use to you: R = 8.315 J/mol . K; T = 298 K; Á (Faraday constant) = 96,480 J/V; N = 6.022 × 1023/mol.) A) about 5 J/mol B) about 15 J/mol C) about 5 kJ/mol D) about 15 kJ/mol E) It is impossible to calculate with the information given.
D) about 15 kJ/mol
49. Which of these polysaccharides is a branched polymer? A) chitin B) amylose C) cellulose D) amylopectin E) hyaluronic acid
D) amylopectin
Which type of organism do you NOT expect to express functionally fluorescent GFP? A) an obligate aerobe B) a multicellular eukarotic organism C) a facultative anaerobe D) an obligate anaerobe E) a unicellular eukaryotic organism
D) an obligate anaerobe
Which drug is NOT lipid based? A) prednisone B) warfarin C) erythromycin D) aspirin E) lovastatin
D) aspirin
59. In most cases, in order for an informational carbohydrate to become a biologically active molecule, it must: A) be an asymmetric molecule. B) contain a reducing sugar. C) contain an O-glycosidic bond. D) be covalently joined to a protein or lipid. E) be present in the extracellular matrix.
D) be covalently joined to a protein or lipid.
Why is it surprising that the side chains of tryptophan residues in proteins can interact with lectins? A) because the side chain of tryptophan is hydrophilic and lectins are hydrophobic. B) because the side chain of tryptophan is (-) charged and lectins are generally (+) charged or neutral. C) because the side chain of tryptophan can make hydrogen bonds and lectins cannot. D) because the side chain of tryptophan is hydrophobic and lectins are generally hydrophilic. E) None of the above
D) because the side chain of tryptophan is hydrophobic and lectins are generally hydrophilic.
Triacylglycerols are composed of: A) a glycerol backbone. B) three fatty acids. C) amide linkages between the fatty acids and the glycerol. D) both a glycerol backbone and three fatty acids. E) a glycerol backbone, three fatty acids, and amide linkages between the fatty acids and the glycerol.
D) both a glycerol backbone and three fatty acids.
A patient you are treating appears to be deficient in vitamin D. You have previously prescribed vitamin D supplements, but they do not appear to be working. Which organs and/or tissues should you check to make sure that the enzymes they produce are functioning appropriately? A) the liver B) the kidneys C) the pancreas D) both a the liver and the kidneys E) the liver, the kidneys, and the pancreas
D) both a the liver and the kidneys
29. A glycoconjugate molecule may include a carbohydrate as well as: A) an amino acid. B) a lipid. C) a saccharide. D) both an amino acid and a lipid. E) an amino acid, a lipid, and a saccharide.
D) both an amino acid and a lipid
Which factor contributes to the selectivity pore of the potassium channel from S. lividans? A) backbone carbonyl groups in irregular secondary structures B) negatively charged amino acids near the channel opening C) the N-terminal ends of 4 a helices D) both backbone carbonyl groups in irregular secondary structures and negatively charged amino acids near the channel opening E) both backbone carbonyl groups in irregular secondary structures and the N-terminal ends of 4 a helices
D) both backbone carbonyl groups in irregular secondary structures and negatively charged amino acids
Which transporters can be classified as active transporters? A) flippases B) floppases C) scramblases D) both flippases and floppases E) both flippases and scramblases
D) both flippases and floppases
Which structure describes an integral membrane protein containing a b barrel? A) maltoporin B) aquaporin C) E. coli OmpF D) both maltoporin and E. coli OmpF E) both maltoporin and aquaporin
D) both maltoporin and E. coli OmpF
Nonsteroidal antiinflammatory drugs (NSAIDs) inhibit the synthesis of which signaling lipids from arachidonic acid? A) prostaglandins B) thromboxanes C) leukotrienes D) both prostaglandins and thromboxanes E) both thromboxanes and leukotrienes
D) both prostaglandins and thromboxanes
80. A microarray of oligosaccharides can be used to determine: A) specificity of lectin binding. B) affinity of lectin binding. C) conformational flexibility of lectin binding. D) both specificity and affinity of lectin binding. E) both specificity and conformational flexibility of lectin binding.
D) both specificity and affinity of lectin binding.
Especially stable haplotypes exist in which portions of the human genome due to their relative lack of meiotic recombination? A) the Y chromosome B) the X chromosome C) the mitochondrial genome D) both the Y chromosome and the mitochondrial genome E) both the X chromosome and the mitochondrial genome
D) both the Y chromosome and the mitochondrial genome
53. The difference in interchain stability between the polysaccharides glycogen and cellulose is due to: A) the different glycosidic linkages of the molecules. B) the different hydrogen bonding partners of the individual chains. C) the incorporation of complex ions in the three dimensional structures of both polysaccharides. D) both the different glycosidic linkages of the molecules and the different hydrogen bonding partners of the individual chains. E) None of the answers is correct.
D) both the different glycosidic linkages of the molecules and the different hydrogen bonding partners of the individual chains
Which technique separates lipids based on their affinity for a silica gel material? A) thin-layer chromatography B) adsorption chromatography C) mass spectrometry D) both thin-layer and absorption chromatography E) both thin-layer chromatography and mass spectrometry
D) both thin-layer and absorption chromatography
Which compound is NOT needed in 454 pyrosequencing of DNA? A) dNTPs B) sulfurylase C) luciferase D) ddNTPs E) apyrase
D) ddNTPs
Which technique used to analyze lipids is the fastest but may not be the most accurate? A) thin-layer chromatography B) high-performance chromatography C) nuclear magnetic resonance D) direct mass spectrometry E) gas chromatography
D) direct mass spectrometry
Glucose transport into erythrocytes is an example of: A) active transport. B) antiport. C) electrogenic uniport D) facilitated diffusion. E) symport.
D) facilitated diffusion.
Which compound(s) is/are NOT enriched in lipid rafts? A) sphingolipids B) cholesterol C) GPI-linked proteins D) farnesylated proteins E) All of these molecules are enriched in lipid rafts.
D) farnesylated proteins
Which health effect is NOT associated with consumption of trans fats? A) lowering of HDL cholesterol B) increased inflammatory response in the body C) raising of LDL cholesterol D) increased joint flexibility due to additional membrane fluidity E) increased risk of heart disease
D) increased joint flexibility due to additional membrane fluidity
The fluidity of a lipid bilayer will be increased by: A) decreasing the number of unsaturated fatty acids. B) decreasing the temperature. C) increasing the length of the alkyl chains. D) increasing the temperature. E) substituting 18:0 (stearic acid) in place of 18:2 (linoleic acid).
D) increasing the temperature.
Phospholipase C hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP2) to form which signaling molecule that triggers Ca2+ release from the endoplasmic reticulum? A) diacylglycerolphosphate (DAGP) B) inositol 5-monophosphate (IP1) C) diacylglycerol (DAG) D) inositol 1,4,5-triphosphate (IP3) E) inositol 4,5-bisphosphate (IP2)
D) inositol 1,4,5-triphosphate (IP3)
Which method is NOT used in linkage analysis? A) comparing densely spaced polymorphisms B) collecting DNA from a family affected by the disease of interest C) sequencing selected parts of the genome D) introducing retroviruses at the mutated locus E) looking for SNP variants
D) introducing retroviruses at the mutated locus
62. Proteins that bind to specific carbohydrates are called ______. A) pectins B) oligonucleotides C) glycosaminoglycans D) lectins E) chitins
D) lectins
What is the meaning of the term "annular lipid"? A) lipids that tend to form micelle structures B) lipids that are formed from the degradation of phospholipids C) lipids that are prosthetic groups in lipid-anchored proteins D) lipids that are found in close association with integral membrane proteins. E) None of the answers is correct.
D) lipids that are found in close association with integral membrane proteins.
The biochemical activity of a protein, such as its enzymatic activity, is called its _____ function. A) phenotypic B) genotypic C) cellular D) molecular E) organismal
D) molecular
Which types of lipids would NOT have their fatty acids completely hydrolyzed by treatment with acid or alkali? A) triacylglycerols B) galactolipids C) sphingomyelins D) plasmalogens E) phosphatidylcholines
D) plasmalogens
If a patient you are treating has asthmatic attacks due to the overproduction of leukotrienes, which drug would you prescribe to help treat that condition? A) testosterone B) ibuprofen C) aspirin D) prednisone E) warfarin
D) prednisone
50. Chitin differs from cellulose due to A) inversion of configuration at the anomeric carbon. B) sulfonation of the C2 OH group. C) a much greater prevalence of branching. D) replacement of the C2 OH group by an acetamido group. E) replacement of the C6 OH group by an amino group.
D) replacement of the C2 OH group by an acetamido group.
The type of membrane transport that uses ion gradients as the energy source is: A) facilitated diffusion B) passive transport. C) primary active transport. D) secondary active transport. E) simple diffusion.
D) secondary active transport.
Which repeating sequences in the human genome are the targets of technologies used in forensic DNA analysis? A) simple-sequence repeats B) single nucleotide polymorphisms C) introns D) short tandem repeats E) long repetitive sequences
D) short tandem repeats
You are comparing the DNA sequences of several species with a shared evolutionary ancestry. Species 1 has a sequence of ATGCCA, species 2 has a sequence of ATACCA, species 3 has a sequence of ATACTA, species 4 has a sequence of ACACTG, and species 5 has a sequence of ATGCCA. Which species is an outgroup compared with all the others? A) species 1 B) species 2 C) species 3 D) species 4 E) species 5
D) species 4
Membrane fusion leading to neurotransmitter release requires the action of: A) cadherins. B) selectins. C) flipases. D) tSNARE and vSNARE. E) None of the answers is correct.
D) tSNARE and vSNARE.
4. When two carbohydrates are epimers: A) one is a pyranose, the other a furanose. B) one is an aldose, the other a ketose. C) they differ in length by one carbon. D) they differ only in the configuration around one carbon atom. E) they rotate plane-polarized light in the same direction.
D) they differ only in the configuration around one carbon atom
When two carbohydrates are epimers: A) one is a pyranose, the other a furanose. B) one is an aldose, the other a ketose. C) they differ in length by one carbon. D) they differ only in the configuration around one carbon atom. E) they rotate plane-polarized light in the same direction.
D) they differ only in the configuration around one carbon atom.
61. O-linked oligosaccharides are commonly attached to the —OH group of _____. A) ribose B) tyrosine C) lysine D) threonine E) glycine
D) threonine
Specific hydrolysis of phosphatidylcholine can be achieved by which technique? A) treatment of the lipid with phospholipase C B) treatment of the lipid with mild acid C) dissolving the lipid in chloroform D) treatment of the lipid with both phospholipase C and mild acid E) both treatment of the lipid with phospholipase C and dissolving the lipid in chloroform
D) treatment of the lipid with both phospholipase C and mild acid
77. High-performance liquid chromatography (HPLC) can be used to determine the: A) position(s) of glycosidic bonds in a polysaccharide. B) sequence of monosaccharides from a polysaccharide. C) sequence of monosaccharides, as well as position and configuration of glycosidic bonds. D) types and amounts of monosaccharide units in a polysaccharide. E) None of the answers is correct.
D) types and amounts of monosaccharide units in a polysaccharide.
If you want to express two different genes on different plasmids in a bacterial host, which procedure will NOT be successful? A) using plasmids that have the same promoter sequence B) using EcoRI and BamHI restriction endonucleases to clone the genes into their respective plasmids C) placing different fusion tags on each of the genes when cloning them D) using plasmids with the same origin of replication E) using plasmids that have different selectable markers
D) using plasmids with the same origin of replication
13. When forming the disaccharide maltose from two glucose monosaccharides: A) water is eliminated. B) a hemiacetal is converted to an acetal. C) the resulting dissacharide is no longer a reducing sugar. D) water is eliminated and a hemiacetal is converted to an acetal. E) None of the answers is correct.
D) water is eliminated and a hemiacetal is converted to an acetal
Which of following is an anomeric pair? A) D-glucose and D-fructose B) D-glucose and L-fructose C) D-glucose and L-glucose D) α-D-glucose and β-D-glucose E) α-D-glucose and β-L-glucose
D) α-D-glucose and β-D-glucose
Which of following is an anomeric pair? A) D-glucose and D-fructose B) D-glucose and L-fructose C) D-glucose and L-glucose D) α-D-glucose and β-D-glucose E) α-D-glucose and β-L-glucose
D) α-D-glucose and β-D-glucose
14. Starch and glycogen are both polymers of: A) fructose. B) glucose1-phosphate. C) sucrose. D) α-D-glucose. E) β-D-glucose.
D) α-D-glucose.
Starch and glycogen are both polymers of: A) fructose. B) glucose1-phosphate. C) sucrose. D) α-D-glucose. E) β-D-glucose.
D) α-D-glucose.
Starch and glycogen are both polymers of: A) fructose. B) glucose1-phosphate. C) sucrose. D) α-D-glucose. E) β-D-glucose.
D) α-D-glucose.
At equilibrium in solution, D-glucose consists of a mixture of its anomers. Which statement most accurately describes this solution? A) The solution consists of approximately equal amounts of the a- and B-anomers. B) The straight-chain form is present in high concentration. C) The a-anomer is more stable and is slightly preferred over the B-anomer. D) The B-anomer predominates over the a-anomer by a ratio of approximately 2:1. E) None of the answers above is correct.
D- The beta anomer predominated over the alpha anomer by a ratio of approx. 2:1
O-linked oligosaccharides are commonly attached to the —OH group of _____. A) ribose B) tyrosine C) lysine D) threonine E) glycine
D- Threonine and Serine
D-Glucose is called a reducing sugar because it undergoes an oxidation-reduction reaction at the anomeric carbon. One of the products of this reaction is: A) D-galactose. B) D-gluconate. C) D-glucuronate. D) D-ribose. E) muramic acid.
D-Glucose is called a reducing sugar because it undergoes an oxidation-reduction reaction at the anomeric carbon. One of the products of this reaction is: B) D-gluconate.
Which pair is epimeric? A) D-glucose and D-glucosamine B) D-glucose and D-mannose C) D-glucose and L-glucose D) D-lactose and D-sucrose E) L-mannose and L-fructose
D-glucose and D-mannose
To possess optical activity, a chemical compound must be A. a hexose B. aromatic C. symmetric D. asymmetric
D. asymmetric
Describe the monosaccharide units and their linkages in the common disaccharides and polysaccharides.
Disaccharides and poly saccharides are made up of monosaccharides linked together by glycosidic bonds. These can occur at any hydroxyl group on a monosaccharide, which is why they can form branched polymers as well as linear polymers (unlike proteins and nucleic acids)
Phospholipase B1 (DOES/DOES NOT) hydrolyzes the fatty acid from the 2-position on the glycerol backbone.
Does not
12. An alternative repair system by error-prone translesion DNA synthesis can result in a high mutation rate, because: A) alternative modified nucleotides can be incorporated more readily. 3 B) interference from the RecA and SSB proteins hinders the normal replication accuracy. C) replication proceeds much faster than normal, resulting in many more mistakes. D) the DNA polymerases involved cannot facilitate base-pairing as well as DNA polymerase III. E) the DNA polymerases involved lack exonuclease proofreading activities.
E
16. Which of the following statements is false? In vitro, the strand-exchange reaction: A) can include formation of a Holliday intermediate. B) is accompanied by ATP hydrolysis. C) may involve transient formation of a three- or four-stranded DNA complex. D) needs RecA protein. E) requires DNA polymerase.
E
7. In a mammalian cell, DNA repair systems: A) are extraordinarily efficient energetically. B) are generally absent, except in egg and sperm cells. C) can repair deletions, but not mismatches. D) can repair most types of lesions except those caused by UV light. E) normally repair more than 99% of the DNA lesions that occur.
E
A hydropathy plot is used to: A) determine the water-solubility of a protein. B) deduce the quaternary structure of a membrane protein. C) determine the water content of a native protein. D) extrapolate for the true molecular weight of a membrane protein. E) predict whether a given protein sequence contains membrane-spanning segments.
E
A major component of RNA but not of DNA is: A) adenine. B) cytosine. C) guanine. D) thymine. E) uracil.
E
A major component of RNA but not of DNA is: A) adenine. B) cytosine. C) guanine. D) thymine. E) uracil
E
An electrogenic Na+ transporter: A) catalyzes facilitated diffusion of Na+ from a region of high Na+ concentration to one of lower Na+ concentration. B) must catalyze an electron transfer (oxidation-reduction) reaction simultaneously with Na+ transport. C) must transport both Na+ and a counterion (Cl-, for example). D) transports Na+ against its concentration gradient. E) transports Na+ without concurrent transport of any other charged species.
E
Chargaff's rules state that in typical DNA: A) A = G. B) A = C. C) A = U. D) A + T = G + C. E) A + G = T + C.
E
Chargaff's rules state that in typical DNA: A) A = G. B) A = C. C) A = U. D) A + T = G + C. E) A + G = T + C.
E
Glycoproteins A) are only found in bacteria. B) are extremely homogeneous. C) are typically less than 1% carbohydrate by weight. D) are assembled under strict genetic control. E) exhibit microheterogeneity.
E
Humans make which omega-3 polyunsaturated fatty acid from alpha-linolenic acid (ALA)? A) eicosapentaenoic acid (EPA) B) arachidonic acid (ARA) C) docosahexaenoic acid (DHA) D) both eicosapentaenoic acid (EPA) and arachidonic acid (ARA) E) both eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA)
E
Identify the molecule(s) derived from sterols. A) arachidonic acid B) gangliosides C) phosphatidylglycerol D) prostaglandins E) cortisol
E
Identify the molecule(s) derived from sterols. A) Arachidonic acid B) Gangliosides C) Phosphatidylglycerol D) Prostaglandins E) Vitamin D
E
In comparison with DNA-DNA double helices, the stability of DNA-RNA and RNA-RNA helices is: A) DNA-DNA > DNA-RNA > RNA-RNA. B) DNA-DNA > RNA-RNA > DNA-RNA. C) RNA-DNA > RNA-RNA > DNA-DNA. D) RNA-RNA > DNA-DNA > DNA-RNA. E) RNA-RNA > DNA-RNA > DNA-DNA.
E
In comparison with DNA-DNA double helices, the stability of DNA-RNA and RNA-RNA helices is: A) DNA-DNA > DNA-RNA > RNA-RNA. B) DNA-DNA > RNA-RNA > DNA-RNA. C) RNA-DNA > RNA-RNA > DNA-DNA. D) RNA-RNA > DNA-DNA > DNA-RNA. E) RNA-RNA > DNA-RNA > DNA-DNA.
E
In living cells, nucleotides and their derivatives can serve as: A) carriers of metabolic energy. B) enzyme cofactors. C) intracellular signals. D) precursors for nucleic acid synthesis. E) All of the answers are correct.
E
In living cells, nucleotides and their derivatives can serve as: A) carriers of metabolic energy. B) enzyme cofactors. C) intracellular signals. D) precursors for nucleic acid synthesis. E) all of the above.
E
In the Watson-Crick model of DNA structure (now called B-form DNA): A) a purine in one strand always hydrogen bonds with a purine in the other strand. B) A-T pairs share three hydrogen bonds. C) G-C pairs share two hydrogen bonds. D) the 5' ends of both strands are at one end of the helix. E) the bases occupy the interior of the helix.
E
In the Watson-Crick model of DNA structure (now called B-form DNA): A) a purine in one strand always hydrogen bonds with a purine in the other strand. B) A-T pairs share three hydrogen bonds. C) G-C pairs share two hydrogen bonds. D) the 5' ends of both strands are at one end of the helix. E) the bases occupy the interior of the helix
E
In the Watson-Crick model of DNA structure: A) both strands run in the same direction, 3' → 5'; they are parallel. B) phosphate groups project toward the middle of the helix, where they are protected from interaction with water. C) T can form three hydrogen bonds with either G or C in the opposite strand. D) the distance between the sugar backbone of the two strands is just large enough to accommodate either two purines or two pyrimidines. E) the distance between two adjacent bases in one strand is about 3.4 Å.
E
In the Watson-Crick model of DNA structure: A) both strands run in the same direction, 3' → 5'; they are parallel. B) phosphate groups project toward the middle of the helix, where they are protected from interaction with water. C) T can form three hydrogen bonds with either G or C in the opposite strand. D) the distance between the sugar backbone of the two strands is just large enough to accommodate either two purines or two pyrimidines. E) the distance between two adjacent bases in one strand is about 3.4 Å.
E
In the laboratory, several factors are known to cause alteration of the chemical structure of DNA. The factor(s) likely to be important in a living cell is (are): A) heat. B) low pH. C) oxygen. D) UV light. E) both C and D.
E
In the laboratory, several factors are known to cause alteration of the chemical structure of DNA. The factor(s) likely to be important in a living cell is/are: A) heat. B) low pH. C) oxygen. D) UV light. E) both oxygen and UV light.
E
Membrane proteins: A) are sometimes covalently attached to lipid moieties. B) are sometimes covalently attached to carbohydrate moieties. C) are composed of the same 20 amino acids found in soluble proteins. D) diffuse laterally in the membrane unless they are anchored E) have all of the properties listed above.
E
One of the MOST common regulatory second messengers in cells is: A) FAD. B) NAD+. C) coenzyme A. D) ATP. E) cAMP.
E
Overproduction of which types of signaling lipids causes asthmatic attacks? A) prostaglandins B) thromboxanes C) arachidonates D) lipoxins E) leukotrienes
E
Polysaccharides CANNOT be used by cells: A) as fuel storage molecules. B) for structural elements in cell walls. C) for structural elements in animal exoskeletons. D) for the extracellular matrix in animal cells. E) All of the answers are correct.
E
Purines have ____ ring(s), (each) containing _____ nitrogen(s), whereas pyrimidines have _____ ring(s), (each) containing _____ nitrogens. A) 1; 1; 1; 1 B) 1; 2; 1; 2 C) 2; 1; 1; 2 D) 2; 2; 1; 1 E) 2; 2; 1; 2
E
Purines have ____ ring(s), (each) containing _____ nitrogen(s), whereas pyrimidines have _____ ring(s), (each) containing _____ nitrogens. A) 1; 1; 1; 1 B) 1; 2; 1; 2 C) 2; 1; 1; 2 D) 2; 2; 1; 1 E) 2; 2; 1; 2
E
The "energy carrier" ATP is an example of a(n): A) deoxyribonucleoside triphosphate. B) dinucleotide. C) peptide. D) ribonucleotide. E) ribonucleoside triphosphate.
E
The "energy carrier" ATP is an example of a(n): A) deoxyribonucleoside triphosphate B) di-nucleotide C) peptide D) ribonucleotide E) ribonucleoside triphosphate
E
The antiviral drugs oseltamivir (Tamiflu) and zanamivir (Relenza) do NOT work by: A) inhibiting the viral enzyme that trims the host cell's oligosaccharides. B) causing the viral particles to aggregate. C) competing with the host cell's oligosaccharides for binding. D) preventing the release of viruses from the infected cell. E) All of the answers are correct.
E
The compound that consists of ribose linked by an N-glycosidic bond to N-9 of adenine is: A) a deoxyribonucleoside. B) a purine nucleotide. C) a pyrimidine nucleotide. D) adenosine monophosphate. E) adenosine.
E
The compound that consists of ribose linked by an N-glycosidic bond to N-9 of adenine is: A) a deoxyribonucleoside. B) a purine nucleotide. C) a pyrimidine nucleotide. D) adenosine monophosphate. E) adenosine
E
The phosphodiester bonds that link adjacent nucleotides in both RNA and DNA: A) always link A with T and G with C. B) are susceptible to alkaline hydrolysis. C) are uncharged at neutral pH. D) form between the planar rings of adjacent bases. E) join the 3' hydroxyl of one nucleotide to the 5' hydroxyl of the next.
E
The phosphodiester bonds that link adjacent nucleotides in both RNA and DNA: A) always link A with T and G with C. B) are susceptible to alkaline hydrolysis. C) are uncharged at neutral pH. D) form between the planar rings of adjacent bases. E) join the 3' hydroxyl of one nucleotide to the 5' hydroxyl of the next
E
The three-carbon monosaccharide _____ is a(n) _____. A) dihydroxyacetone; enantiomer B) fructose; triose C) ribose; hemiacetal D) galactose; ketose E) glyceraldehyde; aldose
E
Under what circumstance might an organism's patterns of glycosylation NOT be altered? A) development B) genetic diseases C) cancer D) cell differentiation E) All of the answers are correct.
E
What possible benefits are provided by extended conformation that the heteropolysaccharide glycosaminoglycans assume in solution? A) The repulsive forces of densely packed negative charges are minimized. B) The hydrophobic portions of the molecules may pack closely together to maximize van der Waals forces. C) The patterns of sulfated and nonsulfated sugar residues are more easily recognized by their respective ligands. D) The repulsive forces of densely packed negative charges are minimized, and the hydrophobic portions of the molecules may pack closely together to maximize van der Waals forces. E) The repulsive forces of densely packed negative charges are minimized, and the patterns of sulfated and nonsulfated sugar residues are more easily recognized by their respective ligands.
E
What strategy do cells use to overcome the modest affinity between an oligosaccharide and an individual CBD of a lectin? A) lectin multivalency B) expressing multiple lectin receptors C) placing multiple CBDs on a single lectin molecule D) both lectin multivalency and placing multiple CBDs on a single lectin molecule E) lectin multivalency, expressing multiple lectin receptors, and placing multiple CBDs on a single lectin molecule
E
When a tissue sample is homogenized in a extractant composed of chloroform, methanol, and water, followed by addition of more water to separate the liquid phases, which molecules will remain in the methanol/water phase? A) lipids B) proteins C) sugars D) both lipids and proteins E) both proteins and sugars
E
Which compound is NOT a glycerophospholipid? A) phosphatidylcholine B) phosphatidylethanolamine C) phosphatidylserine D) cardiolipin E) ceramide
E
Which compound is NOT a reducing sugar? A) fructose B) glucose C) glyceraldehyde D) ribose E) sucrose
E
Which compound is NOT a type of membrane lipid? A) sphingolipid B) glycerophospholipid C) sulfolipid D) sterol E) triacylglycerolipid
E
Which disaccharide does NOT have an anomeric carbon available for oxidation? A) Glc (a1«1a) Glc B) Glc (a1«2b) Fru C) Fru (b2«1a) Glc D) both Glc (a1«2b) Fru and Fru (b2«1a) Glc E) None of the above
E
Which lipid compound is NOT at least partially made from the condensation of isoprene units? A) sterols B) limonene C) beta-carotene D) vitamin E E) phosphatidylinositol
E
Which modification CANNOT be made to a sugar molecule by an organism? A) oxidation of the carbonyl carbon B) replacing a hydroxyl group with an amino group C) oxidizing a carbon atom to a carboxyl group D) replacing a hydroxyl group with a hydrogen atom. E) All of the answer choices are possible sugar derivatives.
E
Which molecules or substances contain, or are derived from, fatty acids? A) beeswax B) prostaglandins C) sphingolipids D) triacylglycerols E) All of these contain or are derived from fatty acids.
E
Which of the following are characteristic of cellulose?A) highly extended fibers B) (14) glycosidic bonds C) extensive hydrogen bonding between individual molecules D) unbranched polymer E) all of the above
E
Which of the following disaccharides has both anomeric carbons involved in the glycosidic bond? A) lactose B) maltose C) amylose D) chitin E) sucrose
E
Which of the following is a disaccharide? A) amylose B) saccharin C) aspartame D) amylopectin E) none of the above
E
Which of the following is an example of a heteropolysaccharide? A) cellulose B) chitin C) starch D) glycogen E) hyaluronic acid
E
Which of the following is not a reducing sugar? A) Fructose B) Glucose C) Glyceraldehyde D) Ribose E) Sucrose
E
Which of the following is the most abundant disaccharide? A) lactose B) cellulose C) α-amylose D) maltose E) sucrose
E
Which of the following molecules or substances contain, or are derived from, fatty acids? A) Beeswax B) Prostaglandins C) Sphingolipids D) Triacylglycerols E) All of the above contain or are derived from fatty acids.
E
Which of the following pairs is interconverted in the process of mutarotation? A) D-glucose and D-fructose B) D-glucose and D-galactose C) D-glucose and D-glucosamine D) D-glucose and L-glucose E) alpha-D-glucose and beta-D-glucose
E
Which of the following would have the HIGHEST melting temperature? A) 20-mer double-stranded DNA-DNA duplex B) 20-mer double-stranded RNA-RNA duplex C) 40-mer double-stranded DNA-DNA duplex D) 40-mer double-stranded DNA-RNA duplex E) 40-mer double-stranded RNA-RNA duplex
E
Which pair is interconverted in the process of mutarotation? A) D-glucose and D-fructose B) D-glucose and D-galactose C) D-glucose and D-glucosamine D) D-glucose and L-glucose E) a-D-glucose and b-D-glucose
E
Which phospholipid head group is positively charged at pH 7? A) serine B) ethanolamine C) choline D) both serine and ethanolamine E) both ethanolamine and choline
E
Which polysaccharide(s) can the enzyme a-amylase break? A) glycogen B) starch C) cellulose D) both glycogen and cellulose E) both glycogen and starch
E
Which statement is NOT true regarding phosphorylated sugar? A) It is trapped inside the cell membrane. B) It is relatively stable at neutral pH. C) It is activated for subsequent chemical transformation D) It can be a component of a nucleotide. E) All of the statements are true.
E
Which type of protein interaction is NOT one with the NS domains of heparan sulfate? A) conformational activation B) cell-surface localization/concentration C) enhanced protein-protein interaction D) binding extracellular signaling molecules E) All of the answer choices are types of protein interaction with heparan sulfate.
E
Which of the following is an example of a heteropolysaccharide? A) cellulose B) chitin C) starch D) glycogen E) hyaluronic acid
E - Hyaluronic acid
Which of the following is a disaccharide? A) amylose B) saccharin C) aspartame D) amylopectin E) none of the above
E - None of the above Disaccharides include lactose and sucrose
Which of the following is the most abundant disaccharide? A) lactose B) cellulose C) α-amylose D) maltose E) sucrose
E - Sucrose
Membrane proteins: A) are sometimes covalently attached to lipid moieties. B) are sometimes covalently attached to carbohydrate moieties. C) are composed of the same 20 amino acids found in soluble proteins. D) diffuse laterally in the membrane unless they are anchored E) All of the answers are correct.
E) All of the answers are correct.
Which molecules or substances contain, or are derived from, fatty acids? A) beeswax B) prostaglandins C) sphingolipids D) triacylglycerols E) All of these contain or are derived from fatty acids.
E) All of these contain or are derived from fatty acids.
58. N-linked oligosaccharides can be covalently linked to proteins at which amino acid? A) Gly B) Ser C) Glu D) Tyr E) Asn
E) Asn
37. Uronic acids A) are aldoses where the aldehyde is oxidized to a carboxylic acid. B) are aldoses where the 1° alcohol is oxidized to a carboxylic acid. C) can be found in the pyranose or furanose forms. D) A and C are both correct. E) B and C are both correct.
E) B and C are both correct.
In humans, the fatty acid composition of membrane lipids in skin cells is different from the fatty acid composition of membrane lipids in the internal organs because the internal organs function at a slightly higher temperature. Which difference in fatty acid composition is MOST likely to be observed? A) Skin cells show lower levels of 18:0 relative to 18:1 AND higher levels of 16:0 relative to 18:0. B) Skin cells show higher levels of 20:0 relative to 18:0 AND higher levels of 18:2 relative to 18:0. C) Skin cells show lower levels of 20:0 relative to 18:0 AND lower levels of 18:0 relative to 18:2. D) Skin cells show higher levels of 18:2 relative to 18:0 AND lower levels of 16:0 relative to 18:0. E) Both answers A and C are true.
E) Both answers A and C are true. (Skin cells show lower levels of 18:0 relative to 18:1 AND higher levels of 16:0 relative to 18:0. Skin cells show lower levels of 20:0 relative to 18:0 AND lower levels of 18:0 relative to 18:2.)
Which of the following is not a reducing sugar? A) Fructose B) Glucose C) Glyceraldehyde D) Ribose E) Sucrose
E) Sucrose is NOT a reducing sugar. (Sucrose does not have a reducing end, as it is made of the anomeric C of glucose and hydroxyl group of fructose via a alpha1-->beta4 linkage.)
Which of the following statements regarding plasmid cloning vectors is correct? A) Circular plasmids do not require an origin of replication to be propagated in E. coli. B) Foreign DNA fragments up to 45,000 base pairs can be cloned in a typical plasmid. C) Plasmids do not need to contain genes that confer resistance to antibiotics. D) Plasmid vectors must carry promoters for inserted gene fragments. E) The copy number of plasmids may vary from a few to several hundred.
E) The copy number of plasmids may vary from a few to several hundred.
Which statement regarding plasmid-cloning vectors is CORRECT? A) Circular plasmids do not require an origin of replication to be propagated in E. coli. B) Foreign DNA fragments up to 45,000 base pairs can be cloned in a typical plasmid. C) Plasmids do not need to contain genes that confer resistance to antibiotics. D) Plasmid vectors must carry promoters for inserted gene fragments. E) The copy number of plasmids may vary from a few to several hundred.
E) The copy number of plasmids may vary from a few to several hundred.
56. What possible benefits are provided by extended conformation that the heteropolysaccharide glycosaminoglycans assume in solution? A) The repulsive forces of densely packed negative charges are minimized. B) The hydrophobic portions of the molecules may pack closely together to maximize van der Waals forces. C) The patterns of sulfated and nonsulfated sugar residues are more easily recognized by their respective ligands. D) The repulsive forces of densely packed negative charges are minimized, and the hydrophobic portions of the molecules may pack closely together to maximize van der Waals forces. E) The repulsive forces of densely packed negative charges are minimized, and the patterns of sulfated and nonsulfated sugar residues are more easily recognized by their respective ligands.
E) The repulsive forces of densely packed negative charges are minimized, and the patterns of sulfated and nonsulfated sugar residues are more easily recognized by their respective ligands
Which bond or functional group is NOT found in a GPI anchor? A) a phosphodiester bond B) a glycosidic bond C) a hydroxyl group D) an ester bond E) a thioester bond
E) a thioester bond
What kind of bond can link a prenyl anchor to a polypeptide? A) an ester bond to an internal serine B) an amide bond to a glycine C) a thioester to a cysteine D) an ester bond to the C-terminus E) a thioether bond to a cysteine side chain
E) a thioether bond to a cysteine side chain
8. Which pair is interconverted in the process of mutarotation? A) D-glucose and D-fructose B) D-glucose and D-galactose C) D-glucose and D-glucosamine D) D-glucose and L-glucose E) a-D-glucose and B-D-glucose
E) a-D-glucose and B-D-glucose
Which transporter will move lipids from the outer leaflet to the cytosolic leaflet of a plasma membrane? A) a flippase B) a floppase C) a scramblase D) both a flippase and a floppase E) both a flippase and a scramblase
E) both a flippase and a scramblase
Which transporter will move lipids from the cytosolic leaflet to the outer leaflet of a plasma membrane? A) a flippase B) a floppase C) a scramblase D) both a flippase and a floppase E) both a floppase and a scramblase
E) both a floppase and a scramblase
What kind of bond can link a palmitoyl anchor to a polypeptide? A) an ester bond to an internal serine B) an amide bond to a glycine C) a thioester to a cysteine D) an ester bond to the C-terminus. E) both an ester bond to an internal serine and a thioester to a cysteine
E) both an ester bond to an internal serine and a thioester to a cysteine
Humans make which omega-3 polyunsaturated fatty acid from alpha-linolenic acid (ALA)? A) eicosapentaenoic acid (EPA) B) arachidonic acid (ARA) C) docosahexaenoic acid (DHA) D) both eicosapentaenoic acid (EPA) and arachidonic acid (ARA) E) both eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA)
E) both eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA)
Which phospholipid head group is positively charged at pH 7? A) serine B) ethanolamine C) choline D) both serine and ethanolamine E) both ethanolamine and choline
E) both ethanolamine and choline
When a tissue sample is homogenized in a extractant composed of chloroform, methanol, and water, followed by addition of more water to separate the liquid phases, which molecules will remain in the methanol/water phase? A) lipids B) proteins C) sugars D) both lipids and proteins E) both proteins and sugars
E) both proteins and sugars
Which process does NOT require a protein facilitator? A) simple diffusion B) ionophore-mediated diffusion C) a primary active uniport D) a passive antiporter E) both simple diffusion and ionophore-mediated diffusion
E) both simple diffusion and ionophore-mediated diffusion
Choline-containing lipids are enriched in the outer leaflet of erythrocyte plasma membranes. This includes: A) cardiolipin. B) phosphatidylinositol. C) sphingomyelin. D) phosphatidylcholine. E) both sphingomyelin and phosphatidylcholine.
E) both sphingomyelin and phosphatidylcholine
Which compound is NOT a glycerophospholipid? A) phosphatidylcholine B) phosphatidylethanolamine C) phosphatidylserine D) cardiolipin E) ceramide
E) ceramide
Identify the molecule(s) derived from sterols. A) arachidonic acid B) gangliosides C) phosphatidylglycerol D) prostaglandins E) cortisol
E) cortisol
56. Glycoproteins A) are only found in bacteria. B) are extremely homogeneous. C) are typically less than 1% carbohydrate by weight. D) are assembled under strict genetic control. E) exhibit microheterogeneity.
E) exhibit microheterogeneity
Which step is NOT involved in neurotransmitter release at a synapse? A) creation of a fusion pore B) hemifusion induced by zipping and lateral tension on the bilayers C) v-SNARE binding to t-SNARE D) pore widening and release of neurotransmitter E) flippase-mediated movement of phosphatidylserine from the inner to the outer leaflet
E) flippase-mediated movement of phosphatidylserine from the inner to the outer leaflet
As the temperature for a membrane lipid preparation is raised, what would be the order of states that would be adopted? A) liquid-ordered, gel phase, liquid-disordered B) liquid-disordered, liquid-ordered, gel phase C) liquid-disordered, gel phase, liquid-ordered D) gel phase, liquid-disordered, liquid-ordered E) gel phase, liquid-ordered, liquid-disordered
E) gel phase, liquid-ordered, liquid-disordered
A good cloning vector should NOT have: A) an origin of replication. B) an antibiotic resistance gene. C) several unique restriction sites. D) a small size. E) genes allowing its insertion into the host chromosome.
E) genes allowing its insertion into the host chromosome.
26. Alcohols react with aldehydes to form A) hemiketals. B) lactones. C) lactams. D) glycosides. E) hemiacetals.
E) hemiacetals.
55. Which of the following is an example of a heteropolysaccharide? A) cellulose B) chitin C) starch D) glycogen E) hyaluronic acid
E) hyaluronic acid
Overproduction of which types of signaling lipids causes asthmatic attacks? A) prostaglandins B) thromboxanes C) arachidonates D) lipoxins E) leukotrienes
E) leukotrienes
Which way is NOT a means of inserting DNA into a cell? A) transformation B) transfection C) transduction D) electroporation E) ligation
E) ligation
44. Which of the following is a disaccharide? A) amylose B) saccharin C) aspartame D) amylopectin E) none of the above
E) none of the above
Which lipid compound is NOT at least partially made from the condensation of isoprene units? A) sterols B) limonene C) beta-carotene D) vitamin E E) phosphatidylinositol
E) phosphatidylinositol
A hydropathy plot is used to: A) determine the water-solubility of a protein. B) deduce the quaternary structure of a membrane protein. C) determine the water content of a native protein. D) extrapolate for the true molecular weight of a membrane protein. E) predict whether a given protein sequence contains membrane-spanning segments.
E) predict whether a given protein sequence contains membrane-spanning segments.
Bacterial cells change the fluidity of their lipid membranes to adapt to growth at lower temperatures by increasing the synthesis of: A) cholesterol. B) long-chain fatty acids and increasing the saturation of their membrane lipids. C) both long- and short-chain fatty acids. D) long-chain fatty acids and decreasing the saturation of their membrane lipids. E) short-chain fatty acids and decreasing the saturation of their membrane lipids.
E) short-chain fatty acids and decreasing the saturation of their membrane lipids.
The technique known as two hybrid analysis for detecting interacting gene products depend on: A) activation of DNA polymerase by the nearby binding of hybridizing protein complexes. B) direct binding of a Gal4p activation domain to a DNA sequence in the promoter region. C) having a promoter that responds directly to one of the two proteins whose interactions is being measured. D) hybridization of DNA segments corresponding to the two genes being examined. E) stimulation of transcription by interaction of two Gal4p domains via fused protein sequences.
E) stimulation of transcription by interaction of two Gal4p domains via fused protein sequences.
The technique known as two hybrid analysis for detecting interacting gene products depend on: A) activation of DNA polymerase by the nearby binding of hybridizing protein complexes. B) direct binding of a Gal4p activation domain to a DNA sequence in the promoter region. C) having a promoter that responds directly to one of the two proteins whose interactions is being measured. D) hybridization of DNA segments corresponding to the two genes being examined. E) stimulation of trasncription by interaction of two Gal4p domains via fused protein sequences
E) stimulation of trasncription by interaction of two Gal4p domains via fused protein sequences
43. Which of the following is the most abundant disaccharide? A) lactose B) cellulose C) α-amylose D) maltose E) sucrose
E) sucrose
Common features found in a cloning plasmid used for protein do NOT include: A) a polylinker. B) an origin of replication. C) an antibiotic resistance marker(s). D) a ribosome binding site. E) telomeric ends.
E) telomeric ends.
In the laboratory, recombinant plasmids are commonly introduced into bacterial cells by: A) electrophoresis - a gentle low-voltage gradient draws the DNA into the cell. B) infection with a bacteriophage that carries the plasmid. C) microinjection. D) mixing plasmids with an extract of broken cells. E) transformation - heat shock of the cells incubated with plasmid DNA in the presence of CaCl2.
E) transformation - heat shock of the cells incubated with plasmid DNA in the presence of CaCl2.
In the laboratory, recombinant plasmids are commonly introduced into bacterial cells by: A) electrophoresis—a gentle low-voltage gradient draws the DNA into the cell. B) infection with a bacteriophage that carries the plasmid. C) microinjection. D) mixing plasmids with an extract of broken cells. E) transformation—heat shock of the cells incubated with plasmid DNA in the presence of CaCl2.
E) transformation—heat shock of the cells incubated with plasmid DNA in the presence of CaCl2.
An electrogenic Na+ transporter: A) catalyzes facilitated diffusion of Na+ from a region of high Na+ concentration to one of lower Na+ concentration. B) must catalyze an electron transfer (oxidation-reduction) reaction simultaneously with Na+ transport. C) must transport both Na+ and a counterion (Cl-, for example). D) transports Na+ against its concentration gradient. E) transports Na+ without concurrent transport of any other charged species.
E) transports Na+ without concurrent transport of any other charged species.
Which compound is NOT a type of membrane lipid? A) sphingolipid B) glycerophospholipid C) sulfolipid D) sterol E) triacylglycerolipid
E) triacylglycerolipid
RFLP is a: A) bacteriophage vector for cloning DNA. B) genetic disease. C) plasmid vector for cloning DNA. D) protein. E) variation in DNA base sequence.
E) variation in DNA base sequence.
ABC transporters are NOT known to facilitate moving: A) cancer drugs out of cancer cells. B) antibiotics out of bacteria. C) membrane lipids from the inner leaflet to the outer leaflet. D) chloride ions in the lung. E) vitamin E into lipocytes.
E) vitamin E into lipocytes.
Which of the following pairs is interconverted in the process of mutarotation? A) D-glucose and D-fructose B) D-glucose and D-galactose C) D-glucose and D-glucosamine D) D-glucose and L-glucose E) α-D-glucose and β-D-glucose
E) α-D-glucose and β-D-glucose
Which of the following pairs is interconverted in the process of mutarotation? A) D-glucose and D-fructose B) D-glucose and D-galactose C) D-glucose and D-glucosamine D) D-glucose and L-glucose E) α-D-glucose and β-D-glucose
E) α-D-glucose and β-D-glucose
N-linked oligosaccharides can be covalently linked to proteins at which amino acid? A) Asp B) Ser C) Ala D) Tyr E) Asn
E- Asn = Asparagine
Glycoproteins A) are only found in bacteria. B) are extremely homogeneous. C) are typically less than 1% carbohydrate by weight. D) are assembled under strict genetic control. E) exhibit microheterogeneity.
E- Exhibit microheterogeneity- enzymatically generated
Uronic acids A) are aldoses where the aldehyde is oxidized to a carboxylic acid. B) are aldoses where the 1° alcohol is oxidized to a carboxylic acid. C) can be found in the pyranose or furanose forms. D) A and C are both correct. E) B and C are both correct.
E- are aldoses where the primary alcohol is oxidized to carboxylic acid & can be found in the pyranose, furanose or linear forms
What is an enantiomer of glucose? What is an epimer of glucose? What is a non-epimer diastereomer of glucose?
Enantiomers differ in configuration at all chiral centers, therefore, are non-superimposable images; ie. D-Glucose ad L-glucose Diastereomers differ in configuration at one or more, but not all, chiral centers; ie. D-mannose and D-galactose or D-glucose and D-altrose Epimers are a class of diastereomers that differ in their configuration at only one chiral center; ie. D-glucose and D-galactose or D-glucose and D-mannose All are optical isomers - rotate the plane of polarized light due to chiral centers - as opposed to cis/trans isomers
Explain why anomers of a monosaccharide can readily interconvert whereas epimers do not.
Epimers are stereoisomers which differ in configuration about any one carbon atom. Anomers are stereoisomers which differ in configuration about anomeric or glycosidic carbon. Monosaccharide show muta rotation due to equilibrium between open chain and different forms of closed chain. This occur about anomeric carbon . Hence we can say that anomers interconvert readily while epimers don't
31. Which reason is the MOST plausible for why most hexoses of living organisms are D isomers? A) D isomers are more energetically favorable. B) D isomers are also used by amino acids. C) Sugars must be opposite isomers from amino acids. D) Evolving enzymes were made to remain with an initial preference. E) Evolving enzymes switch preference often to find the best isomer.
Evolving enzymes were made to remain with an initial preference
Essential nutrients are those we cannot make ourselves. Humans can't make certain desaturations near the end of fatty acids, so we have to obtain them in our diet.
Explain what is meant by an essential fatty acid.
Facilitated diffusion through a biological membrane is: A) driven by a difference of solute concentration. B) driven by ATP. C) endergonic. D) generally irreversible. E) not specific with respect to the substrate
Facilitated diffusion through a biological membrane is: A) driven by a difference of solute concentration.
Which statement is TRUE about fatty acids?
Fatty acids with longer chains have higher melting points and lower solubility in water.
D) Sucrose
Following the action of Beano™, the remaining disaccharide is easily digested by almost all people. Glucose-α-1,2-β-fructose is also known as: A) Cellulose B) Starch C) Lactose D) Sucrose E) Xylitol
For the process of solute transport, the constant Kt is: A) analogous to Ka for ionization of a weak acid. B) analogous to Km for an enzyme-catalyzed reaction. C) analogous to Vmax for an enzyme reaction D) proportional to the number of molecules of glucose transporter per cell. E) the maximum rate of glucose transport.
For the process of solute transport, the constant Kt is: B) analogous to Km for an enzyme-catalyzed reaction.
From the abbreviated name of the compound Gal(beta1-->4)Glc, we know that: A) C-4 of glucose is joined to C-1 of galactose by a glycosidic bond. B) the compound is a D-enantiomer. C) the galactose residue is at the reducing end. D) the glucose is in its pyranose form. E) the glucose residue is the anomer.
From the abbreviated name of the compound Gal(beta1-->4)Glc, we know that: A) C-4 of glucose is joined to C-1 of galactose by a glycosidic bond.
2. Which of the following monosaccharides is NOT an aldose? A) erythrose B) Fructose C) glucose D) glyceraldehyde E) Ribose
Fructose
Why is fructose considered a reducing sugar?(Hint: It must first undergo a chemical conversion.)
Fructose is a ketose, which cannot be readily oxidized; that is, it does not act as a reducing agent in its unaltered form. Fructose must first undergo an isomerization to glucose, a reaction that is readily catalyzed by acidic or basic conditions.
Summarize the steps of signal transduction from a GCPR to phosphorylation or target proteins by PKA
G protein binded to GCPR tail (inactive) -> ligand binds to GCPR head -> GTP, GDP exhange -> alpha and beta subunits break apart -> alpha unit catalyzes AC beta catalyzes PLC-> cAMP formation from AC and ATP -> cAMP targets PKA
In DNA, the base pair ___ -___ is held together by three hydrogen bonds; the base pair ___ -___ has only two such bonds.
G-C; (&) A-T
How do the physical properties of glycosaminoglycans and similar molecules relate to their biological roles? Be able to draw the GAGs
GAGs have a slimy, muccus-like consistency that results from their high viscosity and elasticity. This works well with their biological roles as shock absorbers and lubricants (found in connective tissue, between joints, etc)
What are the roles of proteins such as Grb2, SOS, Ras, and various protein kinases involved in coupling activated RTK to downstream cellular targets such as transcription factors in the nucleus?
GRB2 exists in complex with SH2 domain and SOS exchange factor, GRB2 binds to activate RTK -> SOS binds to inner membrane RAS -> starts phosphorylation cascade
67. _____ could be used to determine human blood group type. A) Lipopolysaccharides B) Globoside C) Glycoproteins D) Lipoproteins E) Mucins
Globoside
10. Which monosaccharides is NOT a carboxylic acid? A) 6-phospho-gluconate B) gluconate C) Glucose D) glucuronate E) muramic acid
Glucose
Glucose transport into erythrocytes is an example of: A) active transport. B) antiport. C) electrogenic uniport D) facilitated diffusion. E) symport.
Glucose transport into erythrocytes is an example of: D) facilitated diffusion.
Show how aldoses and ketoses can form five- and six-membered rings.
Glucose, Mannose, and Galactose. Preferred because little-to-no ring strain.
12. Hemoglobin glycation is a process where _____ is _____ attached to hemoglobin. A) Glycerol- covalently B) Glucose- enzymatically C) Glucose- nonenzymatically D) N-acetyl-galactosamine- enzymatically E) Galactose- nonenzymatically
Glucose- nonenzymatically
The smallest aldose is
Glyceraldehyde
an example of homopolysaccharide in liver and muscle is ___
Glycogen
Which of the following statements about hydrogen bonding in glycogen and cellulose is true?
Glycogen primarily forms hydrogen bonds within a single chain.
68. _____ is the determination of the full component and function of sugar-containing molecules in a cell or tissue. A) Genomics B) Proteomics C) Glycomics D) Metabolomics E) Lipidomics
Glycomics
46. Which polysaccharide is NOT a homopolysaccharide? A) glycogen B) chitin C) amylose D) Glycosaminoglycan E) Dextran
Glycosaminoglycan
The following lipid is the core structure of many membrane lipids, and is the precursor to the ABO blood type antigens. A) Glycerophospholipid B) Triacylglycerol C) Phosphosphingolipid D) Glycosphingolipid E) Sterol
Glycosphingolipid
Why are gram-positive bacteria more susceptible to antibiotics such as penicillin?
Gram positive bacteria have a thicker cell wall, but gram negative bacteria have a thinner cell wall with a more complex outer membrane, which functions to exclude substances toxic to the bacterium such as antibiotice (and gram stain, this is why negative doesn't hold the stain)
6._____ introns are self-splicing (Ribozymes).
Group I and group II
Asked about cyclic conformation of an aldehyde such as mannose, would be -hemiacetal -hemiketal -replacement of aldehyde with carboxylic acid -oxidation of aldehyde
Hemiacetal
Hemoglobin glycation is a process where _______ is _______ attached to hemoglobin. A) glycerol; covalently B) glucose; enzymatically C) glucose; non-enzymatically D) N-acetyl-galactosamine; enzymatically E) galactose; non-enzymatically
Hemoglobin glycation is a process where _______ is _______ attached to hemoglobin. C) glucose; non-enzymatically
57. Which glycosaminoglycan is found in the synovial fluid of joints? A) chondroitin sulfate B) dermatan sulfate C) Hyaluronan D) keratin sulfate E) heparan sulfate
Hyaluronan
19. Which compound is a heteropolysaccharide? A) cellulose B) chitin C) glycogen D) Hyaluronate E) Starch
Hyaluronate
___ is a heteropolymer composed of D-glucoronate and N-acetly-D-glucosamine that acts as shock absorber and lubricant
Hyaluronic Acid
What are some of the biochemical effects of the oligosaccharide portions of glycoproteins?
Hydrophilic carbohydrates can alter the polarity and solubility of the proteins. Steric and charge interactions may influence the conformation of regions of the polypeptide and protect it from proteolysis.
The pitch of an alpha helix is 5.4 A per turn, and there are 3.6 amino acid residues per turn. If the thickness of the lipid bilayer is 30 A, how many amino acid residues are required in an alpha helix that is just long enough to span the lipid bilayer?
If the pitch is 5.4 A/turn and there are 3.6 residues per turn, then each residue lengthens the helix by 5.4/ 3.6 = 1.5 A/residue. Dividing 30 A by 1.5 A/residue gives a value of 20 residues necessary to span the lipid bilayer.
Hyaluronic Acid
Important glycoasaminoglycan component of synovial fluid B(1-->3) linked of D-glucuronate and N-acetyl-d-glucosamine(GlcNAc) Used as a biological shock absorber
This compound is L-glyceraldehyde. Draw a stereochemically correct representation of C-1 and C-2 of D-glucose. CHO | HO—C—H | CH2OH
In D-glucose, the positions of the —H and —OH on C-2 are the reverse of those for C-2 of L-glyceraldehyde. (Compare Fig. 7-1, p. 236, with Fig. 7-2, p. 236.)
Which of these statements about the composition of biological membranes is false?
In a given eukaryotic cell type (e.g., a hepatocyte), all intracellular membranes have essentially the same complement of lipids and proteins
15. Describe one biological advantage of storing glucose units in branched polymers (glycogen, amylopectin) rather than in linear polymers.
In effect, branched polymers increase the substrate concentration for these enzymes.
In glycoproteins, the carbohydrate moiety is always attached through the amino acid residues: A) asparagine, serine, or threonine. B) aspartate or glutamate. C) glutamine or arginine. D) glycine, alanine, or aspartate. E) tryptophan, aspartate, or cysteine.
In glycoproteins, the carbohydrate moiety is always attached through the amino acid residues: A) asparagine, serine, or threonine.
In one catalytic cycle, the Na+/K+ ATPase transporter transports: A) 2 Na+ out, 3 K+ in, and converts 1 ATP to ADP + Pi. B) 3 Na+ out, 2 K+ in, and converts 1 ATP to ADP + Pi. C) 3 Na+ in, 2 K+ out, and converts 1 ATP to ADP + Pi. D) 1 Na+ out, 1 K+ in, and converts 1 ATP to ADP + Pi. E) 2 Na+ out, 3 K+ in, and converts 1 ADP + Pi to ATP.
In one catalytic cycle, the Na+/K+ ATPase transporter transports: B) 3 Na+ out, 2 K+ in, and converts 1 ATP to ADP + Pi.
One critical function of chondroitin sulfate is to act as a lubricant in skeletal joints by creating a gel-like medium that is resilient to friction and shock. This function seems to be related to a distinctive property of chondroitin sulfate: the volume occupied by the molecule is much greater in solution than in the dehydrated solid. Why is the volume so much larger in solution?
In solution, the negative charges on chondroitin sulfate repel each other and force the molecule into an extended conformation. The polar molecule also attracts many water molecules (water of hydration), further increasing the molecular volume. In the dehydrated solid, each negative charge is counterbalanced by a counterion, such as Na+, and the molecule collapses into its condensed form.
If beeswax, cholesterol, and phosphatidylglycerol were dissolved in chloroform, then subjected to thin-layer chromatography on silica gel using a mixture of chloroform/methanol/water as the developing solvent, which would move fastest?
In this chromatography, the least polar compound (beeswax) moves fastest and the most polar (phosphatidylglycerol, which has a negative charge on its head group) moves the slowest.
Which of these is a general feature of the lipid bilayer in all biological membranes?
Individual lipid molecules are free to diffuse laterally in the surface of the bilayer.
_____ is NOT a biological use of waxes.
Insulation
Explain the differences between integral and peripheral membrane proteins.
Integral membrane proteins are very firmly associated with the membrane; their hydrophobic domains are associated with the fatty acyl groups in the interior in hydrophobic interactions. Peripheral membrane proteins are more loosely associated and usually do not penetrate the hydrophobic interior of the bilayer. Conditions that reduce ionic interactions and hydrogen bonds commonly release them.
Plasma membrane channels are classified as which of the following: Peripheral membrane proteins because they are not amphipathic Integral membrane proteins because they are not amphipathic Integral membrane proteins because they contain hydrophobic regions that can span the phospholipid bilayer Peripheral membrane proteins because they contain hydrophobic regions that can span the phospholipid bilayer
Integral membrane proteins because they contain hydrophobic regions that can span the phospholipid bilayer
Integrins are: A) membrane proteins that are involved in ion transport. B) membrane proteins that are involved in sugar transport. C) membrane proteins that mediate cell adhesion. D) proteins of the extracellular matrix that bind to cell surface proteins. E) proteins that are found at the membrane-cytoplasm interface.
Integrins are: C) membrane proteins that mediate cell adhesion.
54. Which statement is FALSE about the enzyme lysozyme? A) It is the active ingredient in penicillin. B) It is found in human tears. C) It is produced by some bacterial viruses. D) It hydrolyzes the (14) glycosidic bond of peptidoglycan. E) It causes osmotic lysis of bacterial cells.
It is the active ingredient in penicillin.
What is the difference between a D and L isomer
L- OH on left D- OH on right
The disaccharide commonly found in dairy products is ___
Lactose
Reducing Sugars
Lactose, Starch, glucose, ribose, starch
Describe the monosaccharide units and their linkages in the common disaccharides and polysaccharides
Lactose: (b1 -> b4) glycosidic linkage between galactose and glucose Sucrose: (a1 ->b2) glycosidic linkage between glucose and fructose Starch: mix of a-amylose [(a1 ->a4) glucose units] and amylopectin [(a1 ->a6] branched linkage to a-amylose every ~30 residues] Glycogen: more branched amylopectin primary structure, every ~10 units Cellulose: (b1 ->b4) glucose links Chitin: (b1 ->b4) N-acetlyglucosamine links
Be able to draw lactose and sucrose
Lactose: Galactose beta 1-4 glucose Sucrose: Glucose alpha 1-4 fructose
Proteins that bind to specific carbohydrates are called ______. A) pectins B) oligonucleotides C) glycosaminoglycans D) lectins E) chitins
Lectin
Oligosaccharide residues on cell surfaces provide recognition sites for a variety of functions, including cell-cell adhesion, movement of immune cells through capillary walls, viral attachment and infection of cells, and targeting of red blood cells and serum proteins for destruction. __________________ are the proteins involved in recognition of specific oligosaccharide structures. A) Antibodies B) Globins C) Proteoglycans D) Lectins E) Glycosylhydrolases
Lectins
Proteins that bind to specific carbohydrates are called ______.
Lectins
What are lectins? What are some biological processes which involve lectins?
Lectins are proteins that bind to specific oligosaccharides. They interact with specific cell-surface glycoproteins thus mediating cell-cell recognition and adhesion. Several microbial toxins and viral capsid proteins, which interact with cell surface receptors, are lectins.
What are the principle features of the fluid mosaic model of membranes?
Lipid bilayer integral membrane proteins peripheral membrane proteins
Which statement BEST describes why lipids typically float on water?
Lipids have lower specific gravities than water does.
23. Which compound(s) is/are a dominant feature of the outer membrane of the cell wall of gram-negative bacteria? A) amylose B) cellulose C) glycoproteins D) Lipopolysaccharides E) Lipoproteins
Lipopolysaccharides
plasma
Liquid portion of blood. Carries water, nutrients, and waste products through the body. Thickness determines how blood will behave when spattering.
What property of the waxy cuticles that cover plant leaves makes the cuticles impermeable to water?
Long, saturated acyl chains, nearly solid at air temperature, form a hydrophobic layer in which a polar compound such as H2O cannot dissolve or diffuse.
Which of the following is not a consequence of partial hydrogenation of vegetable oils?
Lower melting temperature
C) Primary active transport of H+
Lysosomes generate and maintain their pH gradients by using the activity of a proton-pumping V-type ATPase, which uses metabolic energy in the form of ATP to pump protons from the ~neutral cytosol to the highly acidic lysosome lumen. v-ATPases allow for: A) Simple diffusion of H+ B) Facilitated diffusion of H+ C) Primary active transport of H+ D) Secondary active transport of H+
be able to draw the common core of N-linked oligosaccharides
Man alpha 1-6 & man alpha 1-3, man beta 1-4, GlcNAc beta 1-4, GlcNAc
Membrane fusion leading to neurotransmitter release requires the action of: A) cadherins. B) selectins. C) flipases. D) tSNARE and vSNARE. E) none of the above.
Membrane fusion leading to neurotransmitter release requires the action of: D) tSNARE and vSNARE.
Membrane proteins: A) are sometimes covalently attached to lipid moieties. B) are sometimes covalently attached to carbohydrate moieties. C) are composed of the same 20 amino acids found in soluble proteins. D) diffuse laterally in the membrane unless they are anchored E) have all of the properties listed above.
Membrane proteins: E) have all of the properties listed above.
Explain why all mono- and disaccharides are soluble in water.
Monosaccharides and disaccharides are soluble in water because these compounds have many hydroxyl groups, each of which can hydrogen bond with water. (See chapter 4.)
A plant breeder has developed a new frost-resistant variety of tomato that contains higher levels of unsaturated fatty acids in membrane lipids than those found in standard tomato varieties. However, when temperatures climb above 95 °F, this frost-resistant variety dies, whereas the standard variety continues to grow. Provide a likely explanation of the biochemical basis of increased tolerance to cold and increased susceptibility to heat of this new tomato variety.
More unsaturated fatty acids will cause an increase in membrane fluidity because unsaturated fatty acids contain "kinks" and cannot pack as tightly as saturated fatty acids. At cold temperatures, the fluidity increase from the extra unsaturated fatty acids counterbalances the tendency of lipids to solidify at low temperature. At high temperatures, the fluidizing effects of the extra unsaturated fatty acids add to the fluidizing effect of higher temperature, and the membrane of the new plant loses its integrity.
Which statement is TRUE of lipids?
Most are simply polymers of isoprene.
What is the effect of a double bond on fatty acid structure?
Most double bonds in fatty acids are in the cis configuration. This results in a rigid bend in the hydrocarbon chain.
Movement of water across membranes is facilitated by proteins called: A) annexins. B) aquaporins. C) hydropermeases. D) selectins. E) transportins.
Movement of water across membranes is facilitated by proteins called: B) aquaporins.
O- only aka universal donor has no antigens
Mr. Jones's injuries are just as severe. He has lost a liter and half of blood on the scene. He also requires blood. His blood type screening revealed he is O- Which blood types he is able to accept
No, even if the antibody would be present it would not have Rh antigen
Mrs. Chase if A-, Mr. Chase is B+, and their first child is B+. If Mrs. Chase's second child was Rh negative, would it be at risk for (HDN)? Why?
Because anti-B is too large to travel through to child
Mrs. Chase if A-, Mr. Chase is B+, and their first child is B+. Why didn't Mrs. Chase's Anti-B antibodies attack the first child's B antigens?
She wasn't introduced to the Rh factor (can only be introduced via trauma like a placenta tear)
Mrs. Chase if A-, Mr. Chase is B+, and their first child is B+. Why wasn't her first child affected? Can you think of a situation where the first child would be affected?
Yes, because Rh antibody could have been shared from 1st child and would attack 2nd child's immune system
Mrs. Chase is pregnant for the second time. Her first child's birth was normal and uneventful and she has no significant medical history except for the fact she was out of the country during the birth of her first child. As part of her pre-natal exam, a blood screen was done on Mrs. Chase, her husband, and her first child. The results of the blood type screen show Mrs. Chase if A-, Mr. Chase is B+, and their first child is B+. If Mrs. Chase's second child was Rh positive, would it be at risk for hemolytic disease of the newborn (HDN)? Why?
All blood types aka universal recipient
Mrs. Jones, a 24-year-old female, and her husband, Mr. Jones, a 30-year-old male, were in a car accident. Mrs. Jones has lost about a liter of blood on the scene. She is taken into emergency surgery and requires blood. Her blood type screening revealed she is AB+ Which blood types she is able to accept.
No, no antigens to attack B+, B-, O+, O-
Ms. Brown is going to have total hip surgery in a week. You are called in to do a blood type examination. Her blood type was revealed to be type B+. The blood center calls you and tells you that they only have Rh-negative blood on hand. Would giving this person Rh-negative blood be a problem? Why? Which blood types can she receive?
65. _____ are secreted or membrane proteins that contain large numbers of O-linked oligosaccharide chains. A) Gangliosides B) Mucins C) Glycins D) Aminoglycans E) Immunoglobulins
Mucins
What is Mutarotation?
Mutarotation is the change in the optical rotation because of the change in the equilibrium between two anomers,
Explain the difference between N- and O-linked oligosaccharides.
N-linked are attached to asparagine, O-linked are attached to serine or threonine
78. Enzymatic hydrolysis of a purified polysaccharide with a glycosidase that cleaves specifically usually occurs before analysis by: A) NMR and mass spectrometry. B) ion-exchange chromatography. C) gel-filtration chromatography. D) lectin-affinity chromatography. E) gas-liquid chromatography.
NMR and mass spectrometry.
Explain why the systematic name of an oligosaccharide must include more than just the names of the component monosaccharides.
Naming of oligosaccharides proceeds from left to right (from the non-reducing end to the reducing end) as glycosyl [glycosyl]n glycoses or glycosyl [glycosyl]n glycosides, depending on whether or not the reducing end is a free hemiacetal group.[3] In parentheses, between the names of the monosaccharide residues, the number of the anomeric carbon atom, an arrow symbol, and the number of the carbon atom bearing the connecting oxygen of the next monosaccharide unit are listed.[3] Appropriate symbols are used to indicate the stereochemistry of the glycosidic bonds (α or β), the configuration of the monosaccharide residue (D orL), and the substitutions at oxygen atoms (O)
Describe the process by which "old" serum glycoproteins are removed from the mammalian circulatory system.
Newly synthesized serum glycoproteins bear oligosaccharide chains that end in sialic acid. With time, the sialic acid is removed. Glycoproteins that lack the terminal sialic acid are recognized by asialoglycoprotein receptors in the liver, internalized, and destroyed.
What are the similarities and differences between carriers, channels, and transporters involved in facilitated transport?
No energy required, entropically favored by electrochemical gradient, hydrophillic
What is the major difference between gated and non-gated ion channels? Give an example of two different gating signals.
Non-gated channels are always open; gated channels open in response to a signal. Two possible signals are the presence of a ligand or a change in membrane poential.
Cells that become infected by pathogens will present antigens on their surface. Antigens are proteins from pathogens the infected cell has degraded. This presentation occurs via a cell structure called the major histocompatibility complex (MHC). MHC is a transmembrane protein that presents the antigen to T-cells, telling the T-cell to kill the infected cell. What kinds of amino acids would you expect to find in the MHC molecule where it spans the cell membrane? Non-polar amino acids Polar amino acids Negatively charge amino acids positively charged amino acids
Non-polar amino acids
41. Which disaccharide does NOT have an anomeric carbon available for oxidation? A) Glc (a1<->1a) Glc B) Glc (a1<->2B) Fru C) Fru (B2<->1a) Glc D) both Glc (a1<->2B) Fru and Fru (b2<->1A) Glc E) None of the above
None of the above
D)both prostaglandins and thromboxanes
Nonsteroidal antiinflammatory drugs (NSAIDs) inhibit the synthesis of which signaling lipids from arachidonic acid? A) prostaglandins B) thromboxanes C)leukotrienes D)both prostaglandins and thromboxanes E) both thromboxanes and leukotrienes
27. Which statement is NOT a reason that it is difficult to study oligosaccharide composition from biological systems? A) Oligosaccharides are often branched. B) Oligosaccharides often have a high negative charge density. C) Oligosaccharides have a variety of linkages (e.g., 16 or 14). D) Oligosaccharides have too much conformational flexibility. E) There are no specific glycosidase enzymes that can be used to selectively digest oligosaccharides.
Oligosaccharides have too much conformational flexibility
How does osmosis differ from diffusion? Which process occurs during dialysis?
Osmosis is the diffusion of only water; in dialysis, both osmosis and the diffusion of solutes diffuse across a semipermeable membrane until solute concentration reaches equilibrium on both sides osmotic pressure = pressure needed to prevent influx of water (osmosis)
What are the three forms of passive transport?
POF = passive diffusion, osmosis, and filtration
Why is a hydropathy plot useful, and what are its limitations?
Peaks on a hydropathy plot indicate areas of high hydrophobicity, which may signal the presence of transmembrane helices or other integral membrane protein segments. However, because water soluble proteins have hydrophobic interiors, it is possible to get hydrophobic areas for proteins that are not membrane associated.
The main component of a bacterial cell wall is a ___
Peptidoglycan
Bacterial cell walls are composed of _____.
Peptidoglycans
Peripheral membrane proteins: A) are generally noncovalently bound to membrane lipids. B) are usually denatured when released from membranes. C) can be released from membranes only by treatment with detergent(s). D) may have functional units on both sides of the membrane. E) penetrate deeply into the lipid bilayer.
Peripheral membrane proteins: A) are generally noncovalently bound to membrane lipids.
Which statement is NOT true?
Phospholipase B1 hydrolyzes the fatty acid from the 2-position on the glycerol backbone.
Draw the structure of a biological membrane as proposed by the fluid mosaic model. Indicate the positions and orientations of phospholipids, cholesterol, integral and peripheral membrane proteins, and the carbohydrate moieties of glycoproteins and glycolipids.
Phospholipids and sterols are found in both faces of the lipid bilayer. Integral membrane proteins penetrate or span the lipid bilayer, but peripheral membrane proteins associate at the membrane surface with lipid head groups or integral membrane proteins. The carbohydrate moieties of glycolipids and glycoproteins are invariably on the outside face of the plasma membrane.
Which of the following best describes the composition of the plasma membrane of an animal cell? Cholesteryl esters, proteins, and a small but significant amount of triglycerides A lipid bilayer formed mainly from cholesterol with protein attached to both sides Phosphoprotein and cholesterol Phospholipids, sphingolipids, cholesterol, and protein, with some carbohydrate
Phospholipids, sphingolipids, cholesterol, and protein, with some carbohydrate
List the common membrane lipids found in cellular membrane?
Phospholipids,cholestrol,integral proteins,carbohydrates
The following is a ____________. Note R can be any acyl chain. A) Phosphoglycerolipid B) Glycolipid C) Phosphosphingolipid D) Steroid E) Ether Lipid
Phosphosphingolipid
_____ contain(s) an ether-linked alkyl group.
Platelet-activating factor
The manufacture of chocolates containing a liquid center is an interesting application of enzyme engineering. The flavored liquid center consists largely of an aqueous solution of sugars rich in fructose to provide sweetness. The technical dilemma is the following: the chocolate coating must be prepared by pouring hot melted chocolate over a solid (or almost solid) core, yet the final product must have a liquid, fructose-rich center. Suggest a way to solve this problem. (Hint: Sucrose is much less soluble than a mixture of glucose and fructose.)
Prepare the core as a semisolid slurry of sucrose and water. Add a small amount of sucrase (invertase), and quickly coat the semisolid mixture with chocolate. After the chocolate coat has cooled and hardened, the sucrase hydrolyzes enough of the sucrose to form a more liquid center: a mixture of fructose, glucose, and sucrose. .
Discuss differences between prokaryotes and eukaryotes
Prokaryotes: unicellular, smaller, lack nucleus and most membrane-bound organelles Eukaryotes: both unicellular and multicellular, larger, have nucleus and membrane-bound organelles; compartmentalization promotes efficiency
What is the function of cholesterol in the cell plasma membrane? Allow movement of charged particles through the membrane Provide ATP Promote membrane fluidity Transport molecules across the membrane
Promote membrane fluidity
2. __ : Nucleotides sequence in DNA to which RNA polymerase binds to begin transcription.
Promoter
Which statement does NOT describe a characteristic of the fluid mosaic model of membranes? A) Hydrophobic interactions predominate between lipids in the membrane. B) Proteins and lipids are able to move laterally at different rates. C) Protein structures are able to move from one leaflet to another. D) Noncovalent forces predominate in intermolecular interactions.
Protein structures are able to move from one leaflet to another.
Describe the general structures of proteoglycans, peptidoglycans, and glycosylated proteins.
Proteoglycans are large, glycosaminoglycan-containing proteins Peptidoglycans are a network of polysaccharide and polypeptide chains Glycosylated proteins may contain N-linked oligosaccharides or O-linked oligosaccharides or both.
8 7
RNA duplexes are considerably more stable than DNA duplexes of comparable sequence. Although the physical basis for this thermal stability is not understood, it means that even though the A=U base pairs of double-stranded RNA are weaker than the A=T base pairs of double-stranded DNA, the melting point of the RNA duplex will be higher than that of the DNA duplex.
4. ___ : Process in which introns are removed from pre-mRNA.
RNA splicing
Summarize the various members of the RTK family, their ligands, and functions
RTK -> Ligands -> Principal Fxn 1) IR -> insulin, insulin-like growth factors (IGFs) -> glucose homeostasis 2) EGFR (ErbB1/HER1) -> emidermal growth factor (EGF) -> cell growth and poliferation 2) PDGFR -> platelet-derived growth factor -> cell growth and differentiation 3) FGFR -> fibroblast growth factor -> cell growth and development 4) VEGFR -> Vascular endothelial growth factor (VEGF) -> vasculature development 5) HGFR (Met) -> Hepatocyte growth factor -> embryonic development 6)NGFR (TrkA) -> nerve growth factor -> neuronal development 7)EphR (Ephs) -> ephrin -> cell adhesion and migration
What is a reducing end?
Reducing end is the part of the disaccharide in which one of the monosaccharides has a free anomeric carbon not involved in the glycosidic bond which is free to open up the ring.
32. Which monosaccharide is NOT a six-carbon monosaccharide? A) fructose B) Ribose C) mannose D) glucose E) Galactose
Ribose
Describe the structure & stereochemistry of saturated and unsaturated fatty acids
Saturated: conformational flexibility due to free rotation about each C-C bond, but pack close together Unsaturated: kinks in chain at double bonds make looser packing; can adopt 2^n cis/trans stereoisomers where n is the # of double bonds
anti-A test serum
Serum used to test blood samples. If the sample contains A antigens, it will clot.
anti-B test serum
Serum used to test blood samples. If the sample contains B antigens, it will clot.
anti-Rh test serum
Serum used to test blood samples. If the sample is Rh+, it will clot.
Which statement about membrane lipids is TRUE?
Some sphingolipids include oligosaccharides in their structure.
9. ____ facilitate hybridization with electrophoretically separated DNA molecules to identify a DNA fragment.
Southern blotting
7. Most of mRNA Introns are removed via a large protein-RNA complex called a ____
Spliceosome
Starch and glycogen are both polymers of: A) fructose. B) glucose1-phosphate. C) sucrose. D) alpha-D-glucose. E) beta-D-glucose.
Starch and glycogen are both polymers of: D) alpha-D-glucose.
Compare and contrast the structures and functions of cellulose, chitin, starch, and glycogen
Starch: composed of linear and branched polymers, principal fuel storage/ energy reservoir of plants deposited in the chloroplasts Glycogen: more highly branched, principal fuel storage/energy reservoir in animals deposited in the liver produced via glycogenesis Cellulose: linear biopolymer; structural component of plant cell walls and secreted as biofilm by bacteria Chitin: linear biopolymer; structural component of exoskeletons in invertebrates (crustaceans and insects), also prominent in fungi and algae cell walls
Which one of the following statements about membranes is true?
Sterol lipids are common in human cell plasma membranes.
Which statement is NOT true of sterols?
Sterols are commonly found in bacterial membranes.
9. Which compound is NOT a reducing sugar? A) fructose B) glucose C) glyceraldehyde D) ribose E) Sucrose
Sucrose
Following the action of Beano™, the remaining disaccharide is easily digested by almost all people. Glucose-α-1,2-β-fructose is also known as: A) Cellulose B) Starch C) Lactose D) Sucrose E) Xylitol
Sucrose
Compare and contrast symport and antiport. Which term best describes the transport system mediated by the Na+K+ ATPase?
Symport and antiport are both types of cotransport systems in which two solutes move through the membrane simultaneously. In symport, both move in the same direction; in antiport, one solute goes in one direction, the other in the opposite direction. The Na+K+ ATPase of the plasma membrane is an antiport system. It moves K+ in and Na+ out in a ratio of 2 K+ per 3 Na+. Neither of the two ions can be transported unless the other is present, which is characteristic of cotransport systems.
What are the three main classes of facilitated transport?
TCC = transporters, carriers, and channels facilitated transport = facilitated diffusion = passive-mediated transport
How do biochemists define the standard state of a solution?
Temperature = 25 degrees Celsius Pressure = 1atm pH = 7.0
Smith and Wilcox found that sample A had 136 counts/min of 32P; sample B had 3,740 counts/min. Did the nuclease cleavage leave the phosphate on the 5′ or the 3′ end of the DNA fragments? Explain your reasoning.
The 5′ end. If the phosphate were left on the 3′ end, the kinase would incorporate significant 32P as it added phosphate to the 5′ end; treatment with the phosphatase would have no effect on this. In this case, samples A and B would incorporate significant amounts of 32P. When the phosphate is left on the 5′ end, the kinase does not incorporate any 32P: it cannot add a phosphate if one is already present. Treatment with the phosphatase removes 5′ phosphate, and the kinase then incorporates significant amounts of 32P. Sample A will have little or no 32P, and B will show substantial 32P incorporation—as was observed.
fluid mosaic model
The ______ (3 words) describes biological membranes as two-dimensional fluids in which transmembrane proteins and lipids can laterally diffuse.
Why can sugar form at least two different glycosides?
The anomeric C atom undergo condensation with either the OH group from another alcohol to form an O-glycosidic bond or with an NH or NH2 group from an amine to form an N-glycosidic bond
Why can anomers of monosaccharides readily interconvert whereas epimers do not?
The anomers freely interconvert at thermodynamic equilibrium
The basic structure of a proteoglycan consists of a core protein and a: A) glycolipid. B) glycosaminoglycan. C) lectin. D) lipopolysaccharide. E) peptidoglycan.
The basic structure of a proteoglycan consists of a core protein and a: B) glycosaminoglycan.
The biochemical property of lectins that is the basis for most of their biological effects is their ability to bind to: A) amphipathic molecules. B) hydrophobic molecules. C) specific lipids. D) specific oligosaccharides. E) specific peptides.
The biochemical property of lectins that is the basis for most of their biological effects is their ability to bind to: D) specific oligosaccharides.
Advantages to using triacylglycerols, rather than polysaccharaides, to store energy include which reason(s)?
The carbon atoms of triacylglycerols are more reduced, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them.
Advantages to using triacylglycerols, rather than polysaccharides, to store energy include which reason(s)? A) The carbon atoms of triacylglycerols are more oxidized. B) Triacylglycerols contain more oxygen than polysaccharides and therefore are more efficient to oxidize. C) Since triacylglycerols are hydrophillic, excess water does not need to be stored along with them. D) The carbon atoms of triacylglycerols are more reduced, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them. E) Triacylglycerols contain more oxygen than polysaccharides and therefore are more efficient to oxidize, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them.
The carbon atoms of triacylglycerols are more reduced, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them.
Which of the following statements conflicts with the fluid mosaic model? The cell membrane is static in structure. Membrane components can be derived from multiple biomolecules. Hydrophobic interactions stabilize the lipid bilayer. Proteins are asymmetrically distributed within the cell membrane.
The cell membrane is static in structure.
If the hydrophobic interior of a membrane were about 3 nm thick, what would be the minimum number of amino acids in a stretch of transmembrane alpha helix?
The dimensions of an alpha helix are about 5.4 Å/turn, and there are 3.6 residues/turn, so each residue extends the helix by about 1.5 Å or 0.15 nm. To span 3 nm of lipid bilayer will therefore require a minimum of 20 residues.
Why do polar substances dissolve in water while nonpolar substances do not?
The dipolar character of polar solvents (water) enables it to weaken attractive forces between polar ions by surrounding each ion to neutralize its charge - hydration/solvation The hydrophobic effect causes nonpolar substances to aggregate in polar solvents (water) to cause the least disruption of water's extensive network
Explain why the absorption of UV light by double-stranded DNA increases (the hyperchromic effect) when the DNA is denatured.
The double-helical structure is stabilized by hydrogen bonding between complementary bases on opposite strands and by base stacking between adjacent bases on the same strand. Base stacking in nucleic acids causes a decrease in the absorption of UV light (relative to the non-stacked structure). On denaturation of DNA, the base stacking is lost and UV absorption increases.
Describe one biological advantage of storing glucose units in branched polymers (glycogen, amylopectin) rather than in linear polymers.
The enzymes that act on these polymers to mobilize glucose for metabolism act only on their nonreducing ends. With extensive branching, there are more such ends for enzymatic attack than would be present in the same quantity of glucose stored in a linear polymer. In effect, branched polymers increase the substrate concentration for these enzymes.
What is the role of entropy in the hydrophobic effect?
The exclusion of nonpolar groups from polar surroundings so as to maximize the entropy of water molecules by minimizing nonpolar surface area to increase water's degree of freedom/movement is the basis of the hydrophobic effect
The fluidity of a lipid bilayer will be increased by: F) decreasing the number of unsaturated fatty acids. C) decreasing the temperature. G) increasing the length of the alkyl chains. D) increasing the temperature. E) substituting 18:0 (stearic acid) in place of 18:2 (linoleic acid).
The fluidity of a lipid bilayer will be increased by: D) increasing the temperature.
The fluidity of the lipid side chains in the interior of a bilayer is generally increased by: A) a decrease in temperature. B) an increase in fatty acyl chain length. C) an increase in the number of double bonds in fatty acids. D) an increase in the percentage of phosphatidyl ethanolamine E) the binding of water to the fatty acyl side chains.
The fluidity of the lipid side chains in the interior of a bilayer is generally increased by: C) an increase in the number of double bonds in fatty acids.
5. Briefly describe the role of recombination in the generation of antibody (immunoglobin) diversity.
The genes for immunoglobin polypeptide chains are divided into segments, with multiple versions of each segment (V, J, C in Kappa chain: which code for slightly different amino 6 acid sequences). Recombination results in the joining of individual versions of each segment to generate a complete gene. Antibody diversity results from the very large number of different combinations that are possible.
Which ends of a water molecule bare a partial positive and a partial negative charge? What is its van der Waals radius, and what is it's significance?
The hydrogen ends bare the partial positive charge while the lone pairs of the oxygen end bare the partial negative charge. The van der Waals radius is 1.4A; two water molecules cannot get closer to each other than 2r
The inner (plasma) membrane of E. coli is about 75% lipid and 25% protein by weight. How many molecules of membrane lipid are there for each molecule of protein? (Assume that the average protein is Mr 50,000 and the average lipid is 750.) A) 1 B) 50 C) 200 D) 10,000 E) 50,000
The inner (plasma) membrane of E. coli is about 75% lipid and 25% protein by weight. How many molecules of membrane lipid are there for each molecule of protein? (Assume that the average protein is Mr 50,000 and the average lipid is 750.) C) 200
Which of these statements about the composition of membranes is true?
The inner and outer membranes of mitochondria have different protein compositions.
Which of these statements about the composition of membranes is true? All biological membranes contain cholesterol. Free fatty acids are major components of all membranes. The inner and outer membranes of mitochondria have different protein compositions. The lipid composition of all membranes of eukaryotic cells is essentially the same.
The inner and outer membranes of mitochondria have different protein compositions.
Which statement BEST describes how the volatility of lipids is increased for analysis by gas chromatography?
The lipids are transesterified to convert fatty acids into fatty acid methyl esters.
How do oligosaccharides participate in biological recognition?
The many possible ways that carbohydrates can be linked together to form branched structures gives them the potential to carry more biological information than either nucleic acids or proteins of similar size
Explain how it is possible that a polysaccharide molecule, such as glycogen, may have only one reducing end, and yet have many nonreducing ends.
The molecule is branched, with each branch ending in a nonreducing end. (See Fig. 7-14c, p. 5.)
Why must the systematic name of an oligosaccharide include more than just the component monosaccharides?
The name must include the location and stereochemistry of the links because that can distinguish different polymers made up of the same units, ie. starch and cellulose
Describe briefly what is meant by saying that two DNA strands are complementary.
The nucleotide sequences of complementary strands are such that, wherever an A occurs in one strand, there is a T in the other strand with which it can form a hydrogen-bonded base pair. Wherever a C occurs in one strand, a G occurs in the other. A is the base complementary to T, and C is the base complementary to G.
Which one of the following is true of the pentoses found in nucleic acids?
The pentoses are always in the β-furanose forms.
What is the biological advantage to an organism that stores its carbohydrate reserves as starch or glycogen rather than as an equivalent amount of free glucose?
The polymers are essentially insoluble and contribute little to the osmolarity of the cell, thereby avoiding the influx of water that would occur with the glucose in solution. They also make the uptake of glucose energetically more feasible than it would be with free glucose in the cell.
What are the principle features of the fluid mosaic model of membranes?
The principle features of the fluid mosaic model of membranes include: (1) a lipid bilayer in which individual lipids are free to move laterally but not across the bilayer; (2) integral membrane proteins, which penetrate or span the bilayer, associating with lipid acyl chains by hydrophobic interactions and exhibiting lateral mobility; (3) peripheral membrane proteins, which associate noncovalently with the lipid head groups and protruding domains of integral membrane proteins, and which are sometimes tethered to the membrane by a covalent lipid anchor.
How can you predict whether it will be thermodynamically favorable for an apolar substance to move from one side of a membrane to the other?
The rate of diffusion of a a substance is directly proportional to the concentration difference across the membrane and its solubility in the apolar lipid core.
The plasma membrane of an animal cell consists of 45% by weight of phospholipid and 55% protein. What is the mole ratio (moles of lipid/moles of protein) if the average molecular weight of phospholipids is 750 and the average molecular weight of membrane proteins is 50,000?
The ratio of moles lipid/moles protein is about 55. In 100 g of membrane, there are 45 g/750 g·mol-1 = 0.06 mol phospholipid, and 55 g/50,000 g·mol-1 = 1.1 10-3 mol protein. So lipid/protein = 0.06/0.0011 = 55.
The reference compound for naming D and L isomers of sugars is: A) fructose. B) glucose. C) glyceraldehyde. D) ribose. E) sucrose.
The reference compound for naming D and L isomers of sugars is: C) glyceraldehyde.
Explain in molecular terms why humans cannot use cellulose as a nutrient, but goats and cattle can.
The ruminant animals have in their rumens microorganisms that produce the enzyme cellulase, which splits the (beta1 --> 4) linkages in cellulose, releasing glucose. Humans do not produce an enzyme with this activity; the human digestive enzyme alpha-amylase can split only (alpha1 --> 4) linkages (such as those in glycogen and starch).
The shortest alpha helix segment in a protein that will span a membrane bilayer has about _____ amino acid residues. A) 5 B) 20 C) 50 D) 100 E) 200
The shortest alpha helix segment in a protein that will span a membrane bilayer has about _____ amino acid residues. B) 20
The specificity of the potassium channel for K+ over Na+ is mainly the result of the: A) differential interaction with the selectivity filter protein. B) hydrophobicity of the channel. C) phospholipid composition of the channel. D) presence of carbohydrates in the channel. E) presence of cholesterol in the channel.
The specificity of the potassium channel for K+ over Na+ is mainly the result of the: A) differential interaction with the selectivity filter protein.
What is the relationship between the strength of an acid and its pKa value?
The strength of an acid is expressed in terms of quantity by pKa, which is analogous to pH pKa = -logKa [H+] = Ka[HA]/[A-] pH = pKa + log[A-]/[HA] (only for weak acids and bases) pH = pKa @ 50% dissociation, when [HA] = [A-]
6. The DNA below is transcribed from right to left. Label the template and cording strands and write the sequence of the RNA synthesized. (4%) (5')ACTTCGGATCGTTAAGGCCGCTTTCTGT(3') (3')TGAAGCCTAGCAATTCCGGCGAAAGACA(5')
The top one is the template 5' ACAGAAAGCGGCCUUAACGAUCCGAAGU3'
A) Epimers
The top two units (D-Galactose and D-Glucose) differ only in the orientation of the hydroxyl at C-4. We call such sugars: A) Epimers B) Anomers C) Hemiketoses D) Furanoses E) Pentoses
B) Facilitated diffusion
The transport in question 17 is an example of: A) Simple diffusion B) Facilitated diffusion C) Primary active transport D) Secondary active transport
Describe the differences between the glycosphingolipids corresponding to the A, B, and O human blood group antigens.
The type O structure is found in all three glycosphingolipids. In both type A and type B, there is an added sugar; this sugar differs between type A and B.
The type of membrane transport that uses ion gradients as the energy source is: A) facilitated diffusion B) passive transport. C) primary active transport. D) secondary active transport. E) simple diffusion.
The type of membrane transport that uses ion gradients as the energy source is: D) secondary active transport.
The type of motion least common in biological membranes is: A) flip-flop diffusion of phospholipid from one monolayer to the other. B) lateral diffusion of individual lipid molecules within the plane of each monolayer. C) lateral diffusion of membrane proteins in the bilayer. D) lateral diffusion of protein molecules in the lipid bilayer E) random motion of the fatty acyl side chains in the interior of the phospholipid bilayer.
The type of motion least common in biological membranes is: A) flip-flop diffusion of phospholipid from one monolayer to the other.
According to the current model for HIV infection, which of the following is not involved in the process of membrane fusion?
The viral chromosome
Which feature allows certain lipid molecules to be used as colorful pigments in plants and animals?
Their conjugated bond structures allow absorption of visible light.
Summarize the structures and physical properties of fatty acids, triglycerides, phospholipids, sphingolipids, and steroids
These are the 5 major classes of lipids: PFaSST Fatty Acids: carboxylic acids with long aliphatic (chain not ring) tail, saturated and unsaturated; naturally occurring have even # of C atoms Triglycerides/Triglycerols: fatty acid esterfied derivatives of glycerol; 3 tails Phospholipids: fatty acid derivatives of phosphoglycerol with only 2 esterfied fatty acid chains; highly amphiphilic due to phosphate group Sphingolipids: ceramides are fatty acid (1 chain) amides of shpingosine (an amino alcohol) with the fatty acid on the NH3 group, sphingolipids is when one of the OH groups is esterfied to a variable X functional group: P.S. phosphocholine/ethanolamine -> sphyingomyelins O.G. oligosaccharide -> gangliosides M.C. monosaccharide -> cerebrosides Stereolipids: derivatives of sterane comprised of four non-planar rings A-D fused together
58. Which commonality does NOT exist between peptides, nucleic acids, and poly- and oligosaccharides? A) They are all synthesized from a template. B) They are all information-carrying molecules. C) They are all created from multiple building blocks. D) The sequence of monomers is important for function. E) All of the answer choices are commonalities between peptides, nucleic acids, and poly- and oligosaccharides.
They are all synthesized from a template
Explain why all mono- and disaccharides are soluble in water.
They have many hydroxyl groups which Hydrogens can bond with water
A protein is found to extend all the way through the membrane of a cell. Describe this protein in terms of the location of particular types of amino acid side chains in its structure and its ability to move within the membrane.
This integral membrane protein associates with the lipid bilayer through hydrophobic interactions between domains containing many hydrophobic amino acids and the fatty acyl chains of membrane lipids. Polar and charged residues are located on portions of the protein that protrude out of either face of the membrane. The protein is free to diffuse laterally in the plane of the membrane, but cannot move across the lipid bilayer.
8 2
This sequence has a palindrome, an inverted repeat with twofold symmetry: (5′)GCGCAATATTTCTCAAAATATTGCGC(3′) (3′)CGCGTTATAAAGAGTTTTATAACGCG(5′) Because this sequence is self-complementary, the individual strands have the potential to form hairpin structures. The two strands together may also form a cruciform.
platelets
Tiny, disk-shaped bodies in the blood, important in blood clot formation. Makes blood thick and viscous so it resists breaking apart when projected.
Describe two ways a plant can adjust the components of its cell membranes to keep them as fluid as possible on a cold winter morning.
To compensate for the solidifying effect of low temperature on membrane lipids, it can synthesize and place in the membrane (1) a greater proportion of unsaturated fatty acids and (2) shorter-chain fatty acids. Both increase the fluidity of the lipid bilayer.
Which bond(s) in α-D-glucose must be broken to change its configuration to β-D-glucose? Which bond(s) to convert D-glucose to D-mannose? Which bond(s) to convert one "chair" form of D-glucose to the other?
To convert α-D-glucose to β-D-glucose, the bond between C-1 and the hydroxyl on C-5 must be broken and reformed in the opposite configuration. To convert D-glucose to D-mannose, either the —H or the —OH on C-2 must be broken and reformed in the opposite configuration. Conversion between chair conformations does not require bond breakage; this is the critical distinction between configuration and conformation.
To possess optical activity, a compound must be: A) a carbohydrate. B) a hexose. C) asymmetric. D) colored. E) D-glucose.
To possess optical activity, a compound must be: C) asymmetric.
Why do amphiphiles form highly ordered micelles or bilayers in water?
To shield their hydrophibic groups while exposing their hydrophillic groups, driven by the hydrophobic effect
1. __ : Helps to position the RNA polymerase correctly at the promoter, to aid in separate the two DNA strands, and to release RNA polymerase from the promoter.
Transcription factors
11 20
Treat a suspension of the bacteria as follows: Add lactose at a concentration well above the Kt, so that virtually every molecule of galactoside transporter binds lactose. Next, add nonradiolabeled NEM and allow it to react with all available —SH groups on the cell surface. Remove excess lactose by centrifuging and resuspending the cells, then add radiolabeled NEM. The only Cys residues now available to react with NEM are those in the transporter protein. Dissolve the membrane proteins in sodium dodecylsulfate (SDS), and separate them on the basis of size by SDS gel electrophoresis. The Mr of the labeled band should represent that of the galactoside transporter.
Which are not amphipathic molecules, and therefore do not participate in lipid bilayers? A) Triacylglycerol B) Sphingolipid C) Glycerophospholipid D) Sterols E) Glycolipids
Triacylglycerol
Which compound is NOT found in membranes? A) Triacylglycerol B) Sphingolipid C) Glycerophospholipid D) Sterol E) polypeptides
Triacylglycerol
What is the most significant chemical difference between triacylglycerols and glycerophospholipids that leads to their different functions?
Triacylglycerols are nonpolar hydrophobic molecules that can be stored in specialized nonaqueous cellular compartments. Glycerophospholipids are amphipathic molecules that can serve as structural components of membranes, which have hydrophilic and hydrophobic regions.
Describe three functions of triacylglycerols in mammals and one function in higher plants.
Triacylglycerols provide mammals with (1) stored fuel, (2) insulation, and (3) a source of metabolic water. In some animals, such as camels and desert rats, the oxidation of stored lipids provides water; in hibernating animals, oxidation of stored lipids generates heat to maintain body temperature . In plants, oxidation of the triacylglycerols stored in seeds provides the energy and precursors for biosynthetic processes during germination, before photosynthetic mechanisms become functional.
What is the column buffer?
Tris-HCl, pH 7.5
How does a receptor tyrosine kinase phosphorylate itself?
Upon ligand binding, the receptors dimerize or undergo a conformation change to bring their TK (tyrosine kinase) domain close enough together to phosphorylate each other
The glycosaminoglycans are negatively charged at neutral pH. What components of these polymers confer the negative charge?
Uronic acids such as glucuronic acid, and sulfated hydroxyl groups, such as GalNAc4SO3- and GlcNAc6SO3-. (See Fig. 7-22, p. 250.)
The number of structurally different polysaccharides that can be made with 20 different monosaccharides is far greater than the number of different polypeptides that can be made with 20 different amino acids if both polymers contain an equal number (say 100) of total residues. Explain why.
Virtually all peptides are linear.. limited in variability by the different number of subunits. The number of different ways to arrange 20 different sugars in a branched oligosaccharide is much larger than the number of different ways a peptide could be made with an equal number of residues.
Compare the structures of ice and water with respect to the number and geometry of hydrogen bonds
Water is sp3 hybridized with a tetrahedral geometry. The supreme attractive force of hydrogen bonding renders water a liquid at room temperature. Structure of ice: each molecule interacts tetrahedrally with four other neighboring molecules; H-bonds are highly stable/static; water expands on freezing due to this regular "open" network of hydrogen boding, lowering the density of ice Structure of water: each molecule engages in rings of 3-mer, 4-mer, or 5-mer molecules; H-bonds are highly unstable/dynamic; this rather "loose" network of hydrogen bonding allows the molecules to pack more tightly together, raising the density of the liquid
the carbonyl carbon
What carbon becomes the anomeric carbon?
When a bacterium such as E. coli is shifted from a warmer growth temperature to a cooler growth temperature, it compensates by: A) increasing its metabolic rate to generate more heat. B) putting longer-chain fatty acids into its membranes. C) putting more unsaturated fatty acids into its membranes. D) shifting from aerobic to anaerobic metabolism. E) synthesizing thicker membranes to insulate the cell.
When a bacterium such as E. coli is shifted from a warmer growth temperature to a cooler growth temperature, it compensates by: . C) putting more unsaturated fatty acids into its membranes.
Explain why sucrose is not a reducing sugar, even though both glucose and fructose are.
When the carbonyl carbons are involved in glycosidic linkages, they are no longer accessible to oxidizing agents. In sucrose (Glc(α1 → 2)Fru), both oxidizable carbons are involved in the glycosidic linkage.
When the linear form of glucose cyclizes, the product is a(n): A) anhydride. B) glycoside. C) hemiacetal. D) lactone. E) oligosaccharide.
When the linear form of glucose cyclizes, the product is a(n): C) hemiacetal.
When two carbohydrates are epimers: A) one is a pyranose, the other a furanose. B) one is an aldose, the other a ketose. C) they differ in length by one carbon. D) they differ only in the configuration around one carbon atom. E) they rotate plane-polarized light in the same direction.
When two carbohydrates are epimers: D) they differ only in the configuration around one carbon atom.
A) Triacylglycerol
Which are not amphipathic molecules, and therefore do not participate in lipid bilayers? A) Triacylglycerol B) Sphingolipid C) Glycerophospholipid D) Sterols E) Glycolipids
B) glycerol
Which molecule is MOST commonly used as a backbone the linkage of three fatty acids to form fats? A) glycogen B) glycerol C) sphingosine D) glucose E) phosphoglycerol
Which of following is an anomeric pair? A) D-glucose and D-fructose B) D-glucose and L-fructose C) D-glucose and L-glucose D) alpha-D-glucose and beta-D-glucose E) alpha-D-glucose and beta-L-glucose
Which of following is an anomeric pair? D) alpha-D-glucose and beta-D-glucose
Which of the following is an epimeric pair? A) D-glucose and D-glucosamine B) D-glucose and D-mannose C) D-glucose and L-glucose D) D-lactose and D-sucrose E) L-mannose and L-fructose
Which of the following is an epimeric pair? B) D-glucose and D-mannose
Which of the following monosaccharides is not a carboxylic acid? A) 6-phospho-gluconate B) gluconate C) glucose D) glucuronate E) muramic acid
Which of the following monosaccharides is not a carboxylic acid? C) glucose
Which of the following monosaccharides is not an aldose? A) erythrose B) fructose C) glucose D) glyceraldehyde E) ribose
Which of the following monosaccharides is not an aldose? B) fructose
Which of the following pairs is interconverted in the process of mutarotation? A) D-glucose and D-fructose B) D-glucose and D-galactose C) D-glucose and D-glucosamine D) D-glucose and L-glucose E) alpha-D-glucose and beta-D-glucose
Which of the following pairs is interconverted in the process of mutarotation? E) alpha-D-glucose and beta-D-glucose (Mutarotation is the porcess in which one ring form (say the alpha anomer) opens biefly into the linear form, then closes again to produce the beta anomer.)
Which of the following statements about starch and glycogen is false? A) Amylose is unbranched; amylopectin and glycogen contain many (alpha1-->6) branches. B) Both are homopolymers of glucose. C) Both serve primarily as structural elements in cell walls. D) Both starch and glycogen are stored intracellularly as insoluble granules. E) Glycogen is more extensively branched than starch.
Which of the following statements about starch and glycogen is false? C) Both serve primarily as structural elements in cell walls. (Starch and glycogen are storage molecules! Hence the granules and the toughness of chitin and cellulose!)
Which of these is a general feature of the lipid bilayer in all biological membranes? A) Individual lipid molecules are free to diffuse laterally in the surface of the bilayer. B) Individual lipid molecules in one face (monolayer) of the bilayer readily diffuse (flip-flop) to the other monolayer. C) Polar, but uncharged, compounds readily diffuse across the bilayer. D) The bilayer is stabilized by covalent bonds between neighboring phospholipid molecules. E) The polar head groups face inward toward the inside of the bilayer.
Which of these is a general feature of the lipid bilayer in all biological membranes? A) Individual lipid molecules are free to diffuse laterally in the surface of the bilayer.
Which of these statements about facilitated diffusion across a membrane is true? A) A specific membrane protein lowers the activation energy for movement of the solute through the membrane. B) It can increase the size of a transmembrane concentration gradient of the diffusing solute. C) It is impeded by the solubility of the transported solute in the nonpolar interior of the lipid bilayer. D) It is responsible for the transport of gases such as O2, N2, and CH4 across biological membranes. E) The rate is not saturable by the transported substrate
Which of these statements about facilitated diffusion across a membrane is true? A) A specific membrane protein lowers the activation energy for movement of the solute through the membrane.
Which of these statements about the composition of biological membranes is false? A) In a given eukaryotic cell type (e.g., a hepatocyte), all intracellular membranes have essentially the same complement of lipids and proteins. B) The carbohydrate found in membranes is virtually all part of either glycolipids or glycoproteins. C) The plasma membranes of the cells of vertebrate animals contain more cholesterol than the mitochondrial membranes. D) The ratio of lipid to protein varies widely among cell types in a single organism. E) Triacylglycerols are not commonly found in membranes
Which of these statements about the composition of biological membranes is false? A) In a given eukaryotic cell type (e.g., a hepatocyte), all intracellular membranes have essentially the same complement of lipids and proteins.
Which of these statements about the composition of membranes is true? A) All biological membranes contain cholesterol. B) Free fatty acids are major components of all membranes. C) The inner and outer membranes of mitochondria have different protein compositions. D) The lipid composition of all membranes of eukaryotic cells is essentially the same. E) The lipid:protein ratio varies from about 1:4 to 4:1
Which of these statements about the composition of membranes is true? C) The inner and outer membranes of mitochondria have different protein compositions.
Which of these statements is generally true of integral membrane proteins? A) A hydropathy plot reveals one or more regions with a high hydropathy index. B) The domains that protrude on the cytoplasmic face of the plasma membrane nearly always have covalently attached oligosaccharides. C) They are unusually susceptible to degradation by trypsin. D) They can be removed from the membrane with high salt or mild denaturing agents. E) They undergo constant rotational motion that moves a given domain from the outer face of a membrane to the inner face and then back to the outer.
Which of these statements is generally true of integral membrane proteins? A) A hydropathy plot reveals one or more regions with a high hydropathy index.
Which one of the following statements about membranes is true? A) Most plasma membranes contain more than 70% proteins. B) Sterol lipids are common in bacterial plasma membranes. C) Sterol lipids are common in human cell plasma membranes. D) Sterol lipids are common in plant cell plasma membranes. E) The plasma membranes of all cell types within a particular organism have basically the same lipid and protein composition.
Which one of the following statements about membranes is true? C) Sterol lipids are common in human cell plasma membranes.
Why is it surprising that the side chains of tryptophan residues in proteins can interact with lectins? A) because the side chain of tryptophan is hydrophilic and lectins are hydrophobic. B) because the side chain of tryptophan is (-) charged and lectins are generally (+) charged or neutral. C) because the side chain of tryptophan can make hydrogen bonds and lectins cannot. D) because the side chain of tryptophan is hydrophobic and lectins are generally hydrophilic. E) none of the above.
Why is it surprising that the side chains of tryptophan residues in proteins can interact with lectins? D) because the side chain of tryptophan is hydrophobic and lectins are generally hydrophilic.
The difference between a ribonucleotide and a deoxyribonucleotide is:
a deoxyribonucleotide has an —H instead of an —OH at C-2.
Triacylglycerols are composed of:
a glycerol backbone and three fatty acids
When the carbonyl group is on an inner atom forming a ketone, it is classified as
a ketose
A ligand-gated ion channel (such as the nicotinic acetylcholine receptor) is:
a membrane protein that permits an ion to pass through the membrane only when opened by the appropriate ligand.
Which solvent is a commonly used to extract all the lipids from homogenized tissue samples and subsequent separation of the lipids from the proteins and sugars present in those samples?
a mixture of chloroform, methanol, and water
GFC can also be used to measure
a protein's native weight
An integral membrane protein can be extracted with:
a solution containing detergent.
An integral membrane protein can be extracted with: a buffer of alkaline or acid pH. a chelating agent that removes divalent cations. a solution containing detergent. a solution of high ionic strength. (high salt
a solution containing detergent.
Define furanose
a sugar with a five-membered ring
Define ketose
a sugar with a ketone carbonyl group.
Define pyranose
a sugar with a six-membered ring
Define aldose
a sugar with an aldehyde carbonyl group.
What is Glycosidic bond?
a type of covalent bond that joins a carbohydrate (sugar) molecule to another group, which may or may not be another carbohydrate.
8. (6%) What happens in automated Sanger DNA sequencing reaction if you a) forget to add all ddNTPs? b) Add too much ddNTPs ? c) forget to add dNTPs? d) forget to add dGTP?
a) The polymerase will synthesize the whole strand without any breaks, but you will not detect any product at all because there are no short fragments and there is no detectable molecule. b) The polymerase will "stop" too early, thus each reaction will not be extended to full length c) Essentially, no reaction will occur, with the exception of incorporating the first ddNTP. Thus, you will see nothing. d) The polymerase reaction will proceed up to the first complementary C in the sequence and then terminate. Thus, you will see at best a very short strand of DNA sequence
15. Starch and glycogen are both polymers of: A) fructose. B) glucose1-phosphate. C) sucrose. D) a-D-glucose. E) B-D-glucose.
a-D-glucose.
sucrose monomers
a-Glucose + B-Fructose via a Glucose a-1 bond and a Fructose B-2 bond due to the flip that fructose does
Maltose monomers
a-Glucose + a-glucose via an a-1 --> 4 bond
What are the two types of secondary structures that occur in transmembrane proteins?
a-helical = signal transduction (receptors) and energy generation (proton pumps) b-barrel = passive diffusion of nutrients, slts, and water though closed hollow channel
Which arrow CORRECTLY identifies the atom that will become the anomeric carbon? (See Word doc for image) a. A b. B c. C d. D e. E
a. A
All of the statements about the following pairs of sugars are correct EXCEPT: a. Glyceraldehyde and dihydroxyacetone are stereoisomers. b. Glucose and mannose are C1 epimers. c. Galactose and mannose are diastereomers. d. Lgalactose and Dgalactose are enatiomers.
a. Glyceraldehyde and dihydroxyacetone are stereoisomers.
As a result of mutarotation, Dglucose exists in all of the following forms EXCEPT: a. Lglucopyranose. b. βanomer. c. free aldehyde. d. αanomer. e. all are true
a. Lglucopyranose.
Which of the following statements concerning sialic acid residues on glycoproteins is true? a. Sialic residues are removed by neuraminidases b. Sialic residues on erythrocytes are recognized by lectins, leading to removal of the erythrocytes c.Sialic residues on ceruloplasmin are recognized by lectins, leading to removal of ceruloplasmin d. The anti-viral drug oseltamavir accelerates the removal of sialic acid residues
a. Sialic residues are removed by neuraminidases
Which of the following techniques is not commonly used to study oligosaccharide structures? a. Xray crystallography b. Nuclear magnetic resonance (NMR) c. Complete chemical synthesis d. Matrixassisted laser desorption/ionization mass spectroscopy (MALDIMS) e. Lectin microarrays
a. Xray crystallography
In a(n) the carbonyl group is at the end of the carbon chain, but in a(n) the carbonyl group can be at any other position. a. aldose; ketose b. ketose; aldose c. hexose; heptose d. aldose; hexose e. ketose; tetrose
a. aldose; ketose
In glycoproteins, the carbohydrate moiety is always attached through the amino acid residues: a. asparagine, serine, or threonine b. aspartate and glutamate c. glutamine or arginine d. glycine, alanine, or aspartate e. tryptophan, aspartate, or cysteine
a. asparagine, serine, or threonine
Which of the following represents an example of a proteoglycan? a. attachment of several molecules of heparin to the peptide antithrombin III b. attachment of a Galβ(1,3)GalNAc disaccharide to the fish antifreeze protein c. attachment of a small oligosaccharide to an immunoglobulin d. attachment of a small antigenic determinant to a membrane bound protein of a cell e. none of the above
a. attachment of several molecules of heparin to the peptide antithrombin III
(a) Explain why phosphoglycerides (or glycerophospholipids) are capable of spontaneously assembling into the bilayer structure found in biological membranes but triacylglycerols are not. (b) What are the forces that drive bilayer formation?
a. has both polar and non-polar regins b. hydrophobic chain in water forces the formaiton of a cage and when the water molecules in the cage are released a gain in entropy happens driving the formation of the bilayer
(a)When relatively high concentrations of fatty acids are suspended in water, they form structures known as ________. (b) When relatively high concentrations of membrane phospholipids are dissolved in water, they form structures known as ________. (c) Why are the structures listed in your answers to (a) and (b) above favored on each type of lipid?
a. micelles b. bilayers c. Helps with formation
When a preparation of mitochondrial membranes was treated with high salt (0.5 M NaCl), it was observed that 40% of the total protein in this preparation was removed or solubilized. What kind of membrane proteins are in this soluble extract, and what forces normally hold them to the membrane? (b) What kind of proteins constitute the insoluble 60%, and what forces hold these proteins in the membrane?
a. peripheral membrane proteins b. integral membrane proteins
Carbohydrate characteristic chemical features include all EXCEPT: a. the inability to form multiple hydrogen bonds. b. the existence of one or more asymmetric centers. c. the capacity to form polymeric structures. d. the ability to exist in either linear or ring structures
a. the inability to form multiple hydrogen bonds.
When two carbohydrates are epimers: a. they differ only in the configuration around one carbon atom b. one is an aldose, the other a ketose c. they differ in length by one carbon d. they differ only in the configuration around the C1 carbon atom e. they possess the same optical activity
a. they differ only in the configuration around one carbon atom
Which of the following best describes the glycosidic bond below? a. α(1→4) b. α(1→3) c. β(2→4) d. α(2→4) e. β(1→3)
a. α(1→4)
Consider the transport of glucose into an erythrocyte by facilitated diffusion. When the glucose concentrations are 5 mM on the outside and 0.1 mM on the inside, the free-energy change for glucose uptake into the cell is: (These values may be of use to you: R = 8.315 J/mol·K; T = 298 K; 9 (Faraday constant) = 96,480 J/V; N = 6.022 1023/mol.)
about 10 kJ/mol.
Consider the transport of K+ from the blood (where its concentration is about 4 mM) into an erythrocyte that contains 150 mM K+. The transmembrane potential is about 60 mV, inside negative relative to outside. The free-energy change for this transport process is: (These values may be of use to you: R = 8.315 J/mol.K; T = 298 K; 9 (Faraday constant) = 96,480 J/V; N = 6.022 1023/mol.)
about 15 kJ/mol.
Define acid and base
acid = compound that can donate a proton base = compound that can accept a proton
Two purines found in DNA are ______________ and __________________.
adenine; guanine
The compound that consists of ribose linked by an N-glycosidic bond to N-9 of adenine is:
adenosine
What are the reaction schemes that generate adonic acids, uronic acids, alditols, deoxy sugars, and amino sugars
adonic acids = HCO -> COOH uronic acids = H2COH -> COOH alditols = HCO -> H2COH deoxy sugars = OH -> H amino sugars = OH -> NH2
How does an aldose differ from a ketose?
aldose = carbonyl group is an aldehyde (HCO) ketose = carbonyl group is a ketone (RCO)
In a(n) ____ the carbonyl group is at the END of the carbon chain, but in a(n) ____ the carbonyl group can be at any other position. A) aldose; ketose B) ketose; aldose C) hexose; heptose D) aldose; hexose E) ketose; tetrose
aldose; ketose
List the functions of biological membranes
allow import and export retain metabolites and ions provide compartmentalization produce and transmit nerve signals store energy support synthesis of ATP
Which of these pairs can readily interconvert in the process of mutarotation? A) D-glucose and D-Fructose B) D-glucose and D-Ribose C) D-glucose and D-glucosamine D) D-glucose and L-glucose E) alpha-D-glucose and beta-D-glucose
alpha-D-glucose and beta-D-glucose
Which pair is anomeric? A) D-glucose and D-fructose B) D-glucose and L-fructose C) D-glucose and L-glucose D) alpha-D-glucose and beta-D-glucose E) alpha-D-glucose and beta-L-glucose
alpha-D-glucose and beta-D-glucose
Starch and glycogen are both polymers of: A) fructose. B) glucose1-phosphate. C) sucrose. D) alpha-D-glucose. E) beta-D-glucose.
alpha-D-glucose.
Which term BEST describes the cholesterol molecule?
amphipathic
Which term BEST describes the polarity of membrane lipids?
amphipathic
Both α(1-4) and α(1-6) bonds can be found in the plant product ___
amylopectin
Define glycoside
an acetal formed between a sugar anomeric carbon hemi-acetal and an alcohol, which may be part of a second sugar.
A chain-form monosaccharide that has a carbonyl group (C=O) on an end carbon forming an aldehyde group (-CHO) is classified as
an aldose
Fatty acids are attached to sphingosine by what type of chemical linkage?
an amide linkage
What is an anomer?
an anomer is a cyclic saccharide and an epimer that differs in configuration, specifically at the hemiacetal/acetal carbon, also called the anomericcarbon.
Which type of chemical linkage is used to join fatty acids to glycerol?
an ester linkage
The fluidity of the lipid side chains in the interior of a bilayer is generally increased by:
an increase in the number of double bonds in fatty acids.
For the process of solute transport, the constant Kt is:
analogous to Km for an enzyme-catalyzed reaction.
The monosaccharides alpha-D-galactose and beta-D-galactose are
anomers
agglutination
antigen + antibody clump together
Movement of water across membranes is facilitated by proteins called:
aquaporins
Peripheral membrane proteins:
are generally noncovalently bound to membrane lipids.
Peripheral membrane proteins: are generally noncovalently bound to membrane lipids. can be released from membranes only by treatment with detergent(s). may have functional units on both sides of the membrane. penetrate deeply into the lipid bilayer.
are generally noncovalently bound to membrane lipids.
Peripheral membrane proteins: A) are generally noncovalently bound to membrane lipids. B) are usually denatured when released from membranes. C) can be released from membranes only by treatment with detergent(s). D) may have functional units on both sides of the membrane. E) penetrate deeply into the lipid bilayer.
are generally noncovalently bound to membrane lipids.
Define epimers
are stereoisomers differing in configuration at only one asymmetric carbon.
22. In glycoproteins, the carbohydrate moiety is always attached through the amino acid residues: A) asparagine, serine, or threonine. B) aspartate or glutamate. C) glutamine or arginine. D) glycine, alanine, or aspartate. E) tryptophan, aspartate, or cysteine.
asparagine, serine, or threonine
Which drug is NOT lipid based?
aspirin
1. To possess optical activity, a compound must be: A) a carbohydrate. B) a hexose. C) asymmetric. D) colored. E) D-glucose.
asymmetric.
To possess optical activity, a compound must be:
asymmetric.
It is useful to analyze hemoglobin glycation to determine the: A) blood glucose concentration at a given time B) single-time measurement of blood glycogen levels. C) average blood glucose level over days or weeks. D) average blood glycogen level over days or weeks.
average blood glucose level over days or weeks.
Which vitamin is NOT fat soluble? a. A b. C c. D d. E e. K
b. C
___ and ____ are found in tendons, cartilage and other connective tissue. a. Heparin; chondroitins b. Chondroitins; keratin sulfate c. Keratin sulfate, dermatan sulfate d. Hyaluronate, keratin sulfate e. All are true.
b. Chondroitins; keratin sulfate
Which pair is epimeric? a. D-glucose and D-glucosamine b. D-glucose and D-mannose c. D-glucose and L-glucose d. D-lactose and D-sucrose e. L-mannose and L-fructose
b. D-glucose and D-mannose
Glucose is an epimer of: a. xylose. b. Mannose c. ribose d. fructose. e. galactose
b. Mannose
and ____ are glycosamines linked to threecarbon acids at the C1 or C3 positions, and components of the polysaccharides of cell higher organisms and bacterial cell walls. a. Glucosides; galactosides b. Muramic acid; neuraminic acid c. Gluconic acid; glucuronic acid d. Sorbitol; ribitol e. None of the above
b. Muramic acid; neuraminic acid
The benefit of measuring the initial rate of a reaction V0 is that, at the beginning of a reaction: a. [ES] can be measured accurately b. changes in [S] are negligible, so [S] can be treated as a constant c. changes in Km negligible, so Km can be treated as a constant d. V0 = Vmax e. varying [S] has no effect on V0
b. changes in [S] are negligible, so [S] can be treated as a constant
D-Glucose is called a reducing sugar because it undergoes an oxidation reduction reaction at the anomeric carbon. One of the products of this reaction is: a. d-galactose b. d-gluconate c. muramic acid d. d-glucuronate e. d-ribose
b. d-gluconate
Which molecule is MOST commonly used as a backbone the linkage of three fatty acids to form fats? a. glycogen b. glycerol c. sphingosine d. glucose e. phosphoglycerol
b. glycerol
Which types of membrane lipids are modified to determine blood type in humans? a. phosphatidylserines b. glycosphingolipids c. galactolipids d. plasmalogens e. sphingomyelins
b. glycosphingolipids
Which statement is TRUE of the binding energy derived from enzyme-substrate interactions? a. it cannot provide enough energy to explain the large rate accelerations brought about by enzymes b. it is sometimes used to hold two substrates in the optimal orientation for reaction c. it is the result of covalent bonds formed between enzyme and substrate d. most of it is derived from covalent bonds between enzyme and substrate e. most of it is used up simply binding the substrate to the enzyme
b. it is sometimes used to hold two substrates in the optimal orientation for reaction
The cyclization of gluconic acid produces what type of structure? a. lactam b. lactone c. pyranose d. cyclic ether e. none of the above
b. lactone
Which factor is NOT a consequence of partial hydrogenation of vegetable oils? a. longer shelf life b. lower melting temperature c. reduction of some cis double bonds to single bonds d. conversion of some cis double bonds to trans double bonds e. increased risk of cardiovascular disease upon consumption by humans
b. lower melting temperature
Nonsteroidal anti-inflammatory drugs (NSAIDS) like aspirin and ibuprofen act by blocking production of: a. biological waxes b. prostaglandins c. sphingolipids d. vitamin D e. none of the answers are correct
b. prostaglandins
A cyclic hemiacetal with a six-membered oxygen containing ring is referred to as a(n): a. ketopentose. b. pyranose. c. sorbitol. d. aldehyde. e. furanose.
b. pyranose.
Which monosaccharide is NOT a six-carbon monosaccharide? a. fructose b. ribose c. mannose d. glucose e. galactose
b. ribose
Both water and glucose share an-OH that can serve as a substrate for a reaction with the terminal phosphate of ATP catalyzed by hexokinase. a. glucose has more -OH groups per molecule than does water b. the larger glucose binds better to the enzyme; it induces a conformational change in hexokinase that brings active-site amino acids into position for catalysis c. the -OH group of water is attached to an inhibitory H atom, while the glucose -OH group is attached to C d. water and the second substrate, ATP, compete for the active site resulting in a competitive inhibition of the enzyme
b. the larger glucose binds better to the enzyme; it induces a conformational change in hexokinase that brings active-site amino acids into position for catalysis
Which solvent is NOT used to dissolve lipids? a. ethyl ether b. water c. benzene d. methanol e. chloroform
b. water
The biochemical property of lectins that is the basis for most of their biological effects is their ability to bind to: a.specific peptides b.specific oligosaccharides c. amphipathic molecules d. hydrophobic molecules e. hydrophilic oligosaccharides
b.specific oligosaccharides
Which of the following is not a reducing sugar? a. ribose b.sucrose c. glyceraldehyde d. galactose e. fructose
b.sucrose
Why is it important to maintain biological molecules in a buffered solution?
because biological molecules with ionizable groups (capable of dissociting to yield an ion) are sensitive to changes in pH
Which compound can be cleaved in half to generate a molecule important in vision?
beta-carotene
Biological role of Vitamin K
blood clotting
what is the standard solute used to measure void volume?
blue dextran
Describe the nature and relative strengths of covalent bonds, ionic interactions, and van der Waals forces
bond strength: covalent > ionic interactions > van der Waals forces (incl. hydrogen bonding > all other dipole-dipole > dipole-induced > LDFs)
Triacylglycerols (TAGs) are composed of: A) a glycerol backbone B) three fatty acids C) amide linkages between the fatty acids and the glycerol D) both a glycerol backbone and three fatty acids E) a glycerol backbone, three fatty acids, and amide linkages between the fatty acids and the glycerol
both a glycerol backbone and three fatty acids
Humans make which omega-3 polyunsaturated fatty acid from alpha-linolenic acid (ALA)?
both eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA)
Which phospholipid head group is positively charged at pH 7?
both ethanolamine and choline
Which transporters can be classified as active transporters? A) flippases B) floppases C) scramblases D) both flippases and floppases E) both flippases and scramblases
both flippases and floppases
49. Which polysaccharide(s) can the enzyme -amylase break? A) glycogen B) starch C) cellulose D) both glycogen and cellulose E) both glycogen and starch
both glycogen and starch
Nonsteroidal antiinflammatory drugs (NSAIDs) inhibit the synthesis of which signaling lipids from arachidonic acid?
both prostaglandins and thromboxanes
Nonsteroidal antiinflammatory drugs (NSAIDs) inhibit the synthesis of which signaling lipids from arachidonic acid? A) prostaglandins B) thromboxanes C) leukotrienes D) both prostaglandins and thromboxanes E) both thromboxanes and leukotrienes
both prostaglandins and thromboxanes
When a tissue sample is homogenized in a extractant composed of chloroform, methanol, and water, followed by addition of more water to separate the liquid phases, which molecules will remain in the methanol/water phase?
both proteins and sugars
A patient you are treating appears to be deficient in vitamin D. You have previously prescribed vitamin D supplements, but they do not appear to be working. Which organs and/or tissues should you check to make sure that the enzymes they produce are functioning appropriately?
both the liver and the kidneys
Which technique separates lipids based on their affinity for a silica gel material?
both thin-layer and absorption chromatography
70. Oligosaccharides differ from nucleic acids and proteins in that oligosaccharides are commonly: A) branched. B) polymeric. C) acidic. D) basic. E) None of the answers is correct.
branched.
Cellulose is A) a linear copolymer of glucose and galactose. B) a branched polymer of glucose. C) a linear polymer of glucose with β(1-4) linkages. D) a linear polymer of glucose with α(1-4) linkages. E) sometimes called starch.
c
What is the abbreviated nomenclature for octadecanoic acid with two double bonds? a. 16:1 b. 14:2 c. 18:2 d. 18:0 e. 18:1
c. 18:2
The following data were obtained in a study of an enzyme known to follow Michaelis-Menten kinetics: (See Word doc for data) The K for this enzyme is approximately: a. 1mM b. 1000mM c. 2mM d. 4mM e. 6mM
c. 2mM
All are true for cellulose and αamylose EXCEPT: a. Both are linear homopolymers of glucose. b. Both have (1→4) linkages. c. Both form extended ribbon most stable conformations. d. Both have extensive intramolecular hydrogen bonding. e. All are true.
c. Both form extended ribbon most stable conformations.
Which of the following is not a reason that it is difficult to study oligosaccharide composition from biological systems? a. There are no specific glycosidase enzymes that can be used to selectively digest oligosaccharides b. Oligosaccharides have a variety of linkages (e.g., α16 or β14) c. Oligosaccharides often have a high positive charge density. d. Oligosaccharides are often branched. e. Oligosaccharides often have a high negative charge density
c. Oligosaccharides often have a high positive charge density.
Which type of chemical linkage is used to join fatty acids to glycerol? a. an ether linkage b. a peptide bond c. an ester linkage d. a double bond e. a peroxide bond
c. an ester linkage
Honey is characteristically composed predominantly of a.sucrose b. glucose and ribose c. fructose and glucose d.sucrose and sorbitol e. all of the above
c. fructose and glucose
Which of the following sugars is an aldohexose? a. ribulose b. ribose c. galactose d. arabinose e. xylulose
c. galactose
Cellulose is homopolysaccharide composed of ______ linked together by ______ glycosidic bonds. a. galactose; β(1→4) b. galactose; α(1→4) c. glucose; β(1→4) d. glucose; α(1→4) e. none of the above
c. glucose; β(1→4)
Which of the following disaccharides contains an α (1→4) Oglycosidic bond? a.sucrose b. cellobiose c. maltose d. lactose e. cellulose
c. maltose
A glycosidic bond would be present in: a. βDglucose6phosphate. b. βDgalactosamine. c. methylβDglucoside. d. 2deoxyαDribose. e. αDfructose1, 6bisphosphate.
c. methylβDglucoside.
Commercial vegetable oils can be converted from liquid forms to solid forms and have their shelf lives increased due to which process? a. partial desaturation b. unsaturation c. partial hydrogenation d. hydrolysis e. complete esterification
c. partial hydrogenation
Allosteric enzymes: a. are regulated primarily by covalent modification b. usually catalyze several different reactions within a metabolic pathway c. usually have more than one polypeptide chain d. usually have only one active site e. usually show strict Michaelis-Menten kinetics
c. usually have more than one polypeptide chain
Goal of the lab
calculate the relative mobility of acid phosphatase in comparison to the mobility of blue dextran
biological role of glycogen
carbohydrate storage in animal liver
biological role of starch
carbohydrate storage in plants
Sphingosine is NOT a component of:
cardiolipin
48. The polysaccharide chitin is MOST chemically similar to: A) cellulose. B) dextran. C) glycogen. D) starch. E) amylose.
cellulose.
Which compound is NOT a glycerophospholipid?
ceramide
Fatty acids are a component of:
cerebrosides
Bile acids are derived from which lipid?
cholesterol
The chemical oleandrin is produced by the plant Nerium oleander, which is used extensively in landscaping throughout the Southern US and California. It unfortunately produces the toxin oleandrin, shown below, which inactivates the sodium-potassium-ATPase pump. This can lead to a loss of electrical activity in the heart (asystole). **picture has 4 rings - 3 hexagons, 1 pentagon** As indicated by the bracketed structure, Oleandrin is derived from which of the following classes of lipids: A) cholesterol B) sphingomyelin C) ceramide D) triacylglycerol E) phosphatidylcholine
cholesterol
The steroid hormones testosterone and beta-estradiol are derived from which lipid molecule?
cholesterol
Which types of signaling lipids are produced by platelets to aid in the formation of blood clots?
cholesterol
8. During the poly-A tail adding process, the RNA Pol II synthesizes RNA until it encounters a _____ sequence that leads to the cleavage of the RNA several nucleotides down stream.
cleavage signal .
Describe condensation and hydrolysis reactions
condensation = two functional groups (commonly carboxylate and amino) combine to form a larger molecule usually resulting in the loss of water; basis of polymerization of amino acids into polypeptide hydrolysis = cleavage of a chemical bond to split up larger molecules into constituents, with the addition of water; ie. ATP hydrolysis releases free energy
Identify the molecule(s) derived from sterols.
cortisol
Which amino acid is NOT one that may be targeted for phosphorylation to modulate the activity of an enzyme? a. Tyr b. His c. Ser d. Ala e. Thr
d. Ala
Following complete hydrolysis of a sample of glycogen and a sample of cellulose, which of the following must be true? a. The cellulose sample is more soluble than the glycogen sample b. The cellulose sample contains only βdglucose c. The glycogen sample has a higher ratio of αdglucose than the cellulose sample d. Both samples consist of a mixture of αdglucose and βdglucose. e. The glycogen sample is more soluble than the cellulose sample
d. Both samples consist of a mixture of αd-glucose and βdglucose.
From the abbreviated name of the compound Gal(β1 &ρεγ; 4)Glc, we know that: a. the compound is a denantiomer b. the galactose residue is at the reducing end c. the glucose residue is the β anomer d. C4 of glucose is joined to C1 of galactose by a glycosidic bond
d. C4 of glucose is joined to C1 of galactose by a glycosidic bond
Which of the following is a heteropolysaccharide? a. Glycogen b. Starch c. Cellulose d. Hyaluronate e. Chitin
d. Hyaluronate
In competitive inhibition, an inhibitor: a. binds at several different sites on an enzyme b. binds covalently to the enzyme c. binds only to the ES complex d. binds reversibly at the active site e. lowers the characteristic Vmax of the enzyme
d. binds reversibly at the active site
Which statement provides the MOST compelling reason to devote resources to study cellulose-degrading enzymes? a. humans could use cellulose as a food source b. biomass could be converted to crude oil under high pressure c. symbiotic microorganisms in digestive tracts could be used as treatments in some GI tract diseases d. biomass could be converted more easily to bioenergy e. none of the answers are correct
d. biomass could be converted more easily to bioenergy
The core protein of a proteoglycan is noncovalently attached to: a. keratin sulfate. b. oligosaccharides. c. an outer protein. d. hyaluronic acid backbone. e. glycosaminoglycans
d. hyaluronic acid backbone.
The role of an enzyme in an enzyme-catalyzed reaction is to: a. bind a transition state intermediate, such that it cannot be converted back to substrate b. ensure that all of the substrate is converted to product c. ensure that the product is more stable than the substrate d. increase the rate at which substrate is converted into product e. make the free-energy change for the reaction more favorable
d. increase the rate at which substrate is converted into product
Proteoglycans are a group of macromolecules formed from: a. proteases and glycosaminoglycans. b. proteins and glycogen. c. proteases and monosaccharides. d. proteins and glycosaminoglycans. e. proteins and polysaccharides
d. proteins and glycosaminoglycans.
Advantages to using triacylglycerols, rather than polysaccharides, to store energy include which reason(s)? a. the carbon atoms of triacylglycerols are more reduced b. triacylglycerols contain more oxygen than polysaccharides and therefore are more efficient to oxidize c. since triacylglycerols are hydrophobic, excess water does not need to be stored along with them d. the carbon atoms of triacylglycerols are more reduced, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them e. triacylglycerols contain more oxygen than polysaccharides and therefore are more efficient to oxidize, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them
d. the carbon atoms of triacylglycerols are more reduced, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them
The enzymes αamylase and βamylase can cleave the ____ bonds of amylopectin but not the ____ bonds. a. α (1→6); α (1→4) b. β (1→6); β (1→4) c. α (1→4); β (1→4) d. α (1→4); α (1→6) e. α (1→6); β (1→4)
d. α (1→4); α (1→6)
What feature do Tay-Sachs disease, Fabry disease, and Niemann-Pick disease have in common?
defects in enzymes responsible for breaking down membrane lipids in the lysosomes
What is the free energy change for a reaction at equillibrium?
deltaG = 0 at equilibrium = death rather than reach equilibrium, living organisms are thermodynamically open systems that tend to maintain a "steady-state" in which the rates of synthesis and degradation are more or less equal and concentrations change little over time
consider the transport of glucose into an erythrocyte by facilitated diffusion. What is the free-energy change for glucose uptake into the cell when the glucose concentrations are 5mM on the outside and 0.1 mM on the inside? (These values may be of use to you: R = 8.315 J/mol*K; T=298K; Faraday constant = 96,480 J/V; N= 6.022e23/mol) A) about 2 kJ/mol B) about -10 kJ/mol C) about 30 kJ/mol D) about -30 kJ/mol E) it is impossible to calculate without knowledge of the membrane potential
deltaG = RTln(where it ends up/where it starts off) + (z * F * deltaV) Answer: -10 kJ/mol
What is the relationship (equation) between deltaG, deltaG*, and the concentration of reactants and products? *= STP
deltaG = deltaG* + RTlnKeq under non-equilibrium settings Keq = concentrations of products/reactants
What is the relationship (equation) between deltaG* and Keq? *=STP
deltaG* = -RTlnKeq and at equilibrium when deltaG = 0
Why do changes in both enthalpy and entropy determine the spontaneity of a process?
deltaG* = deltaH* - TdeltaS* = measure of thermodynamic potential (spontaneity) thermodynamically favorable (spontaneous, deltaG < 0) rxns are under: enthalpic control if deltaH < 0 and TdeltaS < 0 entropic control if deltaH > 0 and Tdelta > 0 both controls if deltaH < 0 and TdeltaS > 0
What is the relationship between energy (U), heat (q) and work (w)?
deltaU = q - w change in internal energy of the system (delta U) is equal to the amount of heat exchanged/added minus the amount of work done
79. Which factor is NOT a part of determining the complete structure of an oligosaccharide or polysaccharide? A) determination of linear sequence B) determination of lectin partners C) determination of branching positions D) determination of glycosidic linkages E) determination of monosaccharide configuration
determination of lectin partners
All D and L aldohexoses ar?
diastereomers
epimers
diastereomers that differ at one chiral center ex. Glucose and Galactose
phosphate ester bond has the role of
difference between a nucleoside and a nucleotide
The specificity of the potassium channel for K+ over Na+ is mainly the result of the:
differential interaction with the selectivity filter protein.
GFC results in
dilution of the sample (so its best to use it early on in a protein isolation scheme)
Which technique used to analyze lipids is the fastest but may not be the most accurate?
direct mass spectrometry
Alpha monomers have their anomerica hydroxyl go which way?
down
facilitated diffusion through a biological membrane is: A) driven by a difference of solute concentration B) driven by ATP C) endergonic D) generally irreversible E) not specific with respect to the substrate
driven by a difference of solute concentration
Facilitated diffusion through a biological membrane is:
driven by a difference of solute concentration.
Describe the fluid mosaic model
dynamic arrangement and interactions of membrane lipids (x-axis lateral diffusion) and proteins (also decorated with oligosaccharides with y-axis lateral diffusion)
Which of the following statements about starch and glycogen is false? a. Glycogen is more extensively branched than starch b. Both are homopolymers of glucose. c. Amylose is unbranched; amylopectin and glycogen contain many (α1 &ρεγ; 6) branches. d. Both starch and glycogen are stored intracellularly as insoluble granules. e. Both serve primarily as structural elements in cell walls.
e. Both serve primarily as structural elements in cell walls.
The enantiomer of Dglucose would be: a. Larabinose. b. Dgalactose. c. Dglucose. d. Lmannose. e. Lglucose.
e. Lglucose.
Glycosaminoglycans are unbranched polysaccharides consisting of alternating residues of uronic acid and hexosamine. Which of the following is NOT a glycosaminoglycan? a. chondroitin4sulfate b. hyaluronate c. heparin d. dermatan sulfate e. agaropectin
e. agaropectin
Binding energy between an enzyme and a substrate contributes to catalysis in which way? a. binding energy provides the enzyme specificity for the substrate b. binding energy contributions allow for entropy reduction in the substrate-enzyme complex c. binding energy compensates for energy changes as a result of desolvation of the substrate d. binding energy contributes to the process of induced fit between the substrate and the enzyme e. all of the answers are correct
e. all of the answers are correct
Polysaccharides CANNOT be used by cells: a. as fuel storage molecules b. for structural elements in cell walls c. for structural elements in animal exoskeletons d. for the extracellular matrix in animal cells e. all of the answers are correct
e. all of the answers are correct
Under what circumstance might an organism's patterns of glycosylation NOT be altered? a. development b. genetic diseases c. cancer d. cell differentiation e. all of the answers are correct
e. all of the answers are correct
A glycoconjugate molecule may include a carbohydrate as well as: a. an amino acid b. a lipid c. a saccharide d. both an amino acid and a lipid e. an amino acid, a lipid, and a saccharide
e. an amino acid, a lipid, and a saccharide
To possess optical activity, a compound must be: a. carbon triple bonds b. carbon double bond c. carbohydrate d. hexose e. asymmetric
e. asymmetric
Cellulose is extremely resistant to hydrolysis, but cellulase catalyzes the hydrolysis and comes from: a. H+ secreted into the rumen. b. the intestinal wall. c. the pancreas. d. the liver. e. bacteria that live in the rumen
e. bacteria that live in the rumen
Chymotrypsin catalyzes the cleavage of proteins at peptide bonds adjacent to aromatic amino acid residues by using which catalytic mechanism? a. general acid-base catalysis b. metal ion catalysis c. covalent catalysis d. both general acid-base catalysis and metal ion catalysis e. both general acid-base catalysis and covalent catalysis
e. both general acid-base catalysis and covalent catalysis
Which polysaccharide(s) can the enzyme α-amylase break? a. glycogen b. starch c. cellulose d. both glycogen and cellulose e. both glycogen and starch
e. both glycogen and starch
The reference compound for naming D and L isomers of sugars is: a.sucrose b. ribose c. glucose d. fructose e. glyceraldehyde
e. glyceraldehyde
Which of the following is correctly paired with its most prevalent cyclization product? a. fructose: pyranose b. glucose: furanose c. ribose: pyranose d. galactose: does not cyclize e. none of the above
e. none of the above
Which of following is an anomeric pair? a. αdglucose and αdfructose b. αdglucose and βlfructose c. αdfructose and βlfructose d. αdglucose and βlglucose e. αdglucose and βdglucose
e. αdglucose and βdglucose
Which of the following pairs is interconverted in the process of mutarotation? a. dglucose and dfructose b. dglucose and dgalactose c. dglucose and lglucose d. dglucose and dglucosamine e. αdglucose and βdglucose
e. αdglucose and βdglucose
A process not involving the fusion of two membranes or two regions of the same membrane is:
entry of glucose into cells.
What is an epimer?
epimer is a stereoisomer that differs in configuration at any single stereogenic center
The top two units (D-Galactose and D-Glucose) differ only in the orientation of the hydroxyl at C-4. We call such sugars: A) Epimers B) Anomers C) Hemiketoses D) Furanoses E) Pentoses
epimers
33. The two monosaccharides shown below could BEST be described as: A) ketoses. B) anomers. C) rotamers. D) epimers. E) enantiomers.
epimers.
Waxes are BEST described as:
esters of one long-chain fatty acid and one long-chain alcohol.
Biological waxes are all:
esters of single fatty acids with long-chain alcohols
Biological waxes are all:
esters of single fatty acids with long-chain alcohols.
biological role of chitin
exoskeleton of insects
biological role of proteoglycan
extracellular matrix of animal tissues
The transport in question 17 is an example of: **negative free-energy** A) Simple diffusion B) Facilitated diffusion C) Primary active transport D) Secondary active transport
facilitated diffusion
Glucose transport into erythrocytes is an example of:
facilitated diffusion.
Circle the fatty acid in each pair that has the higher melting temperature. (a) 18:19 18:29,12 (b) 18:0 18:19 (c) 18:0 16:0
first one in each -- longer, less double bonds
The type of motion least common in biological membranes is:
flip-flop diffusion of phospholipid from one monolayer to the other.
the _____ describes biological membranes as two-dimensional fluids in which transmembrane proteins and lipids can laterally diffuse.
fluid mosaic model
Which types of membrane lipids make up 70% to 80% of the total membrane lipids in a vascular plant?
galactolipids
A compound containing N-acetylneuraminic acid (sialic acid) is:
ganglioside GM2.
You are working in a laboratory trying to design a drug that specifically binds to the surface of certain cells. To which membrane lipid constituents should your drug bind in order to achieve this specificity?
gangliosides
Tay-Sachs disease is the result of a genetic defect in the metabolism of:
gangliosides.
Which technique would you NOT use to separate and/or analyze lipids in a laboratory?
gel electrophoresis
Hemoglobin glycation is a process where ____ is ___ attached to hemoglobin. A) glycerol; covalently B) glucose; enzymatically C) glucose; nonenzymatically D)N-acetyl-galactosamine; enzymatically E) galactose; nonenzymatically
glucose; nonenzymatically
The reference compound for naming D and L isomers of sugars is:
glyceraldehyde.
Which molecule is MOST commonly used as a backbone the linkage of three fatty acids to form fats?
glycerol
Which molecule is MOST commonly used as a backbone the linkage of three fatty acids to form fats? A) glycogen B) glycerol C) sphingosine D) glucose E) phosphoglycerol
glycerol
Several types of human joint and skeletal defects are a result of a defect in a biosynthetic enzyme responsible for synthesis of: A) glycosaminoglycans. B) glycoproteins. C) glycolipids. D) lipopolysaccharides. E) glycosphingolipids.
glycosaminoglycans.
Which types of membrane lipids are modified to determine blood type in humans?
glycosphingolipids
If a protein enters the pores its elution volume will be
greater than the void volume (V0)
The DNA oligonucleotide abbreviated pATCGAC:
has a hydroxyl at its 3' end.
Membrane proteins: are sometimes covalently attached to lipid moieties. are sometimes covalently attached to carbohydrate moieties. are composed of the same 20 amino acids found in soluble proteins. diffuse laterally in the membrane unless they are anchored have all of the above
have all of the above
Membrane proteins:
have all of the properties listed above.
Explain the difference between a hemiacetal and a glycoside.
hemiacetal is formed when an aldose or ketose condenses with an alcohol; a glyco-side is formed when a hemiacetal condenses with an alcohol
7. When the linear form of glucose cyclizes, the product is a(n): A) anhydride. B) glycoside. C) hemiacetal. D) lactone. E) oligosaccharide.
hemiacetal.
Why do only certain cells respond to hormones even though all cells in the body are exposed to the hormone?
hormones must bind to specific hormone receptors that vary in different types of cells in order for the cell to respond
What are examples of substances that can readily diffuse across biological membranes?
in general, only apolar substances ie. steroid hormones, fat-soluble vitamins K/A/D/E, and gases O2 and CO2
Describe qualitatively how the tm for a double-stranded DNA depends on its nucleotide composition.
in general, the higher the proportion of G and C, the higher the melting temperature, tm. More thermal energy is required to break the three hydrogen bonds holding G≡C pairs than to break the two hydrogen bonds holding A=T pairs. Also, G≡C pairs stack better than A=T pairs, thereby stabilizing the double helix better.
Which health effect is NOT associated with consumption of trans fats?
increased joint flexibility due to additional membrane fluidity
The fluidity of a lipid bilayer will be increased by:
increasing the temperature.
Phospholipase C hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP2) to form which signaling molecule that triggers Ca2+ release from the endoplasmic reticulum?
inositol 1,4,5-triphosphate (IP3)
Explain the differences between integral and peripheral membrane proteins.
integral 6 types,alpha-helixes,span entire membrane peripheral loosely attached, associate w/ polar heads
37. During which process are chemical bonds NOT broken? A) mutarotation B) interconverting between two configurations C) interconverting between two conformations D) interconverting between two anomers E) None of the answers is correct: all involve breaking a chemical bond.
interconverting between two conformations
proteins pass through the column in a manner
inversely related to their diameters
Which method can be used to visualize lipids that have been separated by thin-layer chromatography by reversibly reacting with double bonds in fatty acids?
iodine fumes
What are similarities and differences between ionophore channels and ion channels?
ion channels = protein equivalents of pores; tightly gated and coupled to only open and close when needed ionophore channels drill a tunnel/pore through the membrane to increase permeability both move ions to discharge membrane potential
List hormones produced by the pancreas and adrenal glands, what types of molecules are these hormones?
islets of Langerhans (2% of pancreas) secrete metabolic hormones such as insulin and glucagon which are macromolecular molecules (peptides and proteins) adrenal glands release steroids such as cortisol and aldosterone which are micromolecular molecules
Platelet-activating factor is much more water soluble than most other glycerophospholipids due to which feature?
its ester-linked acetic acid at the C-2 of glycerol
The phosphodiester bonds that link adjacent nucleotides in both RNA and DNA:
join the 3' hydroxyl of one nucleotide to the 5' hydroxyl of the next.
phosphodiester bond has the role of
joins adjacent nucleotides in one strand
hydrogen bond has the role of
joins complementary nucleotides in two strands
Calculate the weight in grams of a double-helical DNA molecule stretching from Earth to the moon (~320,000 km). The DNA double helix weighs about 1 × 10−18 g per 1,000 nucleotide pairs; each base pair extends 3.4 Å. For an interesting comparison, your body contains about 0.5 g of DNA.
km to anstram (1nm to A) angstram to bp (i bp is 3.4 A) bp to g (1x10^-18 per 1000 bp)
Explain the movement of proteins through the column
large proteins don't get trapped within the pores of the matrix, so they move through the mobile phase easily and quickly; smaller proteins enter the pores of the spongy bead matrix and are trapped, so take longer to move through the column
Which proteins will exit the column more quickly?
larger proteins
10. In the group II intron, the intron released itself through a ____ intermediate with a 2'-5'- phosphodiester bond.
lariat-like
Why is lateral diffusion of membrane lipids faster than transverse diffusion?
lateral diffusion is fast because the lipid tails are under constant motion due to free rotation about the c-C bond transverse diffusion is slow due to thermodynamic constraints that would require the polar head to momentarily go through the apolar tails to flip to the other side; and there would be steric clashes
75. What strategy do cells use to overcome the modest affinity between an oligosaccharide and an individual CBD of a lectin? A) lectin multivalency B) expressing multiple lectin receptors C) placing multiple CBDs on a single lectin molecule D) both lectin multivalency and placing multiple CBDs on a single lectin molecule E) lectin multivalency, expressing multiple lectin receptors, and placing multiple CBDs on a single lectin molecule
lectin multivalency, expressing multiple lectin receptors, and placing multiple CBDs on a single lectin molecule
Overproduction of which types of signaling lipids causes asthmatic attacks?
leukotrienes
Overproduction of which types of signaling lipids causes asthmatic attacks? A) prostaglandins B) thromboxanes C) arachidonates D) lipoxins E) leukotrienes
leukotrienes
How do the physical properties of glycosaminoglycans and similar molecules relate to their biological roles?
linear structure, cell walls and exoskeletons
N-glycosidic bond has the role of
links base to pentose in nucleotide
Human adipocytes contain which enzyme that catalyzes the breakdown of triacylglycerols?
lipase
The study and classification of the complete set of lipids produced in an organisms is called:
lipidomics.
How do lipids differ from the three other major classes of biological molecules?
lipids do not polymerize
Which factor is NOT a consequence of partial hydrogenation of vegetable oils?
lower melting temperature
3. ___: RNA molecule that specifies the amino acid sequence of a protein.
mRNA
How to determine molecular weight
make standard curve with Ve/Vo on x-axis and log of MW on y-axis (then you can use Ve/Vo to estimate MW)
What is blue dextran?
massive polysaccharide (approx. weight is 2,000 kDa)
Integrins are:
membrane proteins that mediate cell adhesion.
If you wanted to analyze membrane lipids from a biological sample, which solvent would MOST effectively extract those lipids?
methanol
other names for GFC
molecular sieving, gel permeation chromatography, size exclusion chromatography, Sephadex chromatography
In high-performance liquid chromatography of lipid mixtures using a column packed with a silica gel, which types of lipids will elute first?
neutral lipids
Why is this statement false. Peripheral membrane proteins are generally covalently bound to membrane lipids
non-covalently attached
Why is this statement false. Free fatty acids are major components of all membranes
not in high amounts
List major eukaryotic organelles and their functions
nucleolous = RNA synthesis lysosome = digestive enzymes golgi apparatus = secretory pathway mitochodrion = power plant smooth ER = lipid metabolism rough ER = protein synthesis
Compounds that contain a nitrogenous base, a sugar, and a phosphate group are called
nucleotides
A reducing sugar is
one with a free carbonyl carbon (aldehyde) that can be oxidized to the carboxylic acid by Cu2+ or Fe3+.
Why is this statement false. Peripheral membrane proteins may have part of its polypeptide on both sides of the membrane.
only associate with polar heads on one side chain
Why is this statement false. All biological membranes contain cholesterol
only in animals
What are the biological effects of steroid hormones?
overall help maintain homeostasis; 5 major classes 1)Progesterones - ie. progesterone - menstration, pregnancy, embryogenesis 2)Estrogens - ie. estradiol - female sexual development 3)Androgens - ie. testosterone - male sexual development 4)Glucocorticoids - ie. cortisol - metabolism, and inflammation 5)Mineralcorticoids - ie. aldosterone - osmoregulation (salt and water balance)
How do you calculate pH from the concentration of H+ or OH-?
pH = -log[H+] = measure of acidity pOH = -log[OH-] = measure of alkalinity/basicity pH + pOH = 14
Commercial vegetable oils can be converted from liquid forms to solid forms and have their shelf lives increased due to which process?
partial hydrogenation
Distinguish between passive transport, facilitated transport and active transport
passive = apolar molecules, no energy, with gradient facilitated = small polar molecules, no energy, with gradient, through conduits/vehicles active = energy required; against gradient; protein pumps/transporters
Which glycerophospholipid has a net charge of zero at pH 7?
phosphatidylcholine
Which lipid compound is NOT at least partially made from the condensation of isoprene units?
phosphatidylinositol
Which membrane lipid serves as a reservoir of messenger molecules for signal transduction?
phosphatidylinositol 4,5-bisphosphate (PIP2)
An example of a glycerophospholipid that is involved in cell signaling is:
phosphatidylinositol.
Which types of lipids would NOT have their fatty acids completely hydrolyzed by treatment with acid or alkali?
plasmalogens
A protein is found to extend all the way through the membrane of a cell. Describe this protein in terms of the location of particular types of amino acid side chains in its structure and its ability to move within the membrane.
polar and uncharged residues are located on portions of the protein that protrudes out of face membrane
A hydropathy plot is used to:
predict whether a given protein sequence contains membrane-spanning segments.
If a patient you are treating has asthmatic attacks due to the overproduction of leukotrienes, which drug would you prescribe to help treat that condition?
prednisone
Biological role of Vitamin E
prevention of oxidative damage
Lysosomes generate and maintain their pH gradients by using the activity of a proton-pumping V-type ATPase, which uses metabolic energy in the form of ATP to pump protons from the ~neutral cytosol to the highly acidic lysosome lumen. v-ATPases allow for: A)Simple diffusion of H+ B)Facilitated diffusion of H+ C)Primary active transport of H+ D)Secondary active transport of H+
primary active transport of H+
What are the products of ionization of water? How are their concentrations related?
products are H+ and OH- ions; H+ largely exists as H3O+; concentrations are inversely related - more of one=less of the other
Nonsteroidal anti-inflammatory drugs (NSAIDS) like aspirin and ibuprofen act by blocking production of:
prostaglandins
Which eicosanoids contains a five-carbon ring as part of its structure?
prostaglandins
what is a drawback of long columns and high fluid volumes?
protein peaks spread as they move through the column,
Name the building blocks of proteins, carbohydrates, and nucleic acids
proteins = amino acids; dominated by amino and carboxylate groups carbs = monosaccharides; dominated by hydroxyl and carbonyl groups nucleic acids = nitrogenous bases
proteoglycan and a glycoprotein are both made of
proteins and polysaccharides
Why is this statement false. In a given eukaryotic cell type (e.g., a hepatocyte), all intracellular membranes (membranes of organelles) have essentially the same composition of lipids and proteins.
proteins are a variety of structural and functional
List the major biological functions of proteoglycans and peptidoglycans.
proteoglycans functions in cartilage to make it highly resilient peptidoglycans give cell walls their shape
When a bacterium such as E. coli is shifted from a cooler growth temperature to a warmer growth temperature, it compensates by: A) increasing its metabolic rate to generate more heat. B) putting longer-chain fatty acids into its membranes. C) putting more unsaturated fatty acids into its membranes. D) shifting from aerobic to anaerobic metabolism.
putting longer-chain fatty acids into its membranes.
When a bacterium such as E. coli is shifted from a warmer growth temperature to a cooler growth temperature, it compensates by:
putting more unsaturated fatty acids into its membranes.
When a bacterium such as E. coli is shifted from a warmer growth temperature to a cooler growth temperature, it compensates the fluidity in the membrane by: increasing its metabolic rate to generate more heat. putting longer-chain fatty acids into its membranes. putting more unsaturated fatty acids into its membranes. shifting from aerobic to anaerobic metabolism.
putting more unsaturated fatty acids into its membranes.
What are the biological effects of insulin and glucagon?
regulates blood glucose level @ 1mg/mL insulin is released to lower glucose levels, RTK receptor glucagon is released to raise glucose levels, GPCR receptor
The fluidity of a lipid bilayer will be increased by: decreasing the number of unsaturated fatty acids. decreasing the temperature. increasing the length of the alkyl chains. replacing 18:0 (stearic acid) with 18:2 (linoleic acid).
replacing 18:0 (stearic acid) with 18:2 (linoleic acid).
Examples of artificial sweeteners
saccharine, aspartame, acesulfame, alitame
The type of membrane transport that uses ion gradients as the energy source is:
secondary active transport.
72. Which sequence is the CORRECT one for leukocyte extravasion in the inflammatory response? A) integrin binding selectin binding adhesion arrest extravasion B) adhesion integrin binding selectin binding arrest extravasion C) selectin binding -> integrin binding -> adhesion -> arrest -> extravasion D) integrin binding adhesion selectin binding arrest extravasion E) selectin binding adhesion integrin binding arrest extravasion
selectin binding -> integrin binding -> adhesion -> arrest -> extravasion
Bacterial cells change the fluidity of their lipid membranes to adapt to growtterm-20h at lower temperatures by increasing the synthesis of: A) cholesterol. B) long-chain fatty acids and increasing the saturation of their membrane lipids. C) both long- and short-chain fatty acids. D) long-chain fatty acids and decreasing the saturation of their membrane lipids. E) short-chain fatty acids and decreasing the saturation of their membrane lipids.
short-chain fatty acids and decreasing the saturation of their membrane lipids
Why do glycerophospholipids and sphingolipids - but not fatty acids - form bilayers?
single-tailed amphiphilic detergents and fatty acids aggregate into higher ordered micelles double-tailed amphiphilic molecules like phospholipids and oligosaccharides aggregate into higher ordered bicelles and not micelles because of unfavorable steric clashes in the double tail
What size protein spreads out more?
smaller proteins (because they take longer to move through the gel)
24. The biochemical property of lectins that is the basis for most of their biological effects is their ability to bind to: A) amphipathic molecules. B) hydrophobic molecules. C) specific lipids. D) specific oligosaccharides. E) specific peptides.
specific oligosaccharides
Define enantiomers
stereoisomers that are nonsuperimposable mirror images of each other.
Cortisol is derived from
sterols
biological role of peptidoglycan
structural component of bacterial cell wall
biological role of cellulose
structural component of plant cell walls
All of the following disaccharides are reducing sugars EXCEPT: a. isomaltose. b. maltose. c. cellulose. d.sucrose. e. lactose
sucrose
Membrane fusion leading to neurotransmitter release requires the action of:
tSNARE and vSNARE
make sure that
the buffer meniscus never drains low enough to expose the top of the packed beads
Define anomeric carbon
the carbonyl carbon atom of a such which is involved in ring formation
what does the peak tell you?
the elution volume
For the oligoribonucleotide pACGUAC:
the nucleotide at the 5' end is a pyrimidine.
How does GFC differ from other forms of column chromatography?
the proteins never bind to the immobile phase (they are delayed by differing degrees as they pass through the column)
Which statement is generally TRUE of integral membrane proteins? A) the secondary structure in the transmembrane region usually consists of alpha helices or beta sheets composed of hydrophobic amino acids B) the domains that protrude on the cytoplasmic face of the plasma membrane nearly always have covalently attached oligosaccharides C) transmembrane domains are easily accessible, and therefore very susceptible to degradation by the protease trypsin D) they can be removed from the membrane with high salt E) they undergo constant rotational motion that moves a given domain from the outer face of a membrane to the inner face and then back to the outer
the secondary structure in the transmembrane region usually consists of alpha helices or beta sheets composed of hydrophobic amino acids
Void volume
the volume that lies outside the beads (also the volume of fluid needed to elute a solute that doesn't enter the gel pores at all)
Fatty acids in aqueous solution form micelles and not vesicles because: they are not amphipathic. they are too hydrophobic to form vesicles. their overall surface is cone shaped rather than cylindrical. they do form vesicles if there are no bile salts available.
their overall surface is cone shaped rather than cylindrical.
Why is this statement false. The inner and outer membranes of mitochondria should have same protein compositions
they are asymetric
Why do cells contain an array of protein phosphatases as well as protein kinases?
they maintain homeostasis by turning proteins on and off, molecular switch - post translational regulation
In larger scale operations
they use automation including pumps to regulate flow rate, and an in-line spectrophotometer that monitors absorbance of the eluate, as well as a fraction collector that delivers measured amounts of liquid into a series of test tubes
A pyrimidine found in all DNA but in only some RNA is
thymidine
biological role of trehalose
transport/storage in insects
An electrogenic Na+ transporter:
transports Na+ without concurrent transport of any other charged species
Specific hydrolysis of phosphatidylcholine can be achieved by which technique?
treatment of the lipid with both phospholipase C and mild acid
Which compound is NOT a type of membrane lipid?
triacylglycerolipid
Beta monomers have their anomeric hydroxyl go which way?
up
A major component of RNA but not of DNA is:
uracil.
What are the functions of steroid hormones?
variety of functions central to homeostasis; highly hydrophobic and diffuse easily through cell membrane to bind to their receptor; five major classes = PGAME
biological role of hyaluronate
viscosity, lubrication of extracellular secretions
Biological role of Vitamin A
vision
Which solvent is NOT used to dissolve lipids?
water
28. Which technique is NOT commonly used to study oligosaccharide structures? A) x-ray crystallography B) matrix-assisted laser desorption/ionization mass spectroscopy (MALDI-MS) C) nuclear magnetic resonance (NMR) D) complete chemical synthesis E) oligosaccharide microarrays
x-ray crystallography
Which technique is NOT commonly used to analyze lipid composition?
x-ray crystallography
Explain the trend in melting point with increasing fatty acid chain length and number of double bonds
x:m symbol -> x= # of C atoms, m = # of CC double bonds mp increases with increasing x mp decreases with increasing m
Starch and glycogen are both polymers of:
α-D-glucose.
Which polysaccharide is found in a helically coiled conformation?
α-amylose
Starch is a mixture of:
α-amylose and amylopectin
Raffinose (found in beans, cabbages, etc.) along with other branched galactose-containing carbohydrates, is poorly digested in the small intestines of some individuals. If they are not cleaved to monosaccharides and absorbed, these sugars are instead fermented in the large intestine by bacteria, producing large amounts of hydrogen, carbon dioxide and methane gases. Pain and flatulence can be avoided by using products like Beano™. Beano™, which cleaves the glycosidic bond indicated with an arrow, contains: a) α1-2 galactosidase b) α1-4 galactosidase c) α1-6 galactosidase d) β2-4 galactosidase e) β4-6 galactosidase
α1-6 galactosidase