Genetics 2

The appearance of a novel phenotype resulting from the substitution of a single base pair might be due to:

All of the choices are possible consequences of a single base pair substitution

If a man has the permutation allele for Fragile X syndrome, what is the probability that he will pass the permutation allele on to his son:

0%

There are ____ usually found in the genetic code:

1 start codon and 3 stop codons

Indicate the correct order for one round of infection by bacteriophage T4

1. Lysis of the host cell 2. Phage proteins and DNA synthesized, host DNA degraded 3. Assembly of phage within host cell 4. Phage body enters host cell 5. Phage injects DNA into host cell • 5,2,3,1

Approximately what proportion of the human genome is composed of the exome:

2%

You performed a Sanger sequencing reaction and obtained the following electropherogram (a computer-generated trace of the intensity of each color's fluorescence). In this figure, A = green, C = purple, G = black, T = red. The height of the peaks is unimportant. The 5' end of the squence is at the left of the trace. (colorful scribble picture)What is the sequence of the DNA synthesized in the sequencing reaction?What is the sequence of the template DNA used for this sequencing reaction?

5' TTTGCTTTGTGAGCGGATAACAA 3' 3' AAACGAAACACTCGCCTATTGTT 5'

A sequence of DNA that reads 5' ATGCCTGAATCAGCTTTA 3' should code for ____ amino acids after all the steps of conversion into protein are complete:

6

What is the use of a RefSeq:

A RefSeq is a single, complete, annotates version of a species sequence that can be accessed for bioinformatics studies:

The term mutation refers to

A heritable change in the DNA of a cell

The BLAST suite of programs can be used to:

Compare a nucleotide or amino acid sequence to database from a variety of species

Nonsense codons are:

Codons that do not code for an amino acid

The result of the Luria Delbruck fluctuation experiment indicated that:

Bacteria become resistant to phage by random spontaneous mutation

Red green color blindness is more common in males than females because:

Both the red and green pigment genes are on the X chromosome

Excision repair corrects DNA by:

Detecting, removing, and replacing damaged or incorrect nucleotides in a single strand of DNA

Examination of the rhodopsin gene family provides evidence for gene evolution by:

Duplication and divergence

A mutation that occurs when a base is inserted into or deleted from a DNA sequence, completely altering the subsequent amino acid sequence, is called a

Frameshift mutation

Which of the following is a potential mechanism through which proteins can acquire novel domain architectures over evolutionary time:

Genome duplication followed by exon shuffling

A neomorphic dominant mutation is the Antennapedia (Antp) gene of Drosophila causes:

Growth of a leg from the head region

Mutations that result in much less of a protein or a protein with limited function are known as:

Hypomorphic mutatons

What is one way that genes can be predicted in genome sequences?

Identifying the most conserved sequences between different species

Though sickle cell anemia is frequently lethal for individuals who are homozygous for the sickle cell allele, natural selection seems to have maintained that allele in certain geographic locations. A likely explanation for this observation is:

Individuals who are heterozygous for the sickle cell allele are protected from malaria

The Ames test for mutagenicity is useful to identify potential carcinogens because:

Mutagens that affect bacterial DNA are likely to cause human mutation

In Sanger sequencing, what causes DNA synthesis to terminate at a specific base:

Nucleotide triphosphates that lack a hydroxyl at the 3' position

What is one difference between using restriction endonucleases and mechanical shearing of DNA:

Restriction endonucleases digest at known specific sites while shearing occurs at random sites

Assume that in the organism under study the DNA polymerase has an error rate of 1 mistake in every 10^6 bases copied. However, the overall mutation rate is much lower. This is most likely because:

Repair mechanisms correct errors made by the polymerase

The role of the DNA polymerase in Sanger sequencing is to:

Synthesize a copy of the template strand in the 5' to 3' direction

What is the advantage of having different forms of hemoglobin:

The different forms are adapted to most efficiently carry oxygen in the different stages of development

What do you predict would be the effect of an inversion mutation in the B-globin gene cluster:

The order of globin gene expression will be reversed; the effect on the fetus cannot be predicted

Which of these is NOT a character of the genetic code:

There are the same number of codons as there are amino acids

How are the genes in the B-globin locus different from each other?

They are expressed at different times in development

After digestion of DNA with a restriction endonuclease, which statement is true about the resulting DNA fragments:

They will have either a single stranded overhang or blunt ends, depending on the enzyme used

Why is it necessary to obtain overlapping sequences when performing genomic sequencing:

To assemble the whole genome sequence from random fragments

What is the purpose of ethidium bromide in DNA electrophoresis?

To label DNA fragments so they can be viewed under UV light

Replacing an adenine nucleotide with a guanine is an example of a:

Transition

During maturation of an mRNA sequences that are spliced out are called:

introns

In the usual flow of genetic information (Central Dogma), which of the following best represents the expression of genes

dna-rna-protein

The sequence found in a mature eukaryotic mRNAs are

exons

A mutation that changes a codon sequence, and subsequently changes the amino acid that should have been placed at that point in the polypeptide chain is called a:

missense mutation

A mutation that changes a codon that originally coded for an amino acid into a stop codon is called a:

nonsense mutation

RNA polymerase binds to a sequence called a/n ______ before beginning transcription:

promoter

The pattern or sequence in which a molecule of mRNA is deciphered by a ribosome is called the:

reading frame

Which of these is NOT a step in transcription:

replication

The cellular organelle responsible for protein synthesis is the

ribosome

Choose the condition below that does not involve a defect in an enzyme pathway:

sickle cell anemia

A mutation that is characterized by a change in the DNA sequence, but no change in the resulting protein sequence, is called a:

silent mutation

In gel electrophoresis of DNA, fragments move at different rates because they have different:

sizes

The condition of sickle cell anemia is due to

substitution of an amino acid

UV light is a mutagen that can cause:

thymine dimers

Replacing thymine nucleotide with a guanine is an example of:

tranversion