Genetics Chapter 12

Réussis tes devoirs et examens dès maintenant avec Quizwiz!

The first nucleotide that acts as a template for transcription is designated with the number ___. The nucleotides preceding this site are numbered in a(n) ___ direction, while those that come after it are numbered in a positive direction.

+1 negative

Important bacterial promoter sites

-35 site: 5' TTGACA 3' -10 site: 5' TATAAT 3'

Representaion of the conventional numbering system (order of nucleotides in a bacterial promoter, going from left to right)

-5 -4 -3 -2 -1 1 2 3 4 +5

Steps involoved in the formation of the open complex in eukaryotic transcription

1) TFIID binds to the TATA box 2) TFIIB nids to the TFIID 3) RNA polymerase II binds to the core promoter 4) TFIIH and TFIIE bind to the RNA polymerase II 5) TFIIH denatures the DNA at the TATA box

The TATA box of eukaryotic genes is usually located about ___ from the transcriptional start site

25 bp upstream

5' TTCCCATTTCGATGGGATACGATGG 3' 3' AAGGGTAAAGCTACCCTATGCTACC 5' What is the sequence of the trancribed mRNA, assuming transcription proceeds to the right?

5' UUCCCAUUUCGAUGGGAUACGAUGG 3'

RNA polymerase catalyzes the formation of a bond betweeen the ___ group of one nucleotide and the ___ group in the previous nucleotide.

5' phosphate; 3' hydroxyl

The mRNAs of different genes can be transcribed off either DNA strand of the double helix, but always synthesized in the _____ direction

5' to 3'

The rho-dependent mechanism of transcription termination requires what?

A helicase to separate the DNA-RNA complex The formation of a stem-loop structure

What is a core promoter?

A relatively short DNA sequence that is necessary for transcription to take place

What is a promoter?

A specific target sequence to which RNA polymerase binds.

The complementary rule used in transcription is similar to the ___ rule, except that ___ substitutes for thymine in the RNA.

AT/GC; uracil

What category of genes does RNA polymerase II transcribe?

All protein-encoding genes

What category of genes does RNA polymerase III transcribe?

All tRNA genes and the 5S rRNA gene

Which of the following is the very first step in the formation of the preinitiation complex in eukaryotic transcription?

Binding of TFIID to the TATA box

The central dogma of genetics

DNA --- mRNA --- polypeptide

Transcription factors are proteins that bind to

DNA sequences and facilitate transcription

Regulatory elements are short stretches of ___ involved in the regulation of ____.

DNA; transcription

T/F: A gene is a DNA segment that is used to make a polypeptide only

False

T/F: About 50% of all genes are protein-encoding genes, which are transcribed into mRNA

False

The central dogma of molecular biology was first enunciated by _____ _____ in 1958.

Francis Crick

In eukaryotic protein-encoding genes, three categories of proteins are required for basal transcription at the core promoter: RNA polymerase ____ , general transcription ____, and a complex called mediator.

II factor

Francois Jacob and Jacques Monod hypothesized the existence of what molecule?

Messenger RNA

The catalytic site of RNA polymerase contains ____ and attaches nucleotides covalently to the ___ end of the transcript

Mg2+; 3'

Which of the following are features of transcription in eukaryotes only?

Presence of three types of RNA polymerases Termination occurs accordiing to the allosteric or torpedo model Mediator controls the switch to the elongation phase

The TATAAT sequence in bacterial promoters is called the ___ box after its discoverer.

Pribnow

Transcription is the process of synthesizing

RNA from a DNA template

The enzyme that synthesizes RNA from a DNA template is called

RNA polymerase

Two mechanisms of transcription termination in E. coli?

Rho-dependent termination Rho-independent termination

In bacteria, the ribosome-binding site is also called the

Shine-Dalgarno sequence

The core promoter typically consists of a TATAAA sequence called the ____ box and the transcriptional start site.

TATA

The basal transcription apparatus consists of what?

TATA box plus transcriptional start site TFIID, TFIIB, TFIIF, TFIIE, and TFIIH RNA polymerase II

The consenses sequences are

TTGACA and TATAAT

The term closed complex refers to what?

The initial binding of the RNA pol holoenzyme to the promoter

What category of genes does RNA polymerase I transcribe?

The majority of rRNA genes

What marks the transition to the elongation stage of transcription in bacteria?

The release of the sigma factor from the RNA pol holoenzyme

Intrinsic termination is a term used for the type of transcription termination in

bacteria that does not require rho protein

The low level of transcription caused by the presence of the core promoter by itself is known as ____ transcription

basal

DNA sequences that exert their effects only over a particular gene are called ___-___ elements.

cis-acting

For protein-encoding genes, the nontemplate strand is also called the

coding strand

A triplet of nucleotides that corresponds to an amino acid is known as a(n)

codon

The open complex refers to the small bubble-like structure that occurs

during the elongation process of transcription

Regulatory elements that stimulate transcription are termed

enhancers

What are the two types of regulatory elements that influence the rate of transcription in eukaryotes?

enhancers and silencers

At the molecular level, ___ is the process by which a gene's information is used to produce a polypeptide or funciotional RNA molecule.

gene expression

For eukaryotic protein-encoding genes, the five proteins that are always needed for RNA polymerase II to initiate RNA synthesis are called ____ ____ factors.

general transcription

Molecular recognition between the RNA polymerase holoenzyme and the promoter is accomplished by a structure inside the sigma factor called a(n) ___-___-___ motif. This structure facilitates hydrogen bonding between amino acids in the protein and nucleotides in the DNA.

helix-turn-helix

The three stages of transcription are called

initiation, elongation and termination

The first product of a protein-encoding gene is a(n)

mRNA molecule

In eukaryotes, the interactions between RNA polymerase II and regulatory transcription factors that bind to enhancers and silencers are facilitated by a protein complex called

mediator

A structural gene encodes a(n)

polypeptide

The RNA polymerase holoenzyme is composed of several subunits including sigma factor whose primary role is to recognize the

promoter

Transcription is initiated by the binding of one or more transcription factors to the ____ region of a gene.

promoter

The sequence of a gene's DNA that is transcribed extends from the end of the ___ to the end of the ____.

promoter; terminator

In E. coli, the transcription termination of certin genes requires an RNA-binding protein called

rho

The formation of a stem-loop structure and the requirement for a helicase are characteristic of bacterial genes that undergo ___-_____ termination of transcription.

rho-dependent

A stem-loop structure followed by a stretch of U nucleotides in the 3'-end of a bacterial mRNA are characteristic of genes that undergo

rho-independent termination of transcription

In bacteria, a short sequence in the mRNA provides a location that recruits the machinery to start translation. This sequence is called the ____ site.

ribosome-binding

Regulatory elements that inhibit transcription are termed

silencers

The group of three nucleotides that signals the beginning of translation is called the

start codon

The strand of DNA that is transcribed into RNA is called the ___ strand, while the opposite strand of DNA is called the ___ strand.

template; nontemplate

An exonuclease binds to the 5' end of the RNA that is being transcribed and degrades it in the 5' to 3' direction. The exonuclease then catches up to RNA polymerase II and causes termination. This describes the ___ model of transcription termination in eukaryotes.

torpedo

A protein that can diffuse into the cell nucleus and bind to its appropriate regulatory DNA element is called a

trans-acting factor

The first DNA base used as a template for RNA synthesis is called the

transcriptional start site

The synthesis of a polypeptide molecule from an mRNA is called

translation


Ensembles d'études connexes

The Marketing Mix: The 4Ps of Marketing

View Set

PA Accident and Health Insurance Chapter tests

View Set

GEB4891 MIDTERM REVIEW CH. 1-6 (Chapter 3)

View Set

Fundamentals of nursing Ch. 1,11,12

View Set