human genetics final
transgenic organisms carry the transgene in A) every cell B) gametes only C) somatic cells only D) the cell in which it was originally introduced
A) every cell
Currently in the United States, approximately ______ couples have difficulty in conceiving or giving birth to children A) 1 in 6 B) 1 in 30 C) 1 in 100 D) 1 in 200
A) 1 in 6
The first mutation typically detected in FAP colon cancer is A) APC B) TGF C) p53 D) PRL-3
A) APC
A procedure that places an oocyte and sperm in a culture dish, allows a few cell divisions, and then places the resulting very early embryo in the oocyte donor's uterus is A) IVF B) intrauterine insemination C) surrogate insemination D) GIFT
A) IVF
in an allergic reaction, allergens bind ________ which release allergy mediators A) IgE antibodies on mast cell surfaces B) IgG antibodies on B cell surfaces C) allergy genes on chromosome 5 D) histamines on mast cell surfaces
A) IgE antibodies on mast cell surfaces
_____________ was the first "test tube baby" A) Louise Joy Brown B) Adam Nash C) J. Craig Venter D) Lauren Woodward
A) Louise Joy Brown
the two major types of lymphocytes are A) T and B cells B) A and B cells C) cytokines and antibodies D) RBCs and WBCs
A) T and B cells
the DNA sequence GATCTGATCTGATCTGATCT is a(n) A) VNTR B) STR C) RFLP D) SNP
A) VNTR
an antigen is A) a molecule that can elicit an immune response B) a nucleic acid only C) a protein or nucleic acid D) a protective protein that the immune system produces
A) a molecule that can elicit an immune response
A typhoon devastates a population on "island A" and only a few individuals survive. Several generations later, the replenished population suffers from several inherited disorders that are very rare in other groups. A genetic event that explains this is A) a population bottleneck B) genetic load C) a founder effect D) natural selection
A) a population bottleneck
The oncogene that causes Burkitt's lymphoma results from: A) translocation that moves a proto-oncogene next to an antibody gene B) point mutation in a proto-oncogene C) virus that inserts next to a proto-oncogene D) deleted of an anti-oncogene
A) a translocation that moves a proto-oncogene next to an antibody gene
the functions of antibodies include A) activating complement, inactivating pathogens, and clumping pathogens B) activating macrophages, stimulating mast cells, and increasing the WBC count C) creating a warm and swollen area near the site of infection, which harms the pathogens D) causing B cells to bing to T cells, forming clumps that are visible to the immune system
A) activating complement, inactivating pathogens, and clumping pathogens
the process in which bacteria with the ability to detoxify certain pollutants are released in a particular area known as A) bioremediation B) gene slicing C) gene expression profiling D) enzyme restriction
A) bioremediation
mitochondrial DNA (mtDNA) is helpful in obtaining a DNA profile for very degraded genetic material because A) cells have many mitochondria, and therefore several copies of mtDNA sequence B) mitochondria contain oxidative enzymes that protect the DNA C) mtDNA consists of a single helix, so it cannot be unwound D) it uses urail instead of thymine, which is a more stable nitrogenous base
A) cells have many mitochondria, and therefore several copies of mtDNA sequence
inflammation helps to fight infection by A) creating an environment in the body that is hostile to pathogens B) producing antibodies that kill viruses and bacteria C) limiting the number of phagocytes at the infection site D) producing collectins, cytokines, and RBC
A) creating an environment in the body that is hostile to pathogens
helper T cells secrete A) cytokines B) antibodies C) antigens D) immunoglobulins
A) cytokines
clines are created when A) emigrants remove alleles and immigrants introduce alleles B) immigrants remove alleles and emmigrants introduce alleles C) different genes mutate in different geographical regions D) men marry their neices as part of their culture
A) emigrants moving alleles and immigrants introduce alleles
natural selection has fueled the rise in MRSA infection by A) enabling people to use a greater variety of antibiotic drugs to fight the infection B) inactivating a greater variety of antibiotic drugs C) enabling certain bacterial variants to survive in the presence of many antibiotic drugs D) killing all bacteria exposed to antibiotics, including helpful ones
A) enabling certain bacterial variants to survive in the presence of many antibiotic drugs
Sheree is referred to a genetic counselor because a cystic fibrosis (CF) test done as a routine part of her prenatal care indicated that she is a carrier of the most common mutant allele. Sheree is stunned, because no one in her family has the disease. She is 26 years old. The genetic counselor would most likely A) explain autosomal recessive inheritance and suggest that sheree's husband be tested for CF B) explain autosomal dominant inheritance and suggest that sheree's husband be tested for CF C) explain autosomal dominant inheritance and suggest that sheree's parents be tested for CF D) advise Sheree to have amniocentesis to check the fetus for the CF genotype
A) explain autosomal recessive inheritance and suggest that sheree's husband be tested for CF
SIDS affect both A) humoral and cellular immunity B) white blood cells and red blood cells C) mast cells and macrophages D) helper B cells and cytotoxic B cells
A) humoral and cellular immuntiy
most of the effort involved in a recombinant DNA technology involves A) identifying and separating cells that contain the gene of interest B) finding a restriction enzyme to cut DNA from a donor cell C) identifying a cloning vector that can hold a gene D) finding uses for recombined DNA
A) identifying and separating cells that contain the gene of interest
The first drug produced using recombinant DNA technology was ____. A) insulin B) streptokinase C) tissue plasminogen activator D) erythropoietin
A) insulin
to create a transgenic organism, a researcher A) introduces foreign DNA into a fertilized ovum B) injects a gene of interest into a somatic cell C) injects a gene of interest into several somatic cells D) introduces foreign DNA into somatic cells in culture and transplants them
A) introduces foreign DNA into a fertilized ovum
a person who has a heterozygote G6PD deficiency is protected against A) malaria B) diphtheria C) tuberculosis D) sickle cell disease
A) malaria
In an endogamous community, A) many people marry people from within the community B) many people marry people from another country C) many people marry blood relatives D) many people have dominant genetic disorders
A) many people marry people from within the community.
A cancer's spread is called A) metastasis B) malignancy C) carcinogenesis D) microstasis
A) metastasis
_______ maintains deleterious alleles in a population. A) mutation B) migration C) random mating D) natural selection
A) mutation
_______ in the human population reduced the incidence and virulence of tuberculosis in the early twentieth century. A) natural selection B) mutation C) migration D) nonrandom mating
A) natural selection
the population of HIV variants in a person's body changes during the course of infection due to A) natural selection B) mutation C) migration D) genetic drift
A) natural selection
the requirements for patenting of an invention involving DNA in the US are that it should be A) new, useful, and not obvious to an expert in the field B) obvious, and no one should have previously been able to accomplish it C) helpful and affordable D) new, useful, and predicted by experts in the field
A) new, useful, and not obvious to expert in the field
one of the science-related concerns associated with the use of genetically modified foods is that A) over reliance on GM crops may lead to genetic uniformity B) GM foods are not natural C) genetic modification degrades the nutritional value of food crops D) buffer zones of GM crops halt the pollination of non-GM crops
A) over reliance on GM crops may lead to genetic uniformity
a naturally occurring, small, circle of DNA used as a vector to transmit DNA is a A) plasmid B) prion C) lipofectin D) ring chromosome
A) plasmid
Sporadic cancers result from A) recessive or dominant mutation in a somatic cell B) recssive or dominant germline mutation C) mutation in a sperm or oocyte D) exposure to a cancer causing virus
A) recessive or dominant mutation in a somatic cell.
Proteins isolated from bacteria and used in recombinant DNA technology to cut DNA at specific sequences are A) restriction enzymes B) bacteriophage enzymes C) plasmids D) methylating enzymes
A) restriction enzymes
researchers began using short tandem repeats (STRs) because A) shorter DNA molecules were more likely to persist in a violent situation B) each person has no more than one copy of each STR C) STRs are non uniformly disturbed D) restrictive enzymes cannot be used to cut short DNA molecules
A) shorter DNA molecules were more likely to persist in a violent situation
Diagnosis of hereditary hemochromatosis cannot be based on the results of a genetic test alone because A) the disease is incompletely penetrant B) genetic tests are untrustworthy C) the disease is genetically heterogeneic D) the disease is not inherited
A) the disease is incompletely penetrant
in the hardy weinberg equilibrium, 2pq refers to A) the proportion of heterozygotes in the population B) the number of homozygous dominant individuals in a population C) the most common phenotype in a population D) individuals who are homozygous recessive
A) the proportion of heterozygotes in the population
consaguineous marriages are between men and women who are A) from different cultures B) "blood" relatives C) carriers of a disorder D)from the same town
B) "blood" relatives
the first patent on a living organism was granted in A) 1790, when the US passed patent law B) 1873, for Louis Pasteur's use of yeast C) 1900, when Mendel's laws were rediscovered D) 1978, when modern biotechnology began with recombinant insulin
B) 1873, for Louis Pasteur's use of yeast
Infertility affects around one in _________ males A) 10 B) 25 C) 50 D) 100
B) 25
people who cannot become infected with HIV have A) extra T cells B) deletions in the genes encoding the CCR5 coreceptors C) a gene encoding a protein that attacks the virus D) anti-HIV antigens
B) Deletions in the genes encoding the CCR5 co-receptor
identifying combinations of ______ alleles is useful in tissue typing, establishing identity, and estimating disease risk A) HIV B) HLA C) antibody D) erythrocyte
B) HLA
The procedure in which fertilization takes place in a laboratory dish and the resulting zygote is placed in the woman's uterine tube is called A) embryo transfer B) ZIFT C) RhoGAM D) GIFT
B) ZIFT
VNTRs and STRs differ in that A) a VNTR repeat is shorter than an STR repeat B) a VNTR repeat is longer than an STR repeat C) a VNTR is a type of copy number variant and an STR is not D) an STR is a type of copy number variant and a VNTR is not
B) a VNTR repeat is longer than an STR repeat.
Which of the following is an assisted reproductive technology? A) producing human insulin in bacteria B) a couple conceive using sperm from a sperm bank C) a man donates part of his liver to his daughter, who has cystic fibrosis D) a woman has breast reduction surgery to alleviate back pain
B) a couple conceive using sperm from a sperm bank
surgery is an effective method of treating cancer when A) a primary tumor has spread through the blood stream B) a primary tumor is yet to invade healthy tissue C) all rapidly dividing cells are targeted by the surgery D) a patient has multiple tumors spread across his or her body
B) a primary tumor is yet to invade healthy tissue
Many alleles cause PKU. A unique mutation found only in Yemenite Jews is probably: A) more ancient than other PKU mutations B) a result of genetic drift C) due to a strong heterozygote advantage D) identical to the original allele
B) a result of genetic drift
Germline gene therapy would correct a genetic defect in A) an unaffected individual and his or her offspring B) an affected individual all of his or her descendants C) the parents of an affected individual D) the unaffected sibling of an affected individual
B) an affected individual and all of her or her descendants
a genetic counselor might discuss reproductive technologies with a couple who wish to A) adopt a child B) avoid passing on a disease-causing allele to a child C) avoid cancer in their children D) have a cild who will excel at a particular sport or have a particular talent
B) avoid passing on a disease-causing allele to a child
the connection between stem cells and cancer is that A) all stem cells are also cancer cells B) cells may become cancerous by expressing "stemness" genes C) stem cells rescue cells that have become cancerous D) both stem cells and cancer cells have inactivated telomerase
B) cells may become cancerous by expressing "stemness" genes
Caley, a 30-year-old nurse at Bethson Hospital, is diagnosed with a brain tumor. Caley's doctor presents her with multiple treatment options. Which of the following treatment options is most likely to damage Caley's healthy cells in addition to the cancer cells? A) surgery B) chemotherapy C) tyrosine kinase inhibitors D) liquid biopsy
B) chemotherapy
which of these are thought to have anti-cancer benefits? A) heterocyclic aromatic amines (HAs) B) cruciferous vegetables such as broccoli C) red meats D) baked potatoes E) fried food
B) cruciferous vegetables such as broccoli
control of human reproduction is to achieve a societal goal called A) biogenics B) eugenics C) biodiversity D) natural selection
B) eugenics
A woman who has a baby following embryo donation is her child's A) genetic mother only B) gestational mother only C) genetic and gestational mother D) gestational and surrogate mother
B) gestational mother only
the part of an antigen binding site on an antibody that binds antigen is the A) idioblast B) idiotype C) epitope D) intron
B) idiotype
________ places sperm into a woman's reproductive tract to fertilize an oocyte A) sperm washing B) intrauterine insemination C) GIFT D) IVF
B) intrauterine insemination
in normal differentiated somatic cells, telomerase A) adds material to the ends of chromosomes with each cell division B) is not expressed and telomere tips erode with each cell division C) removes telomere tips with each division D) repairs double strand breaks in DNA
B) is not expressed and telomere tips erode with each division
hardy-weinberg equilibrium is possible only if the population is A) small, with no migration out or in, and females outnumbering males B) large, with random mating and no migration, mutation, genetic drift, or natural selection C) small, with nonrandom mating and no migration, mutation, genetic drift, or artificial selection D) large, with nonrandom mating, mutation, genetic drift, and natural selection
B) large, with random mating and no migration, mutation, genetic drift, or natural selection
The logic behind sequential polar body analysis is based on A) darwin's theory of natural selection B) mendel's law of segregation C) mendel's law of independent assortment D) the rules of the genetic code
B) mendel's law of segregation
which of these affects allele frequencies the least? A) natural selection B) mutation C) migration D) genetic drift
B) mutation
In an allograft, the tissue donor is A) the recipient B) a non-relative C) a dizygotic twin D) a monozygotic twin
B) non-relative
Maxwell needs to take an anti-depressant drug. He enrolls in a clinical trial to detect genetic variants and gene expression profiles associated with response to various drugs. This approach to selecting a therapeutic drug is called A) pharmacogenetics B) pharmacogenomics C) pharmacology D) recombinant DNA technology
B) pharmacogenomics
a molecule that consists of a piece of DNA from one organism combined with the DNA from a member of another species is called A) rejected DNA B) recombinant DNA C) homogenic DNA D) bioengineered DNA
B) recombinant DNA
a vaccine protects by stimulating a person to produce a _______ response when a pathogen is encountered A) primary immune B) secondary immune C) tertiary immune D) anaphylactic
B) secondary immune
a gene expression microarray has A) an entire genome of DNA, cut into hundreds of pieces, attached to a small plastic or glass square B) short pieces of DNA of known sequence attached to a small plastic or glass square C) short pieces of RNA of known sequence attached to a small plastic or glass square D) amino acids attached to a small plastic or glass square
B) short pieces of DNA of known sequence attached to a small plastic or glass square
morpolinos are A) short DNA sequences found only in poulations that trace their roots to italy B) short systemic molecules similar to DNA that are complementary to splice-site mutations C) types of DNA microarrays used to study gene expression D) a type of recombinant bacteria
B) short systemic molecules similar to DNA that are complementary to splice-site mutations
antibody diversity is a consequence of A) the huge number of antibody genes B) shuffling of antibody genes into different combinations during B cell development C) different regulation of antibody gene expression under different circumstances D) the many types of viruses that exist in nature
B) shuffling of antibody genes into different combinations during B cell development
Nonheritable gene therapy is performed on _______ cells. A) germline B) somatic C) bacterial D) gametic
B) somatic
Cancer does not typically follow a Mendelian pattern of inheritance because it is usually caused by A) two gene variants, one dominant and one recessive, and no environmental input B) specific combinations of alleles and an environment factor C) specific combinations of an environmental factor and one dominant gene variant D) genes that cause death before birth
B) specific combinations of alleles and an environment factor
A test offered on the Web by a direct-to-consumer genetic testing company genotypes a gene for ability to taste bitter substances. This test is not regulated by the Clinical Laboratory Improvement Amendments (CLIA) because A) the test is not expensive B) the test provides information, not a diagnosis C) the test is offered in a state of the US not covered by these regulations D) the genetic information nondiscrimination act outlawed CLIA E) it is not accurate
B) the test provides information, not a diagnosis
DNA profiling was less useful in identifying remains from the 2004 tsunami than in criminal cases because A) the DNA after the tsunami was too wet to analyze B) the tsunami left few bodies with collectible DNA C) not enough repeats were profiled D) none of the victims were listed in the FBI's files
B) the tsunami left few bodies with collectible DNA
the probability of cancer development in the general population is one in ______ people A) two B) three C) four D) five
B) three
_______, a recombiant clotbusting drug, is used to limit damage to heart muscle by restoring blood flow A) insulin B) tissue plasminogen activator C) interleukin-2 D) glucocerebrosidase
B) tissue plasminogen activator
A cancer cell is injected into a healthy mouse. The mouse develops tumors. This experiment indicates that cancer is A) contact inhibited B) transplantable C) benign D) invasive
B) transplantable
which type of white blood cells secrete specific antibodies? A) T cell B) cytokine C) B cell D) erythrocyte
C) B cell
an ectopic pregnancy results when A) an oocyte that has not been fertilized implants in the uterus B) more than one oocyte is fertilized C) a fertilized ovum begins to develop in a blocked uterine tube D) a fertilized ovum begins to develop while to the cervix
C) a fertilized ovum begins to develop in a blocked uterine tube
A small group of islanders leave "island A" and travel to "island B." After several generations on island B, a researcher finds that a large percentage of the population is left-handed. Left-handedness is a relatively rare trait on island A. A genetic event that explains this is A) a population bottleneck B) genetic load C) a founder effect D) natural selection
C) a founder effect
a sharp cline may indicate A) a sudden increase in the mutation rate B) a population bottleneck C) a geographical obstacle, such as a mountain D) nonrandom mating
C) a geographical obstacle, such as a mountain.
Matthew has the inherited form of the eye cancer retinoblastoma. His disease is caused by A) a germinal mutation in one RB allele and no mutation in the other allele B) a somatic mutation in each copy of the RB gene in the same cell C) a germinal mutation in one RB allele and a somatic mutation in the other allele D) a somatic mutation in one of the RB genes in the same area of the retina of one eye
C) a germinal mutation in one RB allele and a somatic mutation in the other allele
Combined DNA Index System (CODIS) is A) a fifteen-base DNA sequence used in DNA profiling B) a type of mutation used in forensic applications C) a system for a crime laboratories to share DNA profiles D) a technology used to amplify DNA found at crime scenes
C) a system for crime laboratories to share DNA profiles
In gamete intrafallopian transfer GIFT, fertilization occurs in A) the uterus B) a culture dish C) a uterine tube D) a testis
C) a uterine tube
which of the following is a vector used to deliver genes in human gene therapy? A) parvovirus B) rabies virus C) adeno-associated virus D) E. coli
C) adeno-associated virus
newborn screening using mass spectrometry identifies certain single-gene disorders by detecting A) the causative mutation B) the wild type gene sequence C) an unusual metabolite or metabolic imbalance D) abnormal proteins in urine
C) an unusual metabolite or metabolic imbalance
Darwin bred pigeons to have particular traits. Today people breed dogs, cats, horses, and other animals for the same reason. These activities illustrate A) negative selection B) positive selection C) artificial selection D) veterinary selection
C) artificial selection
in wilms' tumor, A) heart cells divide as frequently as do cells in the skin B) being exposed to cigarette smoke int he uterus causes lung cancer in infants C) cells in a child's kidney divide as frequently as if they were still in a fetus D) deletion of the retinoblastoma gene causes an eye tumor
C) cells in a child's kidney divide as frequently as if they were still in a fetus
balanced polymorphism explains why carriers of cystic fibrosis are relatively resistant to A) malaria B) tuberculosis C) diarrheal illness D) pneumonia
C) diarrheal illness
cancer cells A) divide uncontrollably and then die B) are particularly sensitive to extracellular signals C) divide uncontrollably and are immortal D) are impossible to grow in culture
C) divide uncontrollably and are immortal
Excess tissue growing in the uterine lining is called A) hemorrhoids B) pelvic inflammatory disease C) endometriosis D) an ectopic pregnancy
C) endometriosis
a ______ mutation is one that is present in every cell of an individual, including gametes A) somatic B) sporadic C) germline D) benign
C) germline
the genes of the human leukocyte antigens (HLA) system encode cell surface A) phospholipids B) glycolipids C) glycoproteins D) histamines
C) glycoproteins
A more recently developed cancer treatment is A) stimulating telomerase activity B) stimulating cells to return to a stem-like state of specialization C) inhibiting kinases based on genetic information D) replacing the nuclei in cancer cells
C) inhibiting kinases based on genetic information
the difference between innate immunity and adaptive immunity is that A) adaptive immunity attacks pathogens; innate immunity attacks microbes B) innate immunity targets cancers and transplants; adaptive immunity targets viruses and bacteria C) innate immunity is fast and generalized; adaptive immunity is slow and specific D) adaptive immunity releases cytokines; innate immunity produces antibodies
C) innate immunity is fast and generalized; adaptive immunity is slow and specific
bacteriophages can be used as vectors in recombinant DNA experiments because they A) are small and made of double-stranded DNA B) are circular and easily imported into bacteria or yeast C) insert their genetic material into bacteria D) are resistant to protective restriction enzymes
C) insert their genetic material into bacteria
A man who is paralyzed from a spinal cord injury might become a father using A) IVF B) a surrogate mother C) intracytoplasmic sperm injection D) intrauterine insemination
C) intracytoplasmic sperm injection
tiny fat bubbles used to deliver genes are A) phospholipids B) cholesterols C) liposomes D) plasmids
C) liposomes
The prevalence of a Y chromosome with the same sequences as Genghis Khan illustrates A) mutation B) natural selection C) nonrandom mating D) gene therapy
C) nonrandom mating
the fact that nearly everyone on the island of sardinia has the same X chromosome sequence indicates that the population has experienced A) mutation B) natural selection C) nonrandom mating D) consanguinity
C) nonrandom mating
enzyme replacement therapy treats A) the genotype B) the genome C) the phenotype D) the genetic code
C) phenotype
in a population in hardy-weinberg equilibrium, the frequency of recessive alleles will _______ over time A) increase B) decrease C) remain the same D) increase and then decrease
C) remain the same
ADA deficiency results in A) hereditary emphysema B) neurotransmitter imbalances C) severe combined immune deficiency D) chronic myelogenous leukemia
C) severe combined immune deficiency
A woman is given Rhogam to protect future fetuses from hemolytic disease of the fetus and newborn if A) she and the fetus are born Rh- B) she is Rh+ and the fetus is Rh- C) she is Rh- and the father is Rh+ D) she is Rh+ and the father is Rh-
C) she is Rh- and the father is Rh+
who invented DNA profiling? A) Godfrey Hardy B) William Weinberg C) Sir Alec Jeffreys D) Linus Pauling
C) sir alec jeffreys
a patient received bone marrow modified by an adeno-associated virus (AAV) carrying a human gene that encodes an enzyme her body could not make. this is an example of A) protein therapy B) germline gene therapy C) somatic gene therapy D) retroviral gene therapy
C) somatic gene therapy
an example of an autoimmune disorder is A) hay fever B) severe combined immune deficiency C) systemic lupus erythematosus D) colon cancer
C) systemic lupus erythematosus
one of the most important types of information that a patient can bring to an initial appointment with a genetic counselor is A) her immunization records from childhood B) results of a comprehensive lipid profile C) the family health history, extending to second degree relatives D) a list of the occupations of every family member
C) the family health history, extending to second degree relatives
in order to identify (for rule out identify) from a DNA sample that is a mixture, an investigator should know A) how long the DNA has been exposed to the environemnt B) how the person perished C) the population groups to which the person of interest belongs or belonged D) the genome sequence of the suspect or missing person
C) the population groups to which the person of interest belongs or belonged
a limitation of transgenesis is that A) it only works on very short genes B) it only works on vertebrates C) the transgene can insert many copies of itself in the genome D) the transgene could disappear before it inserts in the genome
C) the transgene can insert many copies of itself in the genome
a multicellular organism that carries DNA from other species is termed A) transverted B) translocated C) transgenic D) transformed
C) transgenic
tay-sachs disease affects 1 in 3,600 Ashkenazim births. the value of q2 is A) 0.1 B) 0.05 C) .017 D) .0003
D) .0003
if one person in 50 is a carrier of an autosomal recessive disorder in a population, the chance that an unrelated man and woman are both carriers are A) 1/50 B) 1/100 C) 1/1000 D) 1/2500
D) 1/2500
human leukocyte antigens (HLA) genes account for about _______ percent of the genetic influence on immunity A) 20 B) 30 C) 40 D) 50
D) 50
Which of the following is incorrectly paired? A) intrauterine insemination; donated sperm is placed in the woman's reproductive tract B) in vitro fertilization, fertilization occurs in a laboratory dish C) ICSI; DNA from an immobile sperm is injected into an oocyte D) GIFT; fertilization occurs in a laboratory
D) GIFT; fertilization occurs in a laboratory
the species naturally affected by Leber's congenital amaurosis II that led to development of gene therapy is A) mice B) pea plants C) a breed of horse D) a breed of dog
D) a breed of dog
Using gene therapy to correct ornithine transcarbamylase deficiency (OTC) would prevent buildup of _________ in the blood. A) cholesterol B) RNA C) adenosine deaminase D) ammonia
D) ammonia
all of the following are cytokines expect A) interleukins B) interferons C) tumor necrosis factor D) collectins
D) collectins
the term used to describe the fact that cancer cells have lost the specializations of the cells from which they descend is A) heritable B) angiogenic C) oncogenic D) dedifferentiated
D) dedifferentiated
newborn screening reveals that newborn Jessica has inherited PKU. her parents are distraught by the diagnosis, but a nutritionist explains that Jessica can be treated right away. the treatment for PKU is A) nonheritable gene therapy B) heritable gene therapy C) exchange of her blood supply D) dietary
D) dietary
mutations that enable cancer cells to grow and divide faster than other normal cells are known as _______ mutations A) benign B) gateway C) passenger D) driver
D) driver
Preimplantation Genetic Diagnosis (PGD), screens ____ for genetic disorders A) oocytes B) spermatocytes C) polar bodies D) early embryos
D) early embryos
A woman who is infertile because she lacks ovaries would benefit most from A) intrauterine insemination B) GIFT C) ZIFT D) embryo donation
D) embryo donation
which of the following might a genetic counselor do as part of her job? A) order prenatal tests, interpret the results, and then deliver the baby B) order a lipid profile, interpret results, then prescribe a statin drug if cholesterol levels are unhealthy C) require a patient to take a test for hereditary colon cancer D) explain the inheritance of a specific disorder in a family, evaluate risks for relatives, and advise on genetic testing
D) explain the inheritance of a specific disorder in a family, evaluate risks for relatives, and advise on genetic testing
A suspect's guilt seems highly likely when a very rare combination of markers is A) found in the population the suspect comes from and at the crime scene B) not found in the population the suspect comes from, but present at the crime scene C) found in the suspect's DNA but not at the crime scene or in the population the suspect comes from D) found in the population the suspect comes from, in the suspects DNA, and at the crime scene
D) found in the population the suspect comes from, in the suspects DNA, and at the crime scene
when all individuals in a population with a certain illness have the same mutation, which present day patients inherited from shared ancestors, it is an evidence of A) random mating B) migration C) population bottlenecks D) founder effect
D) founder effect
a nasal spray for cystic fibrosis patients, which contains adenovirus particles carrying a normal human CFTR gene, is an example of A) ex vivo gene therpy B) in situ gene therapy C) in vitro gene therapy D) in vivo gene therapy
D) in vivo gene therapy
in human populations, hardy-weinberg equilibrium is seen A) in small, isolated communities B) in populations with many immigrants C) in communities founded by a small number of people D) infrequently and in large communities with random mating
D) infrequently and in large communities with random mating
which of the following would provide the longest lasting treatment for Leber's congenital amaurosis II? A) replacing an enzyme that restores the function of T and B cells B) substrate reduction therapy and pharmacological chaperone therpay C) injecting AAV carrying OTC into T and B cells D) injecting adeno-associated virus carrying a wild type version of the RPE65 gene into affected cells of the retina
D) injecting adeno-associated virus carrying a wild type version of the RPE65 gene into affected cells of the retina
gene flow is the A) migration of individuals between populations B) transfer of genes within a population C) variation of alleles within a population D) movement of alleles between populations
D) movement of alleles between populations
Nondirective genetic counseling A) does not accept health insurance B) does not deal with disorders carried on the sex chromosomes C) considers diseases caused by genes that are located throughout the genome D) offers options but not opinions
D) offers options but not opinions.
Which of the following contributes to subfertility? A) regular menstrual cycles B) high sperm counts C) being under 30 years of age D) oligospermia
D) oligospermia
___________ uses a blastomere biopsy to obtain a cell to test for genetic and chromosomal abnormalities A) cytoplasmic donation B) intrauterine insemination C) Oocyte donation D) preimplantation genetic diagnosis
D) preimplantation genetic diagnosis
Frequency of an X-linked recessive allele in males equals A) p2 B) 2pq C) q2 D) q
D) q
a gatekeeper gene A) regulates mitosis and meiosis B) regulates its own mutation rate C) can destabilize the genome when mutant D) regulates apoptosis and mitosis
D) regulates apoptosis and mitosis.
the type of RNA that carries out RNA interference is A) tRNA B) mRNA C) rRNA D) siRNA
D) siRNA
patent law as it pertains to biotechnology has had to change in recent years in response to A) the changeable nature of the genetic code B) the number of people asking for genetic tests C) the increasing number of human genes D) the greatly accelerated speed of DNA sequencing
D) the greatly accelerated speed of DNA sequencing
Lisa and Jack Nash obtained compatible stem cells that cured their young daughter Molly's Fanconi anemia by A) allowing Molly to undergo gene therapy on the affected stem cells B) allowing Molly to undergo gene therapy on her germ cells C) using umbilical cord stem cells from an unrelated donor D) using umbilical cord stem cells from a younger sibling, who was conceived and selected for this purpose
D) using umbilical cord stem cells from a younger sibling, who was conceived and selected for this purpose
a surrogate mother can help couples have a child when the woman does not have a functional A) uterine tube B) vagina C) cervix D) uterus
D) uterus