LS 7C

Aneuploidy can result due to which type of mutation(s). frame shift mutation duplication base insertion translocation nonsense mutation base substitution deletion

duplication, translocation, deletion

The most common oral contraceptives are a combination of an estrogen and a progesterone. Which phase of the uterine cycle is mimicked by taking an oral contraceptive? A. Early to mid-follicular phase B.Late follicular phase C.Early to mid-luteal phase D.Late luteal phase

early to mid-luteal phase

Which of the following insect hormones acts on the body tissues to stimulate molting and metamorphosis? brain peptide All of these choices are correct. juvenile hormone ecdysone PTTH

ecdysone

Myosin is a motor protein that associates with: microfilaments. vimentin. microtubules. intermediate filaments.

microfilaments

When an individual has an energy surplus, he or she stores the extra energy as: lipids. carbohydrates. proteins. nucleic acids. None of the answer options is correct.

lipids

Growth factors, such as platelet-derived growth factor, function in _____ signaling. autocrine endocrine paracrine contact-dependent

paracrine

Signals can travel short or long distances to reach their receptors. Classify the signal below according to the distance between the signaling and responding cell. A water-soluble growth factor secreted by another cell is __________. (2 answers) A. Paracrine B. Autocrine C. Contact-dependent D. Endocrine

paracrine, autocrine

The signal to "rest and digest" comes from the _____ system. peripheral sympathetic somatic parasympathetic

parasympathetic

Assuming that transcription and translation both proceed from left to right, which is the correct orientation of the DNA template, the RNA transcript, and the protein product? DNA template 5'- ......... -3' RNA transcript 5'- ......... -3' Protein product H2N- ....... -COOH DNA template 3'- ......... -5' RNA transcript 5'- ......... -3' Protein product HOOC- ....... ..-NH2 DNA template 5'- ......... -3' RNA transcript 3'- ......... -5' Protein product HOOC- ....... ..-NH2 DNA template 3'- ......... -5' RNA transcript 5'- ......... -3' Protein product H2N- ....... -COOH

DNA template 3'- ......... -5' RNA transcript 5'- ......... -3' Protein product H2N- ....... -COOH

Adrenaline stimulates an increase in heart rate by binding to: A. regulatory regions in genes that code for muscle cell proteins. B. G-protein coupled receptors on the surface of cardiac muscle cells. C. nuclear transport proteins that allow adrenaline to be taken into the nucleus to act as a transcription factor. D. G-proteins on the cytosolic face of the plasma membrane. E. adenylyl cyclase.

G-protein coupled receptors on the surface of cardiac muscle cells

Termination of the adrenaline signal begins when: A. GDP bound to the G-protein is exchanged for GTP. B. the molecules of adrenaline are transported into the cell and degraded. C. ATP gets converted into cyclic AMP. D. GTP bound to the G-protein alpha subunit is hydrolyzed to GDP and Pi. E. G-protein coupled receptors are removed from the cell membrane.

GTP bound to the G-protein alpha subunit is hydrolyzed to GDP and Pi

When a G protein-coupled receptor binds a signal molecule, it activates a G protein. The active G protein is bound to a molecule of _______BLANK, and in its active state can _________BLANK. Question 4 choices Choice A., GDP; inactivate another target protein Choice B., GTP; inactivate another target protein Choice C., GDP; activate another target protein Choice D., GTP; activate another target protein

GTP; activate another target protein

When do the atria repolarize? A. P wave B. PR segment C. QRS complex D. ST segment E. T wave

QRS complex

When do the ventricles depolarize? A. P wave B. PR segment C. QRS complex D. ST segment E. T wave

QRS complex

In the diagram below, which hormone(s) (if any) are released by neurons? A. TRH B. TSH C. T3/T4 D. All of the above E. None of the above

TRH

Which of the four groups did Dr. Bello collect the most samples from? A. Yanomami B. Guahibo C. Malawi D. US E. Can't conclude from the data.

US

The three DNA fragments below are about to be sequenced using the primer 5'-CCGGG-3'. What is the 4th nucleotide in the sequencing read for first DNA fragment below? 5'-AATGGCGTCCTGATCCCGG-3' A. A B. T C. C D. G

a

In the results for percent isometric force graphed versus percent muscle length, A. percent isometric force is the dependent variable. B. percent muscle length is the independent variable. C. percent isometric force is the independent variable. D. percent muscle length is the dependent variable. E. a regression line would be useful to describe the change in percent maximum isometric force as a function of changes in percent muscle length. F. A and B G. C and D

a and b

In order for a tumor cell to metastasize, which of the following would you expect to happen? a decrease in both cadherin and integrin expression an increase in both cadherin and integrin expression an increase of cadherin expression and a decrease in integrin expression a decrease in cadherin expression and an increase of integrin expression

a decrease in cadherin expression and an increase of integrin expression

How is DNA sequencing accomplished? Question 1 choices Choice A., A genomic sequence is broken into small fragments of a few hundred base pairs. Choice B., Whole chromosomes are sequenced in one piece. Choice C., Each gene is separated from the others and individually sequenced. Choice D., The DNA is converted to RNA.

a genomic sequence is broken into small fragments of a few hundred base pairs

Signal transduction results in: production of more signal molecules. termination of the signal. a response by the cell. a change in the conformation of the receptor protein.

a response by the cell

What senses do the three semicircular canals in the mammalian inner ear provide? a sense of orientation to the source of sound a sense of sound pitch and amplitude a sense of angular motion and balance a sense of gravity and body orientation

a sense of angular motion and balance

Tropic hormones: suppress the immune system. act on other endocrine organs. suppress the appetite. are released from the thyroid gland. regulate the metabolic state of the body.

act on other endocrine organs

Skeletal muscle appears striated with light and dark regions. Which of the following is found in the dark regions? Question 5 choices Choice A., actin and myosin Choice B., myosin and the Z disc Choice C., actin and the Z disc Choice D., thick filaments, but not the thin filaments

actin and myosin

If a skeletal muscle is no longer able to make enough ATP, then: A) the muscle will be unable to shorten. B) there will be low levels of acetylcholine at the motor endplate. C) actin and myosin in the sarcomeres will remain bound. D) actin and myosin in the sarcomeres are in the unbound state.

actin and myosin in the sarcomeres will remain bound

Which of the following steps does not result in an amplification of the signal information? Question 2 choices Choice A., activation of G protein by activated receptor Choice B., production of cyclic AMP by adenylyl cyclase Choice C., activation of adenylyl cyclase by active G protein Choice D., phosphorylation of target proteins by protein kinase A

activation of adenylyl cyclase by active G protein

Aldosterone, in the figure below, is a hormone secreted by the adrenal cortex, and insulin is a peptide secreted by the pancreas. When aldosterone contacts a target cell, it binds to an intracellular receptor and migrates to the nucleus; insulin binds to extracellular receptors on the plasma membrane. What is the MOST likely reason for this difference? /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_38/38_43.jpg Insulin is too large to interact chemically with DNA. Aldosterone is too small to bind extracellular receptors on the plasma membrane. Aldosterone is hydrophilic and, therefore, must enter the aqueous environment of the cytoplasm to have an effect. Aldosterone is lipid-soluble and, therefore, easily crosses the phospholipid bilayer of the plasma membrane.

aldosterone is lipid-soluble and, therefore, easily crosses the phospholipid bilayer of the plasma membrane

Which of the following properties of transposable elements allows them to contribute to the C-value paradox? All of these choices are correct. Their copy number can increase from one generation to the next. Their replication is controlled by genes found on the transposable element itself. Copies of transposable elements can appear on multiple chromosomes.

all of these choices are correct

Which of the following types of cellular activities can be a response to cell signaling? Enzyme activities are changed. Cell division is triggered. Cell signals are released to communicate with other cells. All of these choices are correct. Gene expression patterns are changed.

all of these choices are correct

Microbiome refers to: All the microorganisms that inhabit a location. All the microorganisms that inhabit a location as well as all their functional genes and metabolites. An organism and all its symbiotic microorganisms. All the functional genes within microorganisms that inhabit a location.

all the microorganisms that inhabit a location as well as all their functional genes and metabolites

An intron is: part of an RNA transcript that is not present in the DNA template. part of an intact, mature mRNA that leaves the nucleus. a type of transfer RNA. an RNA sequence that is removed during the processing of an RNA molecule in the nucleus. a polypeptide that is clipped out of a larger protein post-translationally.

an RNA sequence that is removed during the processing of an RNA molecule in the nucleus

What stimulates a skeletal muscle cell to contract? hormones auto-depolarizing cells in the membrane of muscle cells an impulse from a motor neuron an impulse from a sensory neuron

an impulse from a motor neuron

Which of the following could lead to a prolonged increase in heart rate, even in the absence of an external signal? Choose all that apply. a. An inability of a G-protein to hydrolyze GTP b. An inability to inactivate protein kinase A c. An inability of G-protein coupled receptors to bind adrenaline d. An inability of cyclic AMP to activate protein kinase A e. An inability to convert ATP into cyclic AMP

an inability of a G-protein to hydrolyze GTP, an inability to inactivate protein kinase A

The interneuron in the spinal cord triggers which of the following? Question 3 choices Choice A., a stimulatory stimulus that prevents contraction of the knee flexor muscles Choice B., an inhibitory stimulus that prevents contraction of the knee flexor muscles Choice C., an inhibitory stimulus that prevents contraction of the knee extensor muscles Choice D., a stimulatory stimulus that prevents contraction of the knee extensor muscles

an inhibitory stimulus that prevents contraction of the knee flexor muscles

The experimental design used to record the resting membrane potential and action potential of the squid axon involved: A. the use of a recording microelectrode placed adjacent to the outside of the cell referenced to a second electrode. B. the use of a recording microelectrode placed inside the cell referenced to a second electrode located outside the cell. C. the use of a separate stimulating electrode to depolarize the nerve cell to its threshold potential. D. the use of a separate stimulating electrode to hyperpolarize the nerve cell to its threshold potential. E. B and C F. A and D

b and c

Muscle fibers generate maximum force: when pulled to long lengths before contraction. when contracting at short lengths. at intermediate lengths. when the myosin filaments contact the Z discs. when the overlap between actin and myosin is minimal.

at intermediate lengths

Diffusion of materials between the blood and body tissues occurs at which of the following blood vessels? arteries arterioles veins capillaries venules

capillaries

You add a toxin that prevents the Na+/K+ pump from hydrolyzing ATP. Absorption of which nutrient(s) will be affected? A. Glucose only B. Amino acids only C. Both glucose and amino acids D. Neither will be affected

both glucose and amino acids

Which region is LARGEST in a mammalian brain? brainstem hippocampus cerebral cortex cerebellum

cerebral cortex

Memory and learning take place in which area of the brain? cerebrum and hippocampus hypothalamus pons and medulla cerebellum

cerebrum and hippocampus

A newly developed drug works by blocking thyroid hormone receptors throughout the body. Which of the following would be expected to occur in a patient who is taking this drug? increased uptake of glucose by body cells changes in metabolism decreased resorption of bone inability to release cortisol production of more dilute urine

changes in metabolism

Which of the following statements is FALSE? Ventilation increases the concentration of oxygen in the air on the outside of the respiratory surface. Circulation requires a pump to generate pressure to drive flow, whereas ventilation does not. The same amount of oxygen enters the blood through diffusion as is transported by circulation. Larger, more complex animals rely on bulk flow and diffusion to deliver oxygen to their cells, whereas some smaller, simpler animals rely on diffusion alone. Oxygen and carbon dioxide both move across the respiratory surface by diffusion.

circulation requires a pump to generate pressure to drive flow, whereas ventilation does not

In DNA editing by means of CRISPR, the function of the CRISPR-associated protein 9 (Cas9) is to: (Select all that apply.) cleave target DNA. bind sgRNA. translate sgRNA. bind target DNA. transcribe CRISPR DNA.

cleave target DNA, bind sgRNA, bind target DNA

Shown below is part of a coding region within the fist exon of a gene. /brainhoney/Resource/11009259,8,0,4E,3/Assets/LS%207C/CRISPR%20cut.PNG Where will Cas9 cause a double stranded DNA break? D B C A

d

What type of diversity is being evaluated? alpha beta both neither

alpha

A climber is scaling Mt. Everest. As the elevation increases, the average amount of oxygen bound to the hemoglobin in their red blood cells ________. A. Increases B. Decreases C. Does not change

decreases

Increased ADH secretion__________ urine output A. Increases B. Decreases C. Has no effect on

decreases

A chromosomal mutation in which a segment is missing is called a deletion. True False

true

Which of the following is referred to as the power stroke? Question 4 choices Choice A., the sliding of bundles of myosin along actin filaments Choice B., a conformational change in myosin Choice C., the hydrolysis by myosin of ATD to ADP Choice D., the hydrolysis by actin of ATP to ADP

a conformational change in myosin

Which lettered item in the figure above represents a tubulin dimer? Question 3 choices Choice A., oval a Choice B., oval b Choice C., oval c Choice D., oval d Choice E., oval e

oval e

Which group has the most bacterial species diversity? A. Yanomami B. Guahibo C. Malawi D. US

yanomami

Which of these stem cells is the least specialized? A B C D

a

Crispr could ... repair a mutation causing a deadly disease in a human embryo. a. Already happened b. Hypothetically possible. c. Pure fiction

already happened

Black widow spider venom causes explosive release of ACh. At the site of a black widow spider bite, muscle membrane potential will __________. A. Become more positive B. Become more negative C. Not change

become more positive

Cells differentiate through: growth. the cell cycle. timing. gene regulation.

gene regulation

The stability of sample 3's microbiome is ________ sample 5's microbiome. Sample X Sample Y A. Greater than B. Less than C. Similar to

greater than

If a hair cell bends toward the kinocilium... A. It generates action potentials B. It releases neurotransmitters C. Both A and B D. Neither A nor B

it releases neurotransmitters

At high altitudes, the partial pressure of oxygen is ______ the partial pressure of oxygen at sea level. A. Higher than B. Lower than C. The same as

lower than

Which lettered item in the figure above is the motor protein? Question 5 choices Choice A., oval a Choice B., oval b Choice C., oval c Choice D., oval d Choice E., oval e

oval c

If a membrane were freely permeable to all charged molecules, then the resting membrane potential would be _________. A. Positive B. Negative C. Zero

zero

A competitive track star at UCLA is training for an upcoming meet. In the first 50 m of the 800 m race, which muscle fiber type is the runner using? A. Fast-twitch muscle fibers B. Slow-twitch muscle fibers

fast-twitch muscle fibers

Dynamic instability is a: feature of microtubules and microfilaments. universal feature of the cytoskeleton. feature of microtubules. feature of microfilaments. feature of intermediate filaments.

feature of microtubules

Suppose you sequence the genome of the healthy cells and the genome of the HeLa cells and map both to the reference genome. There will be _____ sequencing reads that map to chromosome 15 for the healthy cells compared to the HeLa cells. Healthy Cells HeLa Cells (Cervical Cancer) 9/9/2019 A. More B. Fewer C. About the same number of

fewer

Which of the following processes occur within Bowman's capsule? filtration filtration and selective reabsorption selective reabsorption secretion filtration, selective reabsorption, and secretion

filtration

Filtration is usually the first step in the excretory process. What types of filtration typically occur? Select all that apply. Filtration removes water from the blood. Filtration removes substances dissolved in the blood. Filtration removes blood proteins. Filtration removes blood cells. Filtration removes CO2 from the blood.

filtration removes water from the blood, filtration removes substances dissolved in the blood

When skeletal muscles contract such that bone segments move closer together, this action is known as: lengthening contraction extension. tetanus. flexion.

flexion

Patients with Type 2 Diabetes produce insulin, but target cells do not respond to insulin and blood glucose levels become elevated. Which component of the feedback system is broken in these patients? A. Stimulus B. Sensor C. Effector D. Response

effector

Among the possible errors listed below, which would prevent an mRNA with the correct sequence from being translated appropriately? The poly(A) tail was not formed. The DNA sequence was incorrect. The 5′ cap was not added. Either the 5′ cap was not added or the poly(A) tail was not formed. None of the other answer options is correct.

either the 5' cap was not added or the poly(A) tail was not formed

One of the effects of the hormone secretin is to stimulate the release of bicarbonate ions into the duodenum, which neutralizes the acid that enters the duodenum with food from the stomach. One consequence of neutralizing the pH in the intestine is that: enzymes that catalyze the hydrolysis of carbohydrates are denatured. carbohydrates are not as easily broken down in this neutral environment. the enzymatically catalyzed hydrolysis of carbohydrate that began in the stomach is halted in the duodenum. enzymes that catalyze the hydrolysis of carbohydrates are active.

enzymes that catalyze the hydrolysis of carbohydrates are active

In messenger RNA, the protein-coding sequence is present in: introns and the poly(A) sequence. exons and the poly(A) sequence. exons. introns.

eons

All cells of the body contain Na+/K+ pumps in their cell membranes. The Na+/K+ pumps function to: Question 1 choices Choice A., maintain equal concentrations of Na+ inside and outside of the cell. Choice B., maintain equal concentrations of K+ inside and outside of the cell. Choice C., establish concentration gradients—higher Na+ outside and higher K+ inside the cell. Choice D., transport glucose from the lumen of the intestine into the epithelial cells.

establish concentration gradients- higher Na+ outside and higher K+ inside the cell

You turn on a light so you can get a glass of water. At the moment the light turns ON, your bipolar cells will ______ retinal ganglion cells. A. Excite B. Inhibit C. None of the above. (Bipolar cells do not communicate to retinal ganglion cells )

excite

The release of neurotransmitter from the presynaptic cell is an example of: endocytosis. transcytosis. exocytosis. phagocytosis.

exocytosis

Because there are three different possible reading frames in a messenger RNA molecule, most mRNAs can be translated in a cell into three different proteins. True False

false

Before 10:00am, the ambient temperature above the rocks is the highest of the day. Answer A for True or B for False

false

CRISPR/Cas9 cannot be used to introduce mutations into specific organs such as the lungs or the brain. False True

false

Mark A for True or B for False: This tumor has more rearrangements in chromosome 10 than in chromosome 20

false

People with recurrent CDI have more resilient microbiomes true false

false

When the volume of blood passing through the kidney increases, renin production by the kidney will most likely _________. A. Increase B. Decrease C. Stay the same

decrease

Which one of the following properly groups a cell junction with a cytoskeletal element and a cell adhesion molecule? hemidesmosome, microfilament, cadherin adherens junction, microfilament, integrin hemidesmosome, intermediate filament, cadherin desmosome, intermediate filament, cadherin

desmosome, intermediate filament, cadherin

What kind(s) of cell-to-cell junctions would be most useful for anchoring these cells together to form a strong tissue? A. Gap junction B. Tight junction C. Desmosomes D. Any of the above E. None of the above

desmosomes

The diagram and graph in Question 4 actually depict the adaptation of a neuron in the somatosensory cortex to a constant touch stimulus. Knowing this, which of the following diagrams identifies the moment when the cat's skin was first touched, and when pressure was removed from this area of skin? Diagram 1 Diagram 2 Diagram 3 Diagram 4 Diagram 5 A. Diagram 1 B. Diagram 2 C. Diagram 3 D. Diagram 4 E. Diagram 5

diagram 3

Osmoregulators have _____ internal solute concentrations compared to their external environment. different always lower always higher the same

different

Transgenic models can be generated using CRISPR/Cas9 to introduce cancer-related mutations into cells within an organism. Which of the following approaches can produce a transgenic model? (Mark all that apply) Lipid nanoparticles Direct nucleic acid (plasmid) injection Knockin a wildtype genetic locus Patient derived xenografts (PDFs) Viral delivery

direct nucleic acid (plasmid) injection, patient derived xenografts (PDFs)

Compare the results for thyroid tumors and glioblastoma tumors. Which tumors have more mutations on average? 9/9/2019 Median Deciles A. Thyroid B. Glioblastoma C. They are roughly the same

glioblastoma

ompare the results for thyroid tumors and glioblastoma tumors. Which tumors vary more in mutation number? 9/9/2019 Median Deciles A. Thyroid B. Glioblastoma C. They are roughly the same

glioblastoma

At the beginning of ventricular diastole, blood pressure in atria is _______ blood pressure in the ventricles A. Higher than B. Lower than C. The same as D. No way to know!

higher than

One of the hormones not mentioned in the text is GIP (glucose-dependent insulin trophic peptide), which stimulates the secretion of insulin. It is secreted by cells of the duodenum in response to the presence of glucose. Its secretion and action on insulin production is an example of a: homeostatic positive feedback mechanism amplifying the response to glucose ingestion. homeostatic negative feedback mechanism changing the set point. homeostatic negative feedback mechanism keeping a system near a set point.

homeostatic negative feedback mechanism keeping a system near a set point

Gut microbial food sources do not include: Host produced intestinal mucosal complex sugars Bacterial produced simple sugars Host epithelial cell components Host consumed complex sugars

host epithelial cell components

Choose the correct statement that describes how humans gain a gut microbiota: Humans gain a gut microbiota from the birthing process. Humans gain a gut microbiota from the first foods they eat. Bacteria can but usually don't colonize the human gut during birth. Bacteria colonize the human gut while they are in the womb

humans gain a gut microbiota from the birthing process

Which of the following best describes what is happening during Region 3 of the action potential? A. Hyperpolarization due to cations leaving the cell B. Depolarization due to cations leaving the cell C. Hyperpolarization due to cations entering the cell D. Depolarization due to cations entering the cell

hyperpolarization due to cations leaving the cell

A condition called "hypoxia" occurs when not enough oxygen is being delivered to the body. When brainstem senses hypoxic conditions, the rate of ventilation will ... A. Increase B. Decrease C. Not change

increase

If the body senses that calcium levels are too high, the amount of calcitonin secreted by the thyroid will most likely _________. A. Increase B. Decrease C. Stay the same

increase

Low levels of dietary iodine would cause the levels of TRH released from the hypothalamus to ________. A. Increase B. Decrease C. Not change

increase

Which of the following is an example of the effector's role in maintaining homeostasis? A. decrease in body temperature on a cold day B. increased sweating on a hot summer day C. vasodilation on a cold winter day D. increased body temperature during a workout

increased sweating on a hot summer day

Which of the following is an example of the effector's role in maintaining homeostasis? increased body temperature during a workout increased sweating on a hot summer day decrease in body temperature on a cold day vasodilation on a cold winter day

increased sweating on a hot summer day

Decreased Na+ in body fluids (Na+ depletion) __________ renin secretion A. Increases B. Decreases C. Has no effect on

increases

All of the following would lead to an increase in the force generated by a muscle contraction EXCEPT: A) increasing the rate at which calcium is pumped back into the sarcoplasmic reticulum. B) increasing the number of muscle fibers activated. C) increasing the frequency of muscle stimulation by the motor nerve. D) increasing the number of motor units activated. E) maximizing the number of cross-bridges formed during a contraction.

increasing the rate at which calcium us outmode back into the sarcoplasmic reticulum

Feedback inhibition of GnRH will _________ follicular development. A. Activate B. Inhibit C. Not affect

inhibit

You are sitting on the couch and look down on your arm to see this: All of the following are likely to occur EXCEPT: A. Heartrateincreases B. Pupils dilate C. Intestinal activity increases

intestinal activity increases

Which of the following sets of terms belong together? involuntary, autonomic, sympathetic voluntary, somatic, sympathetic involuntary, somatic, parasympathetic voluntary, autonomic, parasympathetic

involuntary, autonomic, sympathetic

The basal lamina: is a specialized extracellular matrix found beneath epithelial tissues. links to epithelial cells through tight junctions. is found on top of the epidermis of the skin. All of these choices are correct. is a cell-rich layer.

is a specialized extracellular matrix found beneath epithelial tissues

If a mutation caused the G protein to become permanently bound to GTP, what result can be predicted? Question 5 choices Choice A., It constantly signals its pathway to be "on." Choice B., It constantly signals its pathway to be "off." Choice C., It is unable to signal subsequent steps in the pathway. Choice D., It is unable to separate from the beta and gamma subunits.

it constantly signals its pathway to be "on"

Suppose you have designed a sgRNA that can hybridize with a target DNA sequence, but there is no PAM sequence nearby. What do you expect to happen? A. Works just fine B. Works but is less efficient C. It doesn't work at all

it doesn't work at all

If a healthy cell were to accumulate about 6 total mutations over 20 cell divisions, how does this compare to thyroid tumors shown here? Assume the thyroid tumor has accumulated these mutations per megabase over the span of 20 cell divisions. Hint: there are 3.2 billion bps in the human genome. Median Deciles A. It's pretty similar (within an order of magnitude) B. It's totally different (more than 10x different) C. There's no way to say from these data

its totally different (more than 10x different)

Which type of protein adds a phosphate group to another molecule? phosphatase phosphorylase G protein kinase

kinase

Sequencing the genome of cancer cells from patients can detect: large scale chromosome mutations such as a translocation and inversion all of these point mutations such as base substitutions none of these single nucleotide deletions protein isoforms

large scale chromosome mutations such as a translocation and inversion, point mutations such as base substitutions, single. nucleotide deletions

Which of the following describes the functional importance of lateral inhibition? Question 3 choices Choice A., Lateral inhibition allows the determination of the frequency of a stimulus. Choice B., Lateral inhibition allows the determination of the intensity of a stimulus. Choice C., Lateral inhibition allows the determination of the location of the source of a stimulus.

lateral inhibition allows the determination of the location of the source of a stimulus

Above the rocks, the ambient temperature at time point A is _________ ambient temperature at time point B. A. Greater than B. Lower than C. Equal to

lower than

What type of sensory receptor is a hair cell? nociceptor electroreceptor mechanoreceptor chemoreceptor

mechanoreceptor

If I increased the amount of sequences evaluated in a sample (independent variable; x-axis). Would I expect to detect... A. More bacterial OTUs. B. Fewer bacterial OTUs. C. What is sequencing?

more bacterial OTUs

At the moment that the action potential has reached its maximum height, the potential (or voltage) difference across the nerve membrane is: Question 2 choices Choice A., more negative inside than out. Choice B., more positive inside than out. Choice C., zero or equal on both sides.

more positive inside than out

A single motor neuron and the population of muscle fibers that it innervates is called a(n): excitation-contraction coupling. twitch fiber. neuromuscular junction. motor unit. motor endplate.

motor unit

The property of dynamic instability implies that the individual protein subunits of microtubules are held together by: All of these choices are correct. disulfide bonds. covalent bonds. noncovalent interactions.

noncovalent interactions

Which of the following would occur if the LH surge were suppressed? A. Ovulation B. An increase in progesterone C. Both A and B D. None of the above

none of the above

ou turn on a light so you can get a glass of water. At the moment the light turns ON, your bipolar cells will ______ firing action potentials. A. Start B. Stop C. None of the above. (Bipolar cells do not fire Action potentials)

none of the above (bipolar cells do not fire action potentials)

Insects possess _____ circulatory systems, circulatory systems in which hemolymph completely "bathes" the organs and is not typically contained in distinct arteries or veins. fluid solid closed open

open

Which lettered item in the figure above is similar to the payload on a transport vehicle? Question 4 choices Choice A., oval a Choice B., oval b Choice C., oval c Choice D., oval d Choice E., oval e

oval b

Oocytes are produced in which of the following structures? cervix ovaries vagina fallopian tubes uterus

ovaries

Based on the diagram, which protein is a phosphatase? A. P1 B. P2 C. P3 D. P4 E. None of the above

p2

Which of the following relationships BEST describes the partial pressure of oxygen (pO2) in the lung (alveolar air), red blood cells, and blood plasma? pO2 blood plasma < pO2 lung < pO2 red blood cell pO2 red blood cell < pO2 blood plasma < pO2 lung pO2 lung < pO2 blood plasma < pO2 red blood cell pO2 red blood cell < pO2 lung < pO2 blood plasma

pO2 red blood cell < pO2 blood plasma < pO2 lung

What drives the reabsorption that occurs in animal excretory systems? Question 4 choices Choice A., passive diffusion Choice B., active transport Choice C., pressure Choice D., electrochemical gradients Choice E., passive diffusion for some substances and active transport for others

passive diffusion for some substances and active transport for others

Which one of the following is a feature of DNA that could allow you to distinguish between a DNA sequence that is protein coding and a DNA sequence that is not? Protein-coding sequences are sets of amino acids; others are sets of nucleotides. Protein-coding sequences are single stranded; others sequences are double stranded. Protein-coding DNA sequences contain U (Uracil), and nontranscribed sequences contain T (Thymine). All of these choices are correct. Protein-coding regions frequently contain long open reading frames; others rarely do.

protein-coding regions frequently contain long open reading frames; others rarely do

If solution X has a 2% concentration of NaCl and solution Y has an 8% concentration of NaCl, which of the following statements is CORRECT? Solution X has a higher osmotic pressure than solution Y. Solution X has a higher solute concentration than solution Y. Solution X is hypertonic relative to solution Y. Solution X has a lower concentration of water than solution Y. Solution X is hypotonic relative to solution Y.

solution x is hypotonic relative to solution y

Which of the following correctly represents the order in which blood flows through structures of the heart? A. Right ventricle, left atrium, pulmonary artery B. Left atrium, pulmonary artery, right atrium C. Pulmonary artery, aorta, left ventricle D. Superior vena cava, pulmonary vein, aorta

superior vena cava, pulmonary vein, aorta

In vertebrates, the speed of transmission along neurons is much faster in myelinated neurons compared to unmyelinated neurons. Which of the following is not true of transmission along myelinated neurons? Question 4 choices Choice A., Sodium and potassium channels are concentrated at nodes of Ranvier. Choice B., Saltatory conduction in non-myelinated neurons slows the process of transmission. Choice C., Action potentials are generated only in the nodes of Ranvier.

saltatory conduction in non-myelinated neurons slows the process of transmission

The functional unit of skeletal muscles are called: Question 2 choices Choice A., muscle bundles. Choice B., muscle fibers. Choice C., myofibrils. Choice D., sarcomeres.

sarcomeres

Which of the following is the CORRECT path taken by sperm from site of production to site of ejection? vas deferens, epididymis, seminiferous tubules, ejaculatory duct, urethra seminiferous tubules, epididymis, vas deferens, ejaculatory duct, urethra epididymis, seminiferous tubules, vas deferens, urethra, ejaculatory duct epididymis, seminiferous tubules, vas deferens, ejaculatory duct, urethra seminiferous tubules, vas deferens, ejaculatory duct, epididymis, urethra

seminiferous tubules, epididymis, vas deferens, ejaculatory duct, urethra

As shown in Fig. 13.1, to sequence a whole genome, researchers will typically break the genome into small fragments, sequence them, and then reassemble these fragments based on sequence overlaps. Two small genomic fragments that have overlapping sequences form a structure known as a contig. The CSAC relied on contigs to sequence the chimpanzee genome. If researchers isolated the above genomic fragments from chimpanzees, which sequences would constitute a contig? A. Sequences 2 and 3 B. Sequences 2 and 4 C. Sequences 1 and 4 D. Sequences 1 and 2 E. Sequences 3 and 4

sequence 1 and 2

Point mutations can impair a protein if they result in a: (Select all that apply.) shift in reading frame. nonsense codon. nonsynonymous codon. synonymous codon.

shift in reading frame, nonsense codon, nonsynonymous codon

In the G protein-coupled signal transduction pathway, phosphatases are responsible for the inactivation of: the alpha subunit of a G protein. the protein target activated by protein kinase A. protein kinase A. adenylyl cyclase. All of these choices are correct

the protein target activated by protein kinase A

What is the function of horizontal cells in the eye? They receive signals from multiple photoreceptors (rods and cones), enhancing contrast and adjusting photoreceptor sensitivity to light levels. They communicate between and among bipolar cells. They process visual input to actually form an image. They transmit signals from rods and cones to the optic nerve.

the receive signals from multiple photoreceptors (rods and cones), enhancing contrast and adjusting photoreceptor sensitivity to light levels

What determines the specific wavelength of light absorbed by a cone cell? the location of the cone cell on the retina the type of opsin present in the membrane the type of retinal molecule present the type of retinal molecule and opsin present

the type of opsin present in the membrane

All of the following are model systems that would be best to understand gene function in the context of cell differentiation or organ formation EXCEPT: Zebrafish Fly Yeast Mice Worm

yeast

Which of the following most likely happens if you shift your gaze from the TV on the other side of the room to look closely at a stain on the front of the shirt you are wearing? Question 2 choices Choice A., Your irises constrict to let less light through the pupil. Choice B., Your lenses become more rounded. Choice C., Your lenses become more flattened. Choice D., Your irises dilate to let more light through the pupil.

your lenses become more rounded

Cutting the auditory nerve could treat the symptoms of: A. Tinnitus (Meniere's disease) only B. Auditory hallucinations (epilepsy) only C. Neither D. Both

tinnitus (Meniere's disease) only

What is the primary function of a statolith? to amplify sound waves to detect vibrations in water to determine the direction of gravity to determine whether an organism is stationary or moving

to determine the direction of gravity

What is the function of adenylyl cyclase? to phosphorylate cyclic AMP to phosphorylate protein kinase A to form protein kinase A to form cyclic AMP

to form cyclic AMP

Depolarization and repolarization... sounds like we're talking about action potentials. Do muscles have action potentials? A.Totally! B.No way! C.How should I know?

totally

A chromosomal segment that breaks off and attaches to another chromosome is what type of mutation? inversion reciprocal translocation duplication translocation deletion

translocation

The following are examples of small-scale mutations except: single nucleotide deletion base substitution translocation single nucleotide insertion frame shift mutation

translocation

Calcium is necessary to initiate muscle contraction. Which of the following molecules binds calcium? actin troponin tropomyosin myosin

troponin

A patient suffers a stroke that cuts of blood supply to a region in the cerebellum. Which of the following symptoms would you be most likely to observe in the patient? A. Trouble maintaining balance B. Inability to regulate body temperature C. Problems seeing different colors D. Muted sensory perception

trouble maintaining balance

A cell in a chick embryo is tested to determine whether it is a stem cell of some kind. These tests find: 1. The SR receptor is present 2. DIV genes are on 3. The DIFF (skin) genes are blocked 4. TF of the neural pathway is in the cytoplasm 5. Transducer 2 of the skin pathway is not phosphorylated Based on these results, the transcription factor of the Skin pathway is in the cytoplasm. True False

true

A cell that utilizes NHEJ to repair a double-stranded DNA break which occurred in the open reading frame of a gene is susceptible to indels resulting in a frame shift mutation and ultimately a non-functional protein. True False

true

A membrane that has no K+ channels will have a resting membrane potential that is higher than the one shown on the figure. true false

true

All voltage changes along the plasma membrane of an axon have the characteristic shape shown above. true false

true

Amino acids with hydrophobic R groups are most often found buried in the interior of folded proteins. True False

true

Answer A for True or B for False Based on the diagram below, secretory vesicles are transported toward the plus ends of microtubules in neurons.

true

Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting "true" for does occur or "false" for does not occur. Circulating levels of aldosterone will increase. true false

true

Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting "true" for does occur or "false" for does not occur. Circulating levels of angiotensin II will increase. true false

true

Calcium is necessary for contraction. True False

true

Cells can regulate their internal osmotic pressure by controlling the solute concentration inside of the cell. true false

true

Chromatin immunoprecipitation and DNA sequencing (ChIP-seq) can determine which parts of our genome are associated with regulatory proteins such as p53 tumor suppressor factor. False True

true

Consider the figure below showing an EKG trace below the typical action potential for the sinoatrial node. Note: You haven't seen the action potential for the pacemaker cells in the text. Indicate whether the following statements are true or false. /brainhoney/Resource/11009259,8,0,4E,3/Assets/EKG1.jpg 2. Atria are emptying at the interval labeled 4 on the graph.

true

Consider the genome browser data associated with TP53. [~]/JT/TP53 tracks.jpg Tracks B and C provide evolutionary evidence of functionality. False True

true

Gene models represent protein coding regions of the genome. The direction of transcription 5' ---> 3' is indicated by the direction of arrows. True False

true

In DNA sequencing, the newly synthesized DNA strand that is complementary and anti-parallel to a template DNA strand is called a sequence read. True False

true

Mark A for True and B for False Based on these results, it can be concluded ob/ob mice do not produce the hormone leptin.

true

Mark A for True and B for False Based on these results, it can be concluded that db/db mice lack the receptor for the hormone leptin.

true

Mark A for True or B for False: The exons of TP53 are more highly conserved across vertebrates than the introns.

true

Mark A for True or B for False: There is a sequencing read from this tumor genome that maps to both chromosome 17 and chromosome 9 of the reference genome

true

Muscles produce higher forces when lengthening than when shortening. True False

true

Neuron A sends an EPSP to Neuron D at the same time that Neuron C sends an IPSP to Neuron D. Mark A for True or B for False The EPSP and IPSP will be spatially summed.

true

One of the roles of the kidneys is to help buffer body fluids so that they are not too acidic or too basic. The cells of the renal tubule secrete H+ into the tubule lumen, and absorb bicarbonate (HCO3-), passing it into the tissue fluid. Consider the reaction catalyzed by the enzyme carbonic anhydrase, shown in the accompanying figure and below. ((Given)) During heavy exercise, the reaction shifts to the right in the nephron (lumen of the tubule). True or False?

true

Pikas spent a greater percentage of time above the rocks before 10:00am. Answer A for True or B for False

true

Principal Coordinate (PC) analysis plots are a tool that can provide information on the similarities and differences between microbiome samples. True False

true

Researchers can change the sequence of small guide RNA (sgRNA) to cut DNA at a specific location in the genome. True False

true

Resting potential is generated mainly by the outward movement of K+ ions from inside the cell. true false

true

Sequencing reads can be aligned to a reference genome (i.e., human genome) to identify single nucleotide variants and potential mutations. True False

true

Strong conservation of a sequence of nucleotides in the human genome can help identify important genes or regulatory regions of the genome. True False

true

The DNA sequence shown below comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The underlined codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. ...TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3' ...AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG-5' /brainhoney/Resource/11009259,8,0,4E,3/Assets/JT/codon%20chart.jpg A mutation that changes the nucleotide at position 23 from C to G is a nonsense mutation. False True

true

The UCSC Genome Browser includes not only genetic information, but also epigenetic information of a gene and its regulatory elements. True False

true

Use the Genome Browser information on the TP53 gene below: /brainhoney/Resource/11009259,8,0,4E,3/Assets/JT/TP53%20genome%20browser.jpg Exon 1 is conserved in mice. True False

true

Using an evolutionary approach, conservation of a specific DNA sequence among species can determine if that sequence is important for the expression of a nearby gene. True False

true

You are looking at DNA-protein binding data in a 14 kb region of the genome. /brainhoney/Resource/11009259,8,0,4E,3/Assets/ls7cnanog.jpg This data provides evidence of cis-regulatory elements. False True

true

Which tumor has more chromosomal deletions? A. Tumor 1 B. Tumor 2 C. They are about the same D. Not enough information

tumor 2

Cellular differentiation progressively restricts cell fate because the unexpressed genes in the cell: accumulate deletions. accumulate point mutations. accumulate both point mutations and deletions. become more densely packed with nucleosomes. undergo irreversible repression.

undergo irreversible repression

In the proximal convoluted tubule, which of the following molecules is being secreted? A. Sodium B. Potassium C. Glucose D. Urea E. All of the above

urea

With a fluorescent marker, researchers were able to visualize species specific locations in the Zebrafish gut when colonized either Vibrio or Aeromonas 9/4/2019 500 μm 100 μm 100 μm Based on my group's interpretation of the data provided, we can conclude: A. Zebrafish have a preference for Vibrio over Aeromonas. B. Vibrio and Aeromonas are able to colonize distinct locations in the Zebrafish gut. C. Both Vibrio and Aeromonas can co-exist in the Zebrafish gut due to their gut location preferences D. We need more information to make any conclusions about this data.

vibrio and aeromonas are able to colonize distinct locations in the zebrafish gut

About _____ of the human genome is protein coding sequences. 30% 50% 100% 1% 10%

1%

How long does an action potential last compared to one second's movement of a clock? A. 10-3 times as long B. 10 times as long C. the same time D. 0.1 times as long E. 1/100th times as long

10-3 times as long

How many more unique OTUs were identified in sample 1 compared to sample 5? Data Matrix sample 1= 5 sample 5=3 A.1 B.2 C.3 D.4 E.5

3

How many synapses in total are involved in the knee-jerk reflex? Question 5 choices Choice A., 1 Choice B., 2 Choice C., 3 Choice D., 4

3

An increase of _____ increases the permeability of the collecting duct to water. ADH (antidiuretic hormone) alcohol caffeine diuretic drug

ADH (antidiuretic hormone)

Please study the table below. /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_38/38_77.jpg Each pair of phrases in the same row shows a valid comparison between the anterior and posterior pituitary EXCEPT: B.hypothalamic-pituitary circulatory system/ long hypothalamic axons A. secretion is stimulated by hypothalamic releasing factors/ site of release for hypothalamic hormones D. produces hormones that stimulate milk production/ produces hormones that stimulate milk ejection C. cortex produces cortisol/ medulla produces epinephrine

C

The new data added below shows the source of mutations for each kind of tumor. What is the most prominent source of mutations in glioblastoma tumors? A. Ultraviolet light C. Tobacco smoke/products B. BRCA1/2mutations D.CpG deamination

CpG deamination

Which genes are expressed in a quiescent stem cell? A. SR genes B. DET genes C. DIV genes D. ID genes E. DIFF (skin) genes

SR genes

Which region on the EKG corresponds to number 2 (flat line) on the figure?? P wave PR segment QRS complex ST segment T wave U wave

ST segment

What are desirable characteristics for a gas exchange surface, such as the endothelial cells lining the inside of lung? (Select all that apply.) a small surface area a thickness of 100 micrometers a large surface area a thickness under 10 micrometers

a large surface area, a thickness under 10 micrometers

Suppose the stereocilia of one hair cell become permanently bent. What will most likely happen as a consequence? A. A single pitch will be constantly perceived B. A single pitch will no longer be perceivable C. A or B depending on the hair cell's location D. A or B depending on the bending's direction

a or b depending on the bending's direction

How does blood pH at muscle tissue compare to blood pH at the lungs? A.Blood pH is higher at the muscle B.Blood pH is lower at the muscle C.Blood pH is the same at the muscle

blood pH is lower at the muscle

Signals can travel short or long distances to reach their receptors. Classify the signal below according to the distance between the signaling and responding cell. A transmembrane protein on the surface of a cell is __________. A. Paracrine B. Autocrine C. Contact-dependent D. Endocrine

contact-dependent

During a typical cardiac cycle, cell depolarization triggers muscle _______ and repolarization triggers muscle ________. A. Contraction; contraction B. Contraction; relaxation C. Relaxation; contraction D. Relaxation; relaxation

contraction; relaxation

Firmicutes are increased in patients with recurrent CDI true false

false

Use the Genome Browser information on the TP53 gene below: /brainhoney/Resource/11009259,8,0,4E,3/Assets/JT/TP53%20genome%20browser.jpg Histone acetylation near the promoter of the gene is conserved in Zebrafish. True False

false

How many SNPs can be detected using a single microarray? Question 6 choices Choice A., 1 Choice B., 2 Choice C., 46 Choice D., millions

millions

The ventricles begin to empty at which region of the cardiac cycle? Diastole Systole Lub

systole

In the example of adrenaline signaling used in the animation, suppose each amplification step produces hundredfold active molecules. How many total modified protein target molecules result from a single activated signal receptor? Question 3 choices Choice A., 300 Choice B., 900 Choice C., 10,000 Choice D., 1,000,000 Choice E., 100,000,000

1,000,000

Place the following events in muscle contraction in the correct sequence from first to last. 1. ATP binds to myosin head. 2. Myosin head interacts with actin. 3. ATP is converted to ADP and Pi. 4. Myosin head is cocked back. 5. Myosin head pivots in the power stroke. 6. ADP and Pi are released from myosin. Question 2 choices Choice A., 1, 2, 3, 4, 5, 6 Choice B., 1, 2, 4, 3, 6, 5 Choice C., 1, 3, 6, 2, 4, 5 Choice D., 1, 3, 4, 2, 6, 5

1,3,4,2,6,5

Signals can travel short or long distances to reach their receptors. Classify the signal below according to the distance between the signaling and responding cell. A peptide hormone that travels through the bloodstream is __________. A. Paracrine B. Autocrine C. Contact-dependent D. Endocrine

endocrine

Sequences that are conserved (i.e., similar in many different organisms) are unlikely to be functionally important. True False

false

A stroke occurs when blood flow to a region of the brain is interrupted, damaging the cells in that region. What symptoms might you see if a person suffered a stroke in their cerebellum? loss of balance and coordination loss of sensory perception difficulty speaking visual impairment

loss of balance and coordination

Which of the following statements best summarizes the function of G protein-coupled receptors? Question 3 choices Choice A., A G protein present on the outside of the cell leads to a change on the inside of the cell. Choice B., A signal present on the outside of the cell leads to a change on the inside of the cell. Choice C., A signal molecule on the outside of the cell is transported to the inside of the cell. Choice D., A GTP molecule is bound to the receptor, which causes a conformational change inside the cell.

a signal present on the outside of the cell leads to a change on the inside of the cell

Stretch receptors in the knee extensor muscles stimulated by the tap of a physician's reflex hammer just below the knee cap directly triggers a nerve impulse in which of the following? Question 1 choices Choice A., the patellar tendon Choice B., an motor neuron Choice C., an interneuron Choice D., a sensory neuron

a sensory neuron

The data shown in Fig. 35.11c represent: A. multiple samples across different nerve cells. B. multiple samples over time. C. a single sample over time. D. a continuous sample. E. a qualitative result.

a single sample over time

Over a period of time, the number of action potentials exhibited by a stimulated sensory neuron decreases. This is known as: Question 2 choices Choice A., the refractory period. Choice B., accommodation. Choice C., lateral inhibition. Choice D., sensory adjustment.

accommodation

We are not aware of the fact that we are wearing socks shortly after we put them on. This is due to which of the following? Question 5 choices Choice A., lateral inhibition Choice B., the direct inhibition of sensory stimuli Choice C., sensory adjustment Choice D., accommodation

accommodation

Animals faced challenges when moving from water to land. What was the single most important adaptation that led to the uncoupling of reproduction and the need for an aquatic habitat? internal fertilization amniotic egg flagellated sperm

amniotic egg

A condition called "hypoxia" occurs when not enough oxygen is being delivered to the body. Chemoreceptors on the ________ sense oxygen levels in the blood and relay this information to respiratory control centers in the brain. A. Aorta B. Pulmonary trunk C. Pulmonary vein D. Superior vena cava

aorta

Neurons in the somatosensory cortex not only differ in the type of stimuli that they respond to, but also in their adaptation responses. Mountcastle noted that the neuron described in Questions 4 and 5 (and most neurons that respond to cutaneous stimuli) demonstrates a slow adaptation response; during the duration of the stimulus, the firing rate of the neuron never returns to normal levels (the firing rate recorded before any stimulus was applied). Mountcastle determined that neurons activated by touching hairs demonstrate quick adaptation responses. Which of the following diagrams might depict a rapid adaptation response of a neuron activated by a stimulus applied to the hair? Diagram 1 Diagram 2 Diagram 3 Diagram 4 A. Diagram 1 B. Diagram 2 C. Diagram 3 D. Diagram 4 E. None of the other answer options are correct.

diagram 2

During _____ bone segments rotate closer, whereas during _____ bone segments move further apart. flexion; extension extension; flexion contraction; flexion contraction; extension rotation; flexion

flexion; extension

A researcher is working with mutant mice that demonstrate defects in the formation of connective tissue. These mice likely carry a mutation in a gene encoding what type of growth factor? histamine neurotransmitters fibrinogen growth factors (FGFs) bone morphogenetic proteins (BMPs) nerve growth factors (NGFs)

fibrinogen growth factors (FGFs)

Crispr could ... make yeast that glows by inserting a gene from a jellyfish. a. Already happened. b. Hypothetically possible. c. Pure fiction

already happened

Crispr could... 1 of 12 ... create a mushroom that is exceptionally slow to brown. a. Already happened. b. Hypothetically possible. c. Pure fiction.

already happened

The two main classes of hormones are: lipid-soluble hormones and water-soluble hormones. steroid hormones and lipid hormones. polysaccharide hormones and protein hormones. amine/peptide hormones and steroid hormones. nucleic acid hormones and lipid hormones.

amine/peptide hormones and steroid hormones

A cell is determined because it received the Self Renewal signal. Which genes that were on, would be turned off if the cell then receives the skin signal? (Assume the SR signal is still present.) A. DETgenes B. DIV genes C. DIFF (skin) genes D. DIFF(neuron)genes

DIV genes

A stem cell is fate determined once it has received the Self Renewal signal. As result, which genes are newly expressed? (Check all that apply) /brainhoney/Resource/11009259,8,0,4E,3/Assets/JT/LS%207C/Cell%20differentiation.jpg DIV genes ID genes SR genes DET genes DIFF (neural) genes DIFF (skin) genes

DIV genes, ID genes, DET genes

Mark A for TRUE and B for FALSE: The Cas9-sgRNA complex must separate double stranded DNA in order to carry out its function.

true

Mark A for True or B for False A drug that blocks the Ca2+ channels of the presynaptic neuron will prevent neurotransmitters from being released.

true

Mark A for True or B for False: All six reads map to this genome reference sequence.

true

Mark A for True or B for False: There is functional redundancy across different types of bacteria

true

Your computer records the raw sequencing data shown below. Image 1 How many different sequences are represented in this dataset? Image 6 9/9/2019 A C G T A. 1 B. 2 C. 3 D. 4 E. 5 or more

2

In which exon does the open reading frame start? A. 1 B. 2 C. 3 D. 4 E. None of the above

3

In a muscle affected by Botox, tropomyosin will be bound to actin True False

true

In addition to introducing mutations in a gene, DNA editing by means of CRISPR can also correct mutations in a gene. False True

true

In most organisms, the excretion of wastes is closely tied to the maintenance of water and electrolyte balance. True False

true

Mark A for True and B for False. Is this an accurate null hypothesis: None of the experimental groups will exhibit changes in body weight.

true

Pheromones are generally detected by the vomeronasal organ in most mammals, reptiles, and amphibians. False True

true

Which of the following is NOT an essential element involved in communication between all cells? second messenger receptor protein signaling molecule responding cell

second messenger

What does the ST interval represent? A. The heart is relaxing B. The ventricles are filling C. The atria are filling

the atria are filling

You hypothesize that mice with microbes have less body fat than mice without microbes. You conduct a follow-up experiment, the results of which are shown below. What can you conclude from these data? A. The data support the hypothesis B. The data refute the hypothesis C. The data don't provide enough information to support or refute

the data refute the hypothesis

Milk-oriented Microbiota refers to: The difference between lactose tolerant and lactose intolerant human microbiota. The type of baby formula invented that includes human milk oligosaccharides. The presence of microbes in store bought milk made from dairy cows. The enrichment of select microbes during development that can degrade human milk oligosaccharides.

the enrichment of select microbes during development that can degrade human milk oligosaccharides

A botanist working in the Amazon rain forest discovers a new species of orchid. Interestingly, males but not females of a certain wasp species keep visiting the flowers of these orchids. Why? The orchid might produce a pheromone similar to that produced by female wasps. Male wasps are likely attracted by growth factors produced by the orchid. Male wasps are likely attracted to the sweet nectar produced by the orchid. Male wasps are likely attracted by paracrine signals produced by the orchid. Male wasps are likely attracted to the bright colors of the orchids' flowers.

the orchid might produce a pheromone similar to that produced by female wasps

The cellular changes associated with long-term potentiation are localized to: both pre- and postsynaptic cells. the postsynaptic cell. the presynaptic cell.

the postsynaptic cell

Why do the functions of many receptor kinases depend on the fluid nature of the plasma membrane? A. The activation of enzyme pathways requires a fluid membrane. B. Binding of ligand to the receptor requires a fluid membrane. C. The receptor monomers must move together and dimerize to be activated. D. Phosphorylationrequiresafluidmembrane.

the receptor monomers must move together and dimerize to be activated

Which photoreceptor cells are primarily responsible for allowing you to read a newspaper in a dimly lit room? Question 3 choices Choice A., the blue-sensitive cone cells in the retina Choice B., the green sensate cone cells in the retina Choice C., the blue- and green-sensitive cone cells in the retina Choice D., the rod cells in the retina

the rod cells in the retina

How is the actual base sequence of DNA fragments determined? Question 2 choices Choice A., They are analyzed in a machine that determines the base sequence. Choice B., They are analyzed in a powerful microscope. Choice C., They are translated into proteins and the amino acid sequence is determined. Choice D., They are carefully lined up with known sequences from other organisms.

they are analyzed in a machine that determines the base sequence

Which of the following statements applies to frameshift mutations? They create a premature stop codon at the site of mutation. They are known risk factors in most forms of cancer, including breast and colon cancer. They cause the insertion or deletion of a single amino acid from the polypeptide chain. They change the amino acid sequence downstream from the mutant site. They are known risk factors in breast cancer, but not colon cancer.

they change the amino acid sequence downstream from the mutant site

Which of the following statements about K-strategists is FALSE? They evolve in stable environments. They give birth frequently. They produce few offspring. There is a lot of parental investment in the offspring. They evolve in environments with intense competition for limited food.

they give birth frequently

What function do collagen and elastin have in arteries? They help to control blood flow within the body by contracting with the smooth muscles in the arterial wall. They form valves to prevent the backflow of blood. They provide elastic rebound of the arterial wall to help smooth out blood flow. They line the interior to provide a smooth surface for blood flow. All of these choices are correct.

they provide elastic rebound of the arterial wall to help smooth out blood flow

What would you predict to be the effect on an animal species of having longer loops of Henle in their kidney structure? Question 2 choices Choice A., They can produce greater concentration gradients of electrolytes in the deep medulla of the kidney. Choice B., They can produce less concentrated urine (one with a higher concentration of water). Choice C., They would be better able to survive in desert or dry habitats than animals with shorter loops. Choice D., They can reabsorb more water, glucose, and amino acids in the ascending limb.

they would be better able to survive in desert to dry habitats than animals with shorter loops

Given the temperature readings in the topmost tube (in the system diagrammed above), which of the following would be reasonable temperatures for points 1 to 5 in the lower tube? (opposite direction) Question 4 choices Choice A., 20 - 30 - 40 - 50 - 60 Choice B., 50 - 40 - 30 - 20 - 10 Choice C., 90 - 80 - 70 - 60 - 50 Choice D., 0 - 10 - 20 - 30 - 40

20 - 30 - 40 - 50 - 60

How many molecules of O2 can a single hemoglobin molecule carry when fully saturated? 8 4 1 16 2

4

/brainhoney/Resource/11009259,8,0,4E,3/Assets/JT/gene%20model.jpg There are 7 introns in this gene model. True False

true

In the diagram below, which hormone(s) (if any) travel through blood vessels? A. TRH B. TSH C. T3/T4 D. All of the above E. None of the above

all of the above

If two signaling pathways are activated simultaneously: one may inhibit the other. they may strengthen each other. All of these choices are correct. they may inhibit each other.

all of these choices are correct

The force that a muscle fiber produces results from many thousands of myosin cross-bridges binding to actin filaments over time. Given this, A. the net force produced by the fiber represents the summation of cross-bridge forces across the thickness and lengths of sarcomeres within the muscle fiber. B. more attached cross-bridges are associated with greater force generated by the sarcomere. C. variation in cross-bridge force could be assessed by measuring the standard deviation of peak individual cross-bridge forces. D. All of these choices are correct.

all of these choices are correct

Crispr could ...change bacteria from beige to dark blue. a. Already happened. b. Hypothetically possible. c. Pure fiction

already happened

CRISPR/Cas9 can be used to insert, delete, or replace DNA any model system. False True

true

Countercurrent mechanisms of ion transport depend on continuous concentration gradients across secretory cells. Which direction must salt secretions flow? blood flow up, salt secretions down blood flow up, salt secretions up

blood flow up, salt secretions down

Which of these would be involved in the body's main response to viral infection? Cytotoxic T cell MHC II MHC I Macrophages Helper T cell Dendritic cell

cytotoxic T cell, MHC 1

Which letter on the figure below corresponds to increased mitotic division in memory B cells? a b c d e

d

In a specific cell type, high H3K27 acetylation would indicate gene expression is turned OFF in that cell. False True

false

The magnitude of the action potential is correlated with the strength of the stimulating input. true false

false

The magnitude of the action potential is correlated with the strength of the stimulating input. False True

false

What happens to a signal after it binds the receptor? A. Itstaysbounduntilthereceptorisdestroyed B. It eventually dissociates from the receptor C. It is eventually destroyed by the receptor D. Itdissociatesfromthereceptorwhenatermination signal is received

it eventually dissociates from the receptor

The diagram below shows an ion moving across a membrane in the direction indicated by the arrow. Which of the following best describes the movement of the ion? A. It is moving against both its chemical and electrical gradients B. It is moving against its chemical gradient and down its electrical gradient C. It is moving down its chemical gradient and against its electrical gradient D. It is moving down both its chemical and electrical gradients

it is moving against its chemical gradient and down its electrical gradient

What is the BEST characterization of the minus end of a dynamic filament? It loses subunits quickly. It is slow growing, and also loses its subunits quickly. It is fast growing. It is slow growing.

it is slow growing

Atrioventricular valves separate the: right atrium from the left atrium and the right ventricle from the left ventricle. right and left ventricles. aorta from the left ventricle. left atrium from the left ventricle and the right atrium from the right ventricle.

left atrium from the left ventricle and the right atrium from the right ventricle

Antacids like pepto-bismal are commonly taken to increase the pH of the stomach. If you take an antacid with your meal, _____ secretin will be released by your duodenum compared with eating an identical meal without an antacid. A. More B. Less C. An equivalent amount of

less

Macrophage cells undergo a process called phagocytosis in which material is brought into a cell in the form of membrane vesicles and then transported along microtubules toward the cell center. Assuming that the centrosome is near the cell center, you can predict that these vesicles are moving to the _____ end of microtubules using the motor protein _____. minus end; kinesin minus end; dynein plus end; dynein plus end; kinesin

minus end; dynein

Arrange the events in the stimulation of heart muscle in order from earliest (1) to latest (5). Note that this question does not list every step in the pathway, but the steps presented should be arranged in order. Activation of adenylyl cyclase Activation of G-proteins Activation of protein kinase A Phosphorylation of proteins that induce contraction in muscle cells Conversion of ATP into cyclic AMP

2,1,4,5,3

Shown below is part of a coding region within the fist exon of a gene. /brainhoney/Resource/11009259,8,0,4E,3/Assets/LS%207C/CRISPR%20cut%201.PNG Where will Cas9 cause a double stranded DNA break? B C A D

a

Glucose transport out of intestinal cells into the bloodstream requires which of the following? Select all that apply. The general chemical nature of a hormone can be used to predict: a Na+ concentration gradient between the blood and the intestinal cell a Na+-glucose cotransporter in the membrane facing the blood a glucose channel protein on the cell surface facing the blood a higher concentration of glucose in the intestinal cells a Na+ channel connecting the intestinal cell to the blood stream

a glucose channel protein on the cell surface facing the blood, a higher concentration of glucose in the intestinal cells

In the context of cell signaling, to what does the term ligand refer? a signaling molecule the proteins activated as part of a signal transduction pathway a type of gated channel the extracellular domain of a receptor protein

a signaling molecule

What is a muscle fiber? a single cell of a muscle the connective tissue outer covering of a muscle the myosin that makes up the contractile unit of a muscle cell a group of muscle cells that make up the same muscle group

a single cell of a muscle

Which of the following would shut the pathway off the most quickly? A. Activating phosphatase that targets the receptor B. Activating a phosphatase that targets P2 C. Activating a phosphatase that targets P3

activating phosphatase that targets the receptor

What drives the secretion stage that occurs in animal excretory systems? Question 7 choices Choice A., passive diffusion Choice B., active transport Choice C., pressure Choice D., electrochemical gradients Choice E., passive diffusion for some substances and active transport for others

active transport

Which of the following statements about bird respiration is FALSE? The unidirectional flow of air through a bird's lungs maintains a larger concentration gradient for diffusion than can be obtained through tidal breathing. Oxygen is exchanged between the air and the bloodstream in the lungs, but not in the air sacs. Bird lungs receive fresh air during both inhalation and exhalation. It takes two ventilation cycles for a single breath of air to move through a bird's respiratory system. Air flowing through the air channels in the lungs moves in a tidal fashion.

air flowing through the air channels in the lungs moves in a tidal fashion

What is meant by "tidal ventilation"? Air moves in a continuous, unidirectional flow through the lungs. Air moves into the lungs during inhalation and air moves out of the lungs during exhalation. None of the answer options is correct. Water is pumped back and forth across the respiratory system. The ventilation rate increases and decreases at regular intervals.

air moves into the lungs during inhalation and air moves out of the lungs during exhalation

Which of the following is not a component that contributes to human gut microbiome stability: Bacterial niche specialization and colonization Host immune system defense against specific of bacterial species All of these answer choices are correct. Bacterial competition for resources Direct bacterial defense against other bacterial species

all of these answer choices are correct

How do repeated sequences in the genome complicate assembly of fragments? Question 4 choices Choice A., The repeated sequences may appear in many fragments. Choice B., Fragments from different regions of the chromosomes may appear identical if they contain the same repeated sequence. Choice C., Regions of sequence overlap may occur between fragments not actually adjacent in the genome. Choice D., All of these choices are correct.

all of these choices are correct

Positive feedback loops: cause a response in the same direction as the initial stimulus. continue until interrupted or broken by an external signal. are activated by a stimulus. All of these choices are correct. move the system farther and farther away from the set point.

all of these choices are correct

Signal transduction is the process by which: a single master gene, or signal, activates a series of downstream genes that lead to cell differentiation. a specific combination of transcription factors determines the developmental pathway in a cell or group of cells. transcription factors bind to cis-regulatory regions of DNA and either activate or repress transcription. an extracellular molecule activates a membrane protein, which in turn activates molecules inside the cell. None of the answer options is correct.

an extracellular molecule activates a membrane protein, which in turn activates molecules inside the cell

Choose the correct statement that refers to human gut microbiome resilience after antibiotic exposure: Antibiotics educate the host immune system to defend against only the bacteria that are causing the disease so after the antibiotic treatment only beneficial microbes are present. Antibiotics are food sources for beneficial microbes only and allow their population sizes to increase due to the greater amount of food that is available for only these beneficial bacteria. Antibiotics can directly kill most of the bacterial species present in the gut but the ones that survive the antibiotic treatment can then increase their population sizes after the antibiotic treatment is finished. Antibiotics can directly kill all of the bacterial species present in the gut and the observed resilience of the microbiota is due to new bacteria we introduce from the food we eat or other environmental exposure events.

antibiotics can directly kill most of the bacterial species present in the gut but the ones that survive the antibiotic treatment can then increase their population sizes after the antibiotic treatment is finished

At which time point do pikas spend the greatest proportion of time below the rocks? Choose A or B

b

The experiments described in Fig. 35.11 were conducted on the squid's giant axon. Which of the following statements is true? A. This experiment shows that all axons use the same movement of ions across their membrane to fire an action potential. B. This experiment suggests a mechanism that other nerve cells may use to transmit action potentials. C. Additional studies of the membrane properties of neurons from other species are needed to test the generality of the findings for a squid's giant axon. D. Additional studies of other neurons cannot be carried out because the membrane properties of other, smaller axons cannot be studied. E. B and C. F. A and D.

b and c

High blood glucose stimulates the _________BLANK cells in the pancreas to secrete _________BLANK. Question 2 choices Choice A., alpha; glucagon Choice B., beta; glucagon Choice C., alpha; insulin Choice D., beta; insulin

beta; insulin

Calcitonin and PTH are peptide hormones. They most likely signal a response by... A. Diffusing across the lipid bilayer to bind a cytoplasmic receptor B. Binding a transmembrane receptor to activate a signal transduction pathway in the cytoplasm C. Beingtransportedintothecelltoactivateasignal transduction pathway in the cytoplasm

binding transmembrane receptor to activate a signal transduction pathway in the cytoplasm

Chromatin immunoprecipitation and DNA sequencing (ChIP-seq) can be used to identify regions of the genome that can indicate promoters, enhancers, and transcription factor-binding motifs. ChIP-seq is an example of: Genetic approach Evolutionary approach All of these approaches None of these approaches Biochemical approach

biochemical approach

Which of the groups of vertebrates below has the greatest number of cone cell types? Question 4 choices Choice A., humans Choice B., canines Choice C., birds

birds

Inactivation of a cell-surface receptor depends on: both the binding affinity of the receptor and concentration of ligand surrounding the cell. the activity of phosphatases in the cytosol. the binding affinity of the receptor. the concentration of ligand surrounding the cell.

both the binding affinity of the receptor and concentration of ligand surrounding the cell

A condition called "hypoxia" occurs when not enough oxygen is Brainstem being delivered to the body. What is acting as the homeostatic sensor? A. Oxygen B. Carbon Dioxide C. Heart D. Brainstem E. Diaphragm

brainstem

Which one of the following steps comes FIRST in shotgun sequencing? matching regions of overlap reconstructing the long sequence of nucleotides putting the sequences in the correct order breaking the DNA into small fragments sequencing the DNA

breaking the DNA into small fragments

The neuron below is generating an action potential at Point A. At the exact same moment, what would an electrode at Point B measure? A- high action potential B- lower peak action potential C- flat line

c

If a mutation occurred in the cadherin gene so that the cytoplasmic domain no longer attached to the cytoskeleton, which of the following would occur? Cadherins in hemidesmosomes would no longer be anchored to intermediate filaments. Cadherins in adherens junctions would no longer be anchored to microtubules. Cadherins in desmosomes would no longer be anchored to microfilaments. Cadherins in desmosomes would no longer be anchored to intermediate filaments.

cadherins in desmosomes would no longer be anchored to intermediate filaments

Why is calcium necessary for muscle contraction? Calcium is needed to detach the myosin from the actin. Calcium is needed to cock the myosin head so that it can form a cross-bridge with actin. Calcium is needed to allow the muscle fiber to become depolarized. Calcium functions as a neurotransmitter and is released from the motor neuron. Calcium is needed to activate troponin so that tropomyosin can be moved to expose the myosin-binding sites on the actin filament.

calcium is needed to activate troponin so that tropomyosin can be moved to expose the myosin-binding sites on the actin filament

How might further research identify what ion enters the cell from outside, causing the rapid rise in membrane potential that initiates the action potential? Researchers could: A. change the concentration of Cl- ions in the solution bathing the axon. B. change the concentration of Na+ ions in the solution bathing the axon. C. create a short-circuit across the axon's membrane so that the membrane potential remains at 0 volts. D. change the concentration of K+ ions in the solution bathing the axon.

change the concentration of Na+ ions in the solution bathing the axon

A person's blood pressure falls. Which of the following would you expect to occur? (Select all that apply.) circulating concentrations of renin will increase water uptake by the distal convoluted tubule will increase circulating concentrations of aldosterone will decrease circulating concentrations of angiotensin II will decrease

circulating concentrations of renin will increase, water uptake by the distal convoluted tubule will increase

Where does the cycle start?!? When a muscle is completely relaxed (no contraction is occurring), at which point is the cycle paused? unbinding of myosin and actin cocking of the myosin head binding myosin to actin power stroke rigor (myosin in low energy state)

cocking of the myosin head

If carbonic anhydrase stopped working, the amount of oxygen delivered to systemic tissues would _________. A. Increase B. Decrease C. Not change

decrease

Low levels of dietary iodine would cause the levels of T3 and T4 circulating in the bloodstream to ________. A. Increase B. Decrease C. Not change

decrease

Multiple sclerosis is a disease in which the myelin surrounding neurons in the brain and spinal cord are damaged. Without myelin, the rate of action potential propagation in these neurons will most likely ______. A. Increase B. Decrease C. Not change

decrease

You are doing an experiment on a new class of G protein−coupled receptor. You make several cell lines that each express the receptor, the corresponding G protein, and adenylyl cyclase. Each cell line has different mutations in these components. You decide to measure cyclic AMP (cAMP) in the cells of each cell line to understand the effect of each of these mutations. Below is a list of mutations. For each, indicate whether the amount of cAMP in the cells will increase, decrease, or stay the same. A mutation in the α subunit of the G protein that prevents the release of bound GDP. The amount of cAMP in cells will: increase stay the same decrease

decrease

Innate immunity activation depends on: memory B cells. diversity of antibodies in the blood stream. None of the answer options is correct. previous exposure to a foreign antigen. MHC class II proteins.

diversity of antibodies in the blood stream

Microtubules are __________BLANK because they __________BLANK and depolymerize at their ends. Question 2 choices Choice A., unstable; hydrolyze Choice B., stable; polymerize Choice C., dynamic; polymerize , Choice D., dynamic; hydrolyze

dynamic; polymerize

The basis for movement of cilia and flagella is the interaction of the motor protein __________BLANK with the cytoskeletal elements called ____________BLANK. Question 2 choices Choice A., dynein; actin filaments Choice B., tubulin; dynein Choice C., myosin; actin filaments Choice D., dynein; microtubules Choice E., kinesin; microtubules

dynein; microtubules

A gain-of-function mutation in a tumor suppressor gene would result in abnormal growth in cells. False True

false

After glucagon binds the G-protein coupled receptor (GPCR), the G-protein is activated. Answer A for True or B for False The Gα subunit gains a phosphate atom from GTP.

false

After the SR receptor binds its signal molecule, the DET genes are expressed. Expression of receptors and transducers of differentiation will cause stem cells to differentiate. True False

false

All of the proteins shown in the diagram are active when they are phosphorylated. True False

false

Answer A for True or B for False A loss of function mutation in dynein would cause vesicles to accumulate in the neuron's cell body.

false

As cells become differentiated, they delete the DNA for genes they no longer need. False True

false

Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting "true" for does occur or "false" for does not occur. Circulating levels of renin will decrease. true false

false

Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting "true" for does occur or "false" for does not occur. Water absorption by the distal convoluted tubule will decrease. true false

false

Epigenetic measurements found in neurons will be the same as those found in T cells. False True

false

From the information provided, mutations in this breast cancer-associated gene tend to be primarily synonymous substitutions. /brainhoney/Resource/11009259,8,0,4E,3/Assets/7s7synanomous.jpg True False

false

Given that most ligands form covalent bonds with their associated receptors, these complexes are more or less permanent and can only be broken through the hydrolysis of ATP. True False

false

If a hemoglobin molecule comes into close contact with a respiring cell, the presence of CO2 in the environment will cause hemoglobin to bind to more oxygen molecules (if it is not already bound to four). True False

false

In a muscle affected by Botox, the cell will become hyperpolarized True False

false

In mammals, bulk flow only refers to the movement of oxygen (either into or out of the lungs and within the bloodstream). Bulk flow never refers to the movement of carbon dioxide. True False

false

Inhibitory postsynaptic potentials (IPSPs) are associated with membrane depolarization, whereas excitatory postsynaptic potentials (EPSPs) are associated with hyperpolarization. True False

false

Mark A for TRUE and B for FALSE: Cas9/sgRNA can hybridize with target DNA if the scaffold region of sgRNA is mutated

false

Mark A for TRUE and B for FALSE: Changing the spacer sequence of sgRNA makes the Cas9- sgRNA complex unable to cleave DNA

false

Mark A for True and B for False Based on these results, it can be concluded that db/db mice do not make the hormone leptin.

false

Mark A for True and B for False: 16S rRNA gene sequencing utilizes RNA to identify microbial species present in a microbiota sample.

false

Mark A for True or B for False: 9/9/2019 Median Deciles The majority of tumor mutations occur in protein-coding regions of the genome.

false

Mark A for True or B for False: All of the reads are identical to the reference genome sequence.

false

Mark A for True or B for False: Small mutations are usually found in the protein-coding regions of the genome.

false

Mark A for True or B for False: The 3'UTR of TP53 is conserved in zebrafish.

false

Mark A for True or B for False: The data presented is a measure of alpha diversity.

false

Mark A for True or B for False: The data was likely generated by 16S rRNA sequencing

false

Most proteins retain metabolic activity when denatured. False True

false

Neuron A sends an EPSP to Neuron D at the same time that Neuron C sends an IPSP to Neuron D. Mark A for True or B for False The IPSP will cause the axon of Neuron D to become hyperpolarized.

false

Assume you haven't eaten in the last 24 hours. Which of the following would you predict? Question 4 choices Choice A., Glucagon release from the pancreas will increase. , [Your answer, correct] Choice B., Insulin release from the pancreas will increase. Choice C., Glucagon release from the pancreas will decrease. Choice D., Glycogen storage by the liver will increase.

glucagon release from the pancreas will increase

Glucose enters the epithelial cells of the small intestine against its concentration gradient. Select the BEST explanation from the following. Glucose is co-transported in the Na+/K+ pump. Glucose is transported through a glucose pump in the apical membrane that hydrolyzes ATP to ADP and Pi. Glucose is co-transported with Na+, which moves down its concentration gradient into the cell. Glucose follows the water that is pumped into the cell. Glucose enters by diffusion.

glucose is co-transported with Na+, which moves down its concentration gradient into the cell

You are studying a protein that you call Protein X. There is an aspartic acid at a key position in Protein X that is important in the folding and stabilization of that protein. If this aspartic acid is changed to a different amino acid, which one of the following amino acid substitutions is MOST likely to allow the protein to fold normally? serine glycine glutamic acid arginine threonine

glutamic acid

In what situation can a harmful deletion in a chromosome persist in a population? if the homologous chromosome lacks the deletion if a transposon replaces the deleted region if the deletion is not in the centromere, so it is not fatal. if it is homozygous

if the homologous chromosome lacks the deletion

The plus ends of both microtubules and microfilaments differentiate from the minus ends: Question 5 choices Choice A., in that new tubulin or actin subunits are added rather than removed. Choice B., in that new tubulin or actin subunits are added more quickly. Choice C., in that the end that always grows in the direction the cell is moving.

in that new tubular or actin subunits are added more quickly

You are doing an experiment on a new class of G protein−coupled receptor. You make several cell lines that each express the receptor, the corresponding G protein, and adenylyl cyclase. Each cell line has different mutations in these components. You decide to measure cyclic AMP (cAMP) in the cells of each cell line to understand the effect of each of these mutations. Below is a list of mutations. For each, indicate whether the amount of cAMP in the cells will increase, decrease, or stay the same. A mutation in the α subunit of the G protein that prevents the release of bound GTP. The amount of cAMP in cells will: stay the same decrease increase

increase

The lungs are highly branched. What is the primary purpose of this branching? A. It increases the surface area of the lungs B. It increases the volume of the lungs C. A and B are correct D. None of the above

it increases the surface area of the lungs

This map of the somatosensory cortex shows distorted body parts because: /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_36/36_184.jpg it reflects differences in different people depending on how that person perceives his or her body parts. that is the only way an illustrator can fit all the parts into the picture. it reflects the relative amount of sensory cortex devoted to pressure and touch sensations from a body part. it reflects the number of muscle fibers that are devoted to stimulating a particular body part.

it reflects the relative amount of sensory cortex devoted to pressure and touch sensations from a body part

Zebrafish embryos change the color of the melanophore cells in their skin to a darker shade by: dynein motor proteins moving pigment granules inward toward the plus end of microtubules. kinesin motor proteins moving pigment granules inward toward the center of the cell. dynein motor proteins moving pigment granules outward from the center of the cell. dynein motor proteins moving pigment granules inward toward the center of the cell. kinesin motor proteins moving pigment granules outward from the center of the cell.

kinesin motor proteins moving pigment granules outward form the center of the cell

Which of the following is inhibited following a tap of a physician's reflex hammer just below the knee cap? Question 2 choices Choice A., motor neurons of the knee extensor muscles Choice B., sensory neurons of the knee extensor muscles Choice C., motor neurons of the knee flexor muscles Choice D., sensory neurons of the knee flexor muscles

motor neurons of the knee flexor muscles

The type of signaling cascade shown in the video directly affects which of these animal tissue types? A. muscle B. epithelial C. connective D. nerve

muscle

Tetanus is a(n): contraction where the muscle does not change length. abnormal muscle contraction. muscle contraction of sustained force resulting from repeated action potentials. contraction that slowly increases in force. contraction caused by a single action potential.

muscle contraction of sustained force resulting from repeated action potentials

In vertebrates, the speed of transmission along a neuron can be increased by which of the following? Question 3 choices Choice A., the presence of additional voltage-gated sodium channels Choice B., the presence of additional voltage-gated potassium channels Choice C., myelinating the axon Choice D., myelinating the dendrites

myelinating the axon

Thick filaments are made of ____________BLANK and thin filaments are made of ____________BLANK. Question 4 choices Choice A., actin; myosin Choice B., actin; myostatin Choice C., myosin; myostatin Choice D., myosin; actin

myosin; actin

Contraction of muscles is an example of how the motor protein _______BLANK interacts with the cytoskeletal elements called _____________BLANK to produce movement. Question 1 choices Choice A., actin; dynein Choice B., myosin; dynein Choice C., myosin; actin filaments Choice D., dynein; microtubules Choice E., kinesin; microtubules

myosin; actin filaments

In organisms with large genomes, inversions are more likely to be tolerated if the breakpoints occur in: open reading frames. closed reading frames. reciprocal translocations. noncoding DNA. coding DNA.

noncoding DNA

Which of the following point mutations is unlikely to change a protein's ability to function? (Select all that apply.) one that occurs in somatic cells one that occurs in a noncoding region of DNA one that occurs in germ cells one that creates a new codon that codes for an amino acid of the same size as that coded for by the original codon one that creates a new codon code for the same amino acid as the original codon

one that occurs in a noncoding region of DNA, one that creates a new codon code for the same amino acid as the original codon

In this example, what is acting as the homeostatic sensor? A. Insulin/Glucagon B. Glucose C. Hypothalamus D. Liver E. Pancreas

pancreas

In the figure above, at which labeled location will NaCl be at its highest concentration relative to the other solutes in the filtrate? Question 7 choices Choice A., point a Choice B., point b Choice C., point c Choice D., point d Choice E., point e

point c

n the figure above, where would you predict you would find the highest concentration of solutes in the filtrate? Question 4 choices Choice A., point a Choice B., point b Choice C., point c Choice D, point d Choice E., point e

point c

When you examine the cells lining the loop of Henle at the regions labeled in the figure above, where do you observe large numbers of mitochondria? Select all that apply. point a point b point c point d point e

point d and point e

In the figure above, where will urea be at its highest concentration relative to the other solutes in the filtrate? Question 6 choices Choice A., point a Choice B., point b Choice C., point c Choice D., point d Choice E., point e

point e

Signal molecules that are _______ usually have their corresponding receptor ______________of the cell. Choice A., nonpolar; on the surface Choice B., polar; in the cytoplasm Choice C., polar; on the surface

polar; on the surface

Selective serotonin reuptake inhibitors (SSRIs) block the function of serotonin reuptake transporters. Increased levels of serotonin in the synaptic cleft will most likely cause the ____________ neuron to __________ the frequency of action potentials A. Presynaptic; increase B. Presynaptic; decrease C. Postsynaptic; increase D. Postsynaptic; decrease

postsynaptic; increase

Under normal (resting) cellular conditions, the _________BLANK concentration is greater inside the cell, and the plasma membrane is most permeable to ______________BLANK. Question 3 choices Choice A., sodium; potassium Choice B., potassium; sodium Choice C., potassium; potassium Choice D., sodium; sodium

potassium; potassium

A researcher is using a small molecule as an inhibitor to manipulate a signaling pathway. This inhibitor prevents phosphorylation and MOST likely targets a: G protein-coupled receptor. G protein. ligand-gated ion channel. receptor kinase. phosphatase.

receptor kinase

Which type of cell-surface receptor undergoes changes in phosphorylation in response to binding of its ligand? G protein-coupled receptor both the G protein-coupled receptor and the receptor kinase receptor kinase ligand-gated ion channel

receptor kinase

In general, excretory organs function to do which of the following? Select all that apply. remove nitrogenous wastes from the circulating blood remove excess sugar from the circulating blood maintain water balance in the body maintain electrolyte balance in the body

remove nitrogenous wastes from the circulating blood, maintain water balance in the body, maintain electrolyte balance in the body

Which of the following best describes what is happening during Region 2 of the action potential? A. Repolarization due to cations leaving the cell B. Repolarization due to cations entering the cell

repolarization due to cations leaving the cell

The random thermal motion of molecules from a region of higher concentration to a region of lower concentration is called diffusion. The rate of diffusion across a barrier is defined by Fick's law of diffusion: Rate of diffusion = k * A * (C2 - C1) L k = diffusion coefficient, which depends on solubility and temperature A = surface area for exchange C2 - C1 = difference in partial pressure of gas on either side of the barrier L = thickness of the barrier to diffusion In the design of respiratory systems, respiratory membranes 1 and 2 represent membrane barriers between the outside medium and the inside of the organism. Which would have the higher rate of diffusion, respiratory membrane 1 or respiratory membrane 2? respiratory membrane 2 respiratory membrane 1

respiratory membrane 2

What is the basic contracting unit of a skeletal muscle? myosin actin filament myofibril sarcomere

sarcomere

A researcher is comparing the size of sarcomeres in mice to those in elephants. What will he find? Sarcomere size is relatively constant in vertebrates. As a result, mouse and elephant sarcomeres will likely be equal in size. Sarcomere size is proportional to the size of the animal; sarcomeres of elephants will be much larger than sarcomeres in mice. Sarcomere size is inversely proportional to animal size; sarcomeres in mice will be much larger than sarcomeres in elephants. It is impossible to determine sarcomere size in elephants and mice, given that sarcomeres are dynamic and are constantly changing in length and diameter.

sarcomere size is relatively constant in vertebrates. as a result, mouse and elephant sarcomeres will likely be equal in size

Sensory cells and sensory neurons allow multicellular animals to sense physical and chemical cues from their environment. What key properties of these cells enable them to perform this function? (Select all that apply.) A) All sensory cells and sensory neurons fire action potentials when they bind a signaling molecule. B) Sensory cells and sensory neurons have electrically excitable membranes that change in charge potential in response to binding an environmental signaling molecule. C) Sensory cells and sensory neurons have protein receptors linked to intracellular or membrane-based signaling pathways that alter ion channel permeability. D) Sensory neurons have myelinated dendrites that serve as nerve endings.

sensory cells and sensory neurons have electrically excitable membranes that change in charge potential in response to binding an environmental signaling molecule, sensory cells and sensory neurons have protein receptors linked to intracellular or membrane-based signaling pathways that alter ion channel permeability

The body fluid of sharks has a much lower concentration of sodium chloride than that of the surrounding seawater, and sharks are able to remain in osmotic equilibrium with the external environment. How can this be the case? Sharks maintain high levels of sodium chloride in their skin. None of the answer options is correct. Sharks drink large volumes of seawater to compensate for the low salt concentration of their body fluids. Sharks store enough urea to match the total solute concentration of the surrounding seawater. Sharks are osmoregulators.

sharks store enough urea to match the total solute concentration of the surrounding seawater

_________BLANK concentration is always higher outside the cell. During the peak of the action potential, the plasma membrane is becoming more permeable to _________BLANK. Question 4 choices Choice A., Sodium; potassium Choice B., Potassium; sodium Choice C., Potassium; potassium Choice D., Sodium; sodium

sodium; potassium

Which of the following correctly describe(s) the functioning of steroid hormones in the animal endocrine system? Select all that apply. Steroid hormones can change which mRNAs are produced in a cell. Steroid hormones have their primary effects in the cell's nucleus. In general, peptide hormones are slower to act than steroid hormones and their actions last longer than those of steroid hormones. Steroid hormones bind to cell-surface receptors, which then trigger second messengers.

steroid hormones can change which mRNAs are produced in a cell, steroid hormones have their primary effects in the cell's nucleus.

Which of the following would result in tetanus? A) stimulating a muscle fiber to contract immediately after it has relaxed B) stimulating a muscle fiber to contract when it has partially relaxed C) All of these choices are correct. D) stimulating the muscle fiber so frequently that it cannot relax at all E) allowing a muscle fiber to relax for several seconds between twitches

stimulating a muscle fiber so frequently that it cannot relax at all

How is synaptic signaling different from paracrine signaling? Synaptic signaling specifically involves neurotransmitters that are released from neurons. Synaptic signaling requires receptors to elicit a response in the target cell. Synaptic signaling acts over a longer distance than paracrine signaling. All of these choices are correct. Synaptic signaling is longer in duration than paracrine signaling.

synaptic signaling specifically involves neurotransmitters that are released from neurons

The initiation of the mammalian heart contraction: takes place at the AV node and requires neural input. takes place at the SA node. takes place at the AV node. requires neural input. takes place at the SA node and requires neural input.

takes place at the SA node

The hormone indicated by the small hexagon on the lower left in the figure could be which of the following? /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_38/38_57.jpg testosterone ADH insulin growth hormone

testosterone

In eukaryotes, the AUG codon that starts translation is: at the 5' end of the mRNA. None of the other answer options is correct. the AUG nearest the 5' cap on the mRNA. adjacent to the 5' cap on the mRNA. adjacent to a Shine-Dalgarno sequence.

the AUG nearest the 5' cap on the mRNA

Which of the following is the diffusible extracellular element in the process of vulval cell differentiation? the Notch receptor the EGF ligand the EGF receptor the Notch ligand

the EGF ligand

When an open reading frame (ORF) is identified, it may not actually correspond to the amino acid sequence of any polypeptide in the cell. Why not? (Select all that apply.) The ORF could be due to chance. It may contain one or more stop codons in the middle. The amino acid sequence may not match any known sequence. The DNA may not be transcribed into RNA.

the ORF could be due to chance, the DNA may not be transcribed into RNA

If secretion of adrenocorticotropic hormone (ACTH) is inhibited, then which of the following will result? The anterior pituitary gland would not release TSH. The thyroid gland would not release thyroid hormone. The posterior pituitary gland would not release ADH. None of the answer options is correct. The adrenal glands would not release cortisol.

the adrenal glands would not release cortisol

A rightward shift in the oxygen dissociation curve means that: the affinity of hemoglobin for O2 has decreased. the hemoglobin protein has denatured. the CO2 levels in the blood have decreased. the pH of the blood has increased. less O2 is released by hemoglobin to the body cells.

the affinity of hemoglobin for O2 has decreased

Which of the following are correct descriptions about the pituitary gland? Select all that apply. The general chemical nature of a hormone can be used to predict: The pituitary gland controls signaling from the hypothalamus. The anterior pituitary gland is under the control of the hypothalamus. The posterior pituitary gland is under the control of the hypothalamus. The pituitary gland acts as the control center for most other endocrine glands in the body. Even though the anterior and posterior pituitary have distinctly different functions, they formed from the same embryonic tissue.

the anterior pituitary gland is under the control of the hypothalamus, the posterior pituitary gland is under the control of the hypothalamus, the pituitary gland acts as the control center for most other endocrine glands in the body.

Which of the following statements about amino acids is INCORRECT? The more glycines that are found in a polypeptide's primary sequence, the more flexible the backbone of that polypeptide. At typical cellular pH, the R groups of basic amino acids are positively charged. The bridge between cysteines, which connects parts of a protein, is a stable but noncovalent interaction. A turn or kink in a protein is more likely to be induced by a proline than by a glycine. Not every amino acid is asymmetric.

the bridge between cysteines, which connects parts of a protein, is a stable but non covalent interaction

During the signal transduction process, the signal often triggers a signal transduction cascade. For example, an activated receptor activates hundreds of protein A. Each activated protein A activates hundreds of protein B and so on until a cellular response occurs. What purpose does this cascade serve? Having several intermediates allows for greater control of the response. Having a cascade allows the cell to respond to different signals. The cascade serves to amplify the signal, so one activated receptor can have a significant response. The cascade makes signaling easier to shut off or terminate.

the cascade serves to amplify the signal, so one activated receptor can have a significant response

One example of a cellular response to a signal is the triggering of cell division. If a mutation occurred in the gene for the signal receptor in this pathway that caused the receptor to reject binding of the signal, what response can be predicted? Choice A., The cell does not divide. Choice B., The cell divides repeatedly without the signal. Choice C., The signal is not produced.

the cell does not divide

Which of the following could be inhibited by greatly decreasing extracellular calcium? Question 5 choices Choice A., the arrival of the action potential at the presynaptic axon terminal Choice B., the production of neurotransmitter by the presynaptic neuron Choice C., the opening of voltage-gated calcium channels on the presynaptic axon terminal Choice D., the fusion of secretory vesicles with the presynaptic plasma membrane

the fusion of secretory vesicles with the presynaptic plasma membrane

Which of the following best describes the function of the hypothalamus? Question 2 choices Choice A., The hypothalamus produces the hormones that make up the endocrine system. Choice B., The hypothalamus connects the nervous system to the endocrine system. Choice C., The pituitary gland is that part of the hypothalamus that produces hormones. Choice D., The hypothalamus has endocrine hormone receptors that trigger the action potentials of the neurosecretory cells.

the hypothalamus connects the nervous system to the endocrine system

Predict what would happen to a neuron's resting membrane potential if the number of sodium ion channels increased. The membrane potential would become more negative. The membrane potential would remain the same due to the activity of the sodium-potassium pump. The membrane potential would become more positive. The membrane potential would become slightly more negative.

the membrane potential would become more positive

Which of the following determines whether or not an action potential is triggered in the postsynaptic neuron? Question 3 choices Choice A., the magnitude of the depolarizing excitatory postsynaptic potentials (EPSPs) Choice B., the magnitude of the hyperpolarizing inhibitory postsynaptic potential (IPSP) Choice C., the overall net change in membrane potential caused by the combined EPSPs and IPSPs

the overall net change in membrane potential caused by the combined EPSPs and IPSPs

As fluid moves through a vessel, which factors determine the flow resistance? (Select all that apply.) the radius of the vessel the viscosity of the fluid the pressure exerted by the heart the length of the vessel

the radius of the vessel, the viscosity of the fluid, the length of the vessel

How can researchers distinguish exons from introns in a segment of DNA? Only exons contain three-base sequences that can code for amino acids. Primers won't bind to introns. Exons have a characteristic sequence. The sequence of exons complements mRNA molecules in the cell.

the sequence of eons complements mRNA molecules in the cell

Signals from the sympathetic nervous system cause arteriole B to constrict. Arteriole B is most likely carrying blood to ________. (Hint: fight or flight) A.The brain B.The small intestine C.A leg muscle D.The heart

the small intestine

The motility of the digestive tract and secretion of digestive enzymes are optimized for digestion and absorption. For most nutrients, once material is in the digestive tract, the digestive system does not vary its rate of absorption according to body needs. A. Thisisanexampleofahomeostatic positive feedback mechanism B. This is an example of a homeostatic negative feedback mechanism C. This response is not homeostatic

this response is not homeostatic

Refer to the figure if needed to complete the following: The transduction of sound waves to changes in membrane potential takes place A) in the oval window, which vibrates at the same frequency as the original sound. B) in the basilar membrane as it vibrates at different locations. C) within the tectorial membrane as it is stimulated by the hair cells. D) when stereocilia bend against the tectorial membrane, causing hair cell depolarization. E) as the vibrations received by the outer ear cause the eardrum to vibrate.

when stereocilia bend against the tectorial membrane, causing hair cell depolarization

Secretion means excretion from the body. If excess salt ions need to be removed from the body, which direction must blood flow? blood flow up blood flow down

blood flow up

Which of the following statements explains why there is an elastic layer found in arteries, but not veins? Valves present in veins provide a mechanism for withstanding high blood pressure flow going through veins. Arteries are thicker than veins, and the elastic layer is necessary to support the additional weight of arteries. Blood pressure is higher in arteries than veins, and the elastic layer helps maintain the structure of the artery. The total length of arteries in the body is more than the total length of veins, and the elastic layer helps push the blood over the longer length.

blood pressure is higher in the arteries than veins, and the elastic layer helps maintain the structure of the artery

Which tumor has more chromosomal rearrangements? A. Tumor 1 B. Tumor 2 C. They are about the same D. Not enough information

tumor 1

The random thermal motion of molecules from a region of higher concentration to a region of lower concentration is called diffusion. The rate of diffusion across a barrier is defined by Fick's law of diffusion: Rate of diffusion = k * A * (C2 - C1) L k = diffusion coefficient, which depends on solubility and temperature A = surface area for exchange C2 - C1 = difference in partial pressure of gas on either side of the barrier L = thickness of the barrier to diffusion In the design of respiratory systems, respiratory membranes 1 and 2 represent membrane barriers between the outside medium and the inside of the organism. /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_39/39_36-37_20160405155723604.jpg 4. Which term in the equation above is different between respiratory membranes 1 and 2? L C2 - C1 k A

A

An EPSP of sufficient strength to reach threshold occurred at #1 on the figure. true false

true

The alpha subunit of a G-protein is free to diffuse in the plane of the membrane when: A. the alpha subunit gets phosphorylated. B. cyclic AMP binds to it. C. the alpha subunit gets dephosphorylated. D. GDP is exchanged for GTP. E. GTP is hydrolyzed into GDP and Pi.

GDP is exchanged for GTP

The ventricles finish filling with blood after the _______. A. Atria depolarize B. Atria repolarize C. Ventricles depolarize D. Ventricles repolarize

atria depolarize

Body functions such as heart rate, blood flow, and digestion are controlled by the _____ nervous system. autonomic somatic automatic voluntary

autonomic

Choose the correct statement that refers to either beneficial or pathogenic microbes: All microbes are beneficial but some are considered pathogenic because the host immune system does not recognize it. All microbes are pathogenic but we still tolerate some species without showing disease symptoms. Beneficial microbes develop a symbiotic relationship with the host and pathogenic microbes do not and cause disease symptoms in the host. Pathogenic bacteria help hosts utilize food sources, which they are not normally able to use.

beneficial microbes develop a symbiotic relationship with the host and pathogenic microbes do not and cause disease symptoms in the host

Based on these observation(s), what can you conclude about the ability of Pikas to regulate their body temperature? A. Pikas do not regulate their body temperature in any manner. B. Pikas regulate their body temperature by avoiding prolonged activity at low ambient temperatures. C. Pikas regulate their body temperature by increasing time spent below the rocks at high ambient temperatures. D. Pikas regulate their body temperature by spending more time on the surface of rocks during warm, sunny weather.

pikas regulate their body temperature by increasing time spent below the rocks at high ambient temperatures

In the figure above, which of the letters represents a region of the loop of Henle where water diffuses out of the filtrate? Select all that apply. point a point b point c point d point e

point a and point b

Assuming that active transport of electrolytes stop in the ascending limb, what would you predict the comparative composition would be of the filtrate at points a and e in the figure above? Question 8 choices Choice A., Point a has more water than point e. Choice B., Point a has more NaCl than point e. Choice C., Point e has more water than point a. Choice D., Point e has more NaCl than point e. Choice E., Points a and e have similar composition.

points a and e have similar composition

Researchers noted that about half of all species of bacteria contain small segments of DNA of about 20-50 base pairs derived from plasmids or viruses. The phrase clustered regularly interspaced short palindromic repeats (CRISPR) describes the organization of these viral DNA segments in the bacterial genome. Bacteria use CRISPR to: (Select all that apply.) "remember" the first time it was infected with a virus. transcribe RNA that combines with a protein that has a RNA-cleaving function. copy part of the bacteria genome and incorporate it into a viral genome. identify viral DNA by complementary base pairing with RNA. transcribe RNA that combines with a protein that has a DNA-cleaving function. identify viral DNA by complementary base pairing with template DNA.

"remember" the first time it was infected with a virus, identify viral DNA by complementary base pairing with RNA, transcribe RNA that combines with a protein that has a DNA-cleaving function

In separate studies of other nerve cells in other animals, researchers have recorded the following values for the resting membrane potential of the different nerve cells: -55 mv, -40 mv, -70 mv, -60 mv and -45 mv. What is the mean resting membrane potential of these cells? A. -40 mv B. +40 mv C. -54 mv D. -50 mv E. -60 mv

-54 mv

How many synapses are involved in the contraction of the knee extensor muscles in the knee-jerk reflex? Question 4 choices Choice A., 1 Choice B., 2 Choice C., 3 Choice D., 4

1

A retrotransposon known as Alu1 is about 300 base pairs in length and is present in the human genome in about 1 million copies. Approximately what percentage of the human genome is accounted for by this transposon? 30% 1% 10% 0.1% 0.03%

10%

The same red blood cell leaves the heart again, but this time instead of traveling to the liver, it travels to a skeletal muscle that is actively respiring. At each point on its journey (A-D), determine the oxygen saturation level (%) of the hemoglobin molecules found in this red blood cell. What is the approximate O2 saturation at point D? A. 75% B. 25% C. 40% D. 10% E. None of the above

10%

In the example of adrenaline signaling used in the animation, suppose each amplification step produces hundredfold active molecules. A signaling pathway resulting from a single activated signal receptor results in the consumption of _______BLANK molecules of GTP and _______BLANK molecules of ATP. Question 4 choices Choice A., 100; 1,000,000 Choice B., 100; 1,010,000 Choice C., 1; l00 Choice D., 10,000; 1,000,000

100; 1,010,000

A retrotranspon known as LINE1 is about 1000 base pairs in length and is present in the human genome in about 516,000 copies. Approximately what percentage of the human genome is accounted for by this transposon? 0.0017% 0.17% 1.7% 17% 0.017%

17%

If you were to use CRISPR to cleave DNA at sites flanking a gene, and in this way produce a deletion of the gene, how many sgRNAs would you need? /brainhoney/Resource/11009259,8,0,4E,3/Assets/LS%207C/gene%20image.png 4 2 3 1

2

Shown below is the start of a coding region within the fist exon of a gene. 5'-GCTCTTAGATATTCCACGACACAGCATGTCAAGAGAAGTACAGTAATGACGGACTAGTA-3' 3'-CGAGAATCTATAAGGTGCTGTGTCGTACAGTTCTCTTCATGTCATTACTGCCTGATCAT-5' How many Cas9 PAM sequences are present? 3 1 2 4 0

2

The three DNA fragments below are about to be sequenced using the primer 5'-CCGGG-3'. How many different sequencing reads will be recorded by this sequencing reaction? 5'-AATGGCGTCCTGATCCCGG-3' 3'-GGCCCGTTATCAGTGGTAA-5' 5'-CCGGGATCAGGACGCCATT-3' A.1 B.2 C.3 D.More than 3 E. No way to know

2

If the same muscle was activated at 80% of its muscle length, enabling its fibers to produce 80% of their maximum isometric force, how much force would 1 cm2 of actively contracting fibers produce? A. 250 N B. 2500 N C. 2000 N D. 200 N E. None of the other answer options are correct.

2000 N

A muscle's force depends on the total cross-sectional area of all fibers within it that are activated to contract. As shown in Fig. 37.9, if maximum isometric force produced by a muscle (at 100%) is 25 N/mm2, how much force would a muscle produce that has 1 cm2 in cross-section of actively contracting fibers? A. 25 N B. 250 N C. 2500 N D. 10 N E. None of the other answer options are correct.

2500 N

Shown below is the start of a coding region within the fist exon of a gene. 5'-GCTCTTAGATATTCCACGACACAGCATGTCAAGAGAAGTACAGTAATGACGGACTAGTA-3' 3'-CGAGAATCTATAAGGTGCTGTGTCGTACAGTTCTCTTCATGTCATTACTGCCTGATCAT-5' You design two sgRNAs that will allow you to model a deletion mutation that has been found in cancer cells. What size DNA fragment do you expect to delete using 2 sgRNAs? 28 bp 26 bp 27 bp 29 bp You cannot model deletion mutations using 2 sgRNAs

27 bp

Your computer records the raw sequencing data shown below. [~]/JT/LS 7C/Sequencing raw data.png How many different sequences are represented in this dataset? 1 3 4 2 5 or more

3

Shown below is the start of a coding region within the fist exon of a gene. 5'-GCTCTTAGATATTCCACGACACAGCATGTCAAGAGAAGTACAGTAATGACGGACTAGTA-3' 3'-CGAGAATCTATAAGGTGCTGTGTCGTACAGTTCTCTTCATGTCATTACTGCCTGATCAT-5' Which sequence could you use for your sgRNA? 3' GCTGTGTCGTACAGTTCTCT 5' 5' GCTGTGTCGTACAGTTCTCT 3' 3' CGACACAGCATGTCAAGAGA 5' 5' CGACACAGCATGTCAAGAGA 3'

3' GCTGTGTCGTACAGTTCTCT 5'

A template strand of DNA is read in the _____ direction in order to direct synthesis of RNA in the _____ direction. 3'-5'; 5'-3' 5'-3'; 3'-5' 3'-5'; 3'-5' 5'-3'; 5'-3'

3'-5'; 5'-3'

Shown below is the start of a coding region within the fist exon of a gene. 5'-GCTCTTAGATATTCCACGACACAGCATGTCAAGAGAAGTACAGTAATGACGGACTAGTA-3' 3'-CGAGAATCTATAAGGTGCTGTGTCGTACAGTTCTCTTCATGTCATTACTGCCTGATCAT-5' What is the PAM sequence of the bottom strand of DNA? 3'-AGG-5' 5'-AGG-3' 5'-CGG-3' 3'-GGT-5'

3'-GGT-5'

You are interested in using CRISPR to edit a particular gene in the genome. Select the correct order of events that must occur to introduce a double stranded DNA break using CRISPR/Cas9. 1. small guide RNA (sgRNA) hybridizes with the target DNA 2. Cas9 cuts DNA 3. Cas9/sgRNA complex binds PAM sequence 4. sgRNA binds Cas9 5. Cas9 unzips DNA 5, 1, 4, 3, 2 4, 3, 5, 1, 2 5, 4, 3, 1, 2 4, 1, 3, 5, 2

4,3,5,1,2

Shown below is the start of a coding region within the fist exon of a gene. 5'-GCTCTTAGATATTCCACGACACAGCATGTCAAGAGAAGTACAGTAATGACGGACTAGTA-3' 3'-CGAGAATCTATAAGGTGCTGTGTCGTACAGTTCTCTTCATGTCATTACTGCCTGATCAT-5' Which sequence could you use for your sgRNA? 3' GTTCTCTTCATGTCATTACT 5' 5' CAAGAGAAGTACAGTAATGA 3' 5' GTTCTCTTCATGTCATTACT 3' 3' CAAGAGAAGTACAGTAATGA 5'

5' CAAGAGAAGTACAGTAATGA 3'

The three DNA fragments above are about to be sequenced. Which primers could be used to sequence the following DNA fragments? Select all that apply. 5'-AATGG-3' 5'-CCGGG-3' 5'-CCATT-3' 5'-GGCCC-3'

5'-AATGG-3', 5'-CCGGG-3'

The three DNA fragments above are about to be sequenced. What is the nucleotide sequence that will be recorded from this synthesis reaction for the bottom (3rd) DNA fragment? 5'-CCGGGCAATAGTCACCATT-3' 5'-AATGGCGTCCTGATCCCGG-3' 5'-CCGGGATCAGGACGCCATT-3' 5'-AATGGTGACTATTGCCCGG-3'

5'-AATGGCGTCCTGATCCCGG-3'

Consider the single-stranded DNA template below. Which of the following primers would allow you to sequence this piece of DNA? 5'-ACCACTAACGTCAGT-3' A. 5'-ACTGAC-3' B. 5'-GTCAGT-3' C. 5'-AGTGGT-3'

5'-ACTGAC-3'

A double-stranded DNA molecule is being transcribed, only part of which is shown below. If the molecule is translated from left to right, one of the nucleotides shown in bold would be the first transcribed in this small molecule. 5'-ATGATCGGATCGATCCAT-3' 3'-TACTAGCCTAGCTAGGTA-5' Which of the following is the correct mRNA produced from the transcription of this DNA molecule? 5'-AUGAUCGGAUCGAUCCAU-3' 5'-UACUAGCCUAGCUAGGUA-3' 3'-AUGAUCGGAUCGAUCCAU-5' 3'-UACUAGCCUAGCUAGGUA-5'

5'-AUGAUCGGAUCGAUCCAU-3'

Your computer records the raw sequencing data shown below. [~]/JT/LS 7C/Sequencing raw data.png Which of the following sequences is (are) represented in this dataset? (Mark all that apply) 5'-CCGGAT-3' 5'-TAGGCC-3' 5'-CCGGAA-3' 5'-TAAGCC-3'

5'-CCGGAT-3', 5'-CCGGAA-3', 5'-TAAGCC-3'

About _________ of our human genome is composed of repetitive sequences. 75% 15% 20% 50% 1%

50%

If a muscle fiber is 10 mm long and its sarcomeres average 2.0 μm in length (close to their maximal force generation), how many sarcomeres are in series along the fiber's length? A. 50 B. 2000 C. 5000 D. 200

5000

How many exons are in this gene model? A. 9 B. 7 C. 6 D. 5 E. None of the above

7

A red blood cell has just left the right ventricle of the heart. It travels to the lungs, back to the heart, to the liver, and then back to the heart again. At each point on its journey (A-D), determine the oxygen saturation level (%) of the hemoglobin molecules found in this red blood cell. (You may assume the pH of the blood is 7.4.) What is the approximate O2 saturation at point D? A. 75% B. 30% C. 40% D. 10% E. None of the above

75%

About ________ of our human genome is transcribed into RNAs. 1% 15% 50% 20% 75%

75%

Given the temperature readings in the topmost tube (in the system diagrammed above), which of the following would be reasonable temperatures for points 1 to 5 in the lower tube? (same direction) Question 2 choices Choice A., 20 - 30 - 40 - 50 - 60 Choice B., 50 - 40 - 30 - 20 - 10 Choice C., 90 - 80 - 70 - 60 - 50 Choice D., 40 - 30 - 20 - 10 - 0

90 - 80 - 70 - 60 - 50

What is required to separate actin and myosin during sarcomere contraction? Question 1 choices Choice A., ADP and Pi Choice B., ATP Choice C., Actin and myosin do not separate during sarcomere contraction.

ATP

One of the functions of the cardiovascular and respiratory systems is to rid the body of CO2. Where does the CO2 come from? A. CO2 is a breakdown product of the carbohydrates oxidized in cellular respiration. B. CO2 is a breakdown product of the carbohydrates reduced in cellular respiration. C. CO2isproducedwheninhaledoxygencombines with carbon atoms from carbohydrates. D. CO2 is produced when the oxygen atoms of water combine with carbon atoms.

CO2 is a breakdown product of the carbohydrates oxidized in cellular respiration

Research suggests that learning may involve: Ca2+ influx into a postsynaptic cell, causing biochemical changes and enhanced response to stimulation. synaptic changes causing slower reuptake of neurotransmitter from the synaptic cleft. changes in action potential duration caused by blocking voltage-gated K+ channels. synaptic changes caused by decreasing the size of the synaptic cleft and increasing the effectiveness of neurotransmitter diffusion. strengthening the sodium-potassium pump.

Ca2+ influx into a postsynaptic cell, casting biochemical changes and enhanced response to stimulation

Based on the diagram shown here, ______ concentration in the duodenum is homeostatically regulated. A. Bicarbonate B. Bile C. CCK D. H+ ion E. Secretin

H+ ion

If the RNA transcript resulting from the DNA sequence above is present in the mRNA and translated codon by codon from one end to the other, which of the following polypeptides would correspond to this part of the mRNA? (Use Table 4.1 to answer this question.) /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_4/4_112.jpg NH2 - Tyr-Leu-Ala-Arg-Lue-Val -COOH COOH- Tyr-Leu-Ala-Arg-Lue-Val - NH2 COOH- Met-Ile-Gly-Ser-Ile-His - NH2 NH2 - Met-Ile-Gly-Ser-Ile-His -COOH

NH2 - Met-Ile-Gly-Ser-Ile-His -COOH

Continued glucose transport into cells lining the lumen of the small intestine requires a _________BLANK concentration gradient and a transmembrane protein that is a _________BLANK. Question 3 choices Choice A., glucose; glucose channel protein Choice B., K+; glucose channel protein Choice C., Na+; Na+-glucose cotransporter Choice D., Na+; K+-glucose cotransporter Choice E., K+; K+-glucose cotransporter

Na+; Na+-glucose cotransporter

The DNA sequence shown comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The bracketed codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. ...TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3' ...AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG-5' Which stop codon is used for this gene? A. UAA B. UAG C. UGA

UGA

Vascular endothelial growth factor (abbreviated VEGF and pronounced "Veg-F") is a peptide signaling molecule related to platelet-derived growth factor. VEGF is important in the formation of the circulatory system because its signaling pathway causes the formation of blood vessels in developing embryos during normal development. Tumors also produce and secrete VEGF, causing the formation of new blood vessels that supply these tumors. Given what you know about the different kinds of cell signaling and VEGF, which one of the following statements is TRUE? VEGF is an endocrine-signaling molecule because it circulates through the bloodstream inside of platelets. VEGF is a paracrine signaling molecule because it binds to receptors on cells at the site where new blood vessels are needed. VEGF is an endocrine-signaling molecule because it is released from platelets into the bloodstream and is carried throughout the body, causing widespread activation of platelet-derived growth factor receptors on cells in a variety of tissues.

VEGF is a paracrine signaling molecule because it binds to receptors on the cells at the site where new blood vessels are needed

Place the following events in the correct order. I. opening of voltage-gated calcium channels II. change in membrane potential of the postsynaptic neuron III. fusion of secretory vesicles with the plasma membrane of the axon terminal IV. binding of neurotransmitters to receptors on the postsynaptic neuron V. increase in cytosolic calcium levels in the presynaptic neuron VI. arrival of action potential at the axon terminal of the presynaptic neuron Question 4 choices Choice A., I, V, II, III, IV, VI Choice B., VI, I, V, III, IV, II Choice C., VI, II, I, V, III, IV Choice D., II, I, V, IV, III, VI

VI, I, V, III, IV, II

Based on the results shown in Fig. 37.9, the researchers: A. found experimental support for their hypothesis that muscle force depends on the overlap of actin and myosin filaments allowing cross-bridge formation within a sarcomere. B. found experimental support that muscles change length when they contract through shortening of myosin filaments. C. found experimental support that muscles change length by the relative sliding of adjacent actin and myosin filaments. D. found no support for their experimental hypothesis. E. A and C F. B and D

a and c

Refer to the graph pictured in Fig. 35.11c. Which of the following statements are true? A. The concentration of positively charged ions present inside the cell must increase to produce the positive spike of the action potential. B. The concentration of positively charged ions present inside the cell must decrease to produce the positive spike of the action potential. C. The concentration of negatively charged ions present inside the cell must increase to produce the positive spike of the action potential. D. The decrease in voltage after the action potential spike results from the movement of positive ions from the inside to the outside the nerve cell. E. The decrease in voltage after the action potential spike results from the movement of positive ions back into the nerve cell. F. A and D G. A and E

a and d

Cell survival depends on receiving and processing information. Signals come from a variety of sources. Which of the following is most likely NOT a signal? A. Awater-solublegrowthfactorsecretedby another cell B. A transmembrane protein on the surface of a cell C. A steroid hormone that travels through the bloodstream D. Apeptidehormonethattravelsthroughthe bloodstream E. A chain reaction or cascade of biochemical events

a chain reaction or cascade of biochemical events

Differentiating cells receiving the Skin signal becomes skin, but never neurons. How could this property of a cell becoming only one or the other of these two cell types be achieved? A. A Kinase activated by Transducer 2 of the skin pathway would target Transducer 1 of the Neural pathway B. A Phosphatase activated by Transducer 2 of the skin pathway would target Transducer 2 of the Neural pathway C. DIFF (skin) genes could include transcription factors that activate the DIFF (neural) genes D. Activation of Transducer 1 of the neural pathway would cause degradation of TF of the Skin pathway.

a phosphatase activated by Transducer 2 of the skin pathway would target Transducer 2 of the Neural pathway

A new hormone has been isolated from an organism. Although the structure of the hormone has not yet been determined, the hormone is known to exert its effects by forming a hormone-receptor complex that acts as a transcription factor within target cells. What type of hormone is this MOST likely to be? a steroid hormone either an amine or a peptide hormone either a steroid or a peptide hormone either a steroid hormone or an amine hormone a peptide hormone

a steroid hormone

What class of membrane-transport protein is associated with triggering an action potential? a sodium/potassium symporter a pump protein a voltage-gated ion channel a ligand-gated ion channel

a voltage-gated ion channel

The term "saltatory propagation" refers to the: role of ions such as sodium and potassium in producing the action potential. All of these choices are correct. ability of an action potential to "jump" from one node of Ranvier to the next. tendency of an action potential to move in one direction.

ability of an action potential to "jump" from one node of Ranvier to the next

In the example of adrenaline signaling, which steps represent an amplification of the signal? Question 1 choices Choice A., activated receptor activates G proteins, G protein binding by GTP, cyclic AMP activation of protein kinase A Choice B., activated receptor activates G proteins, activated adenylyl cyclase produces cAMP, active protein kinase A phosphorylates target proteins Choice C., receptor signal binding, activated receptor activates G proteins, activated adenylyl cyclase producing cAMP Choice D., receptor signal binding, activated adenylyl cyclase producing cAMP, active protein kinase A phosphorylating target proteins

activated receptor activates G proteins, activated adenylyl cyclase produces cAMP, active protein kinase A phosphorylates target proteins

The countercurrent arrangement of the two limbs of the loop of Henle becomes a multiplier of electrolyte concentration due to which other characteristic? Question 1 choices Choice A., water permeability of the descending limb Choice B., water impermeability of the ascending limb Choice C., active transport of electrolytes out of the ascending limb Choice D., thickness of the ascending limb

active transport of electrolytes out of the ascending limb

A decrease in cell adhesion, by the introduction of an experimental substance to a tissue, compromises the strength of the tissue. Which cell junction would MOST likely be affected if a tissue is treated with this experimental substance? A. adherens junctions B. gap junctions C. hemidesmosomes D.tight junctions

adherens junctions

You feel something brush past your arm. This sensation is sent to your brain by ______ neurons in the ______ nervous system. A. Afferent; central B. Efferent; central C. Afferent; peripheral D. Efferent; peripheral

afferent; peripheral

Insects, reptiles, and birds excrete uric acid as their form of nitrogenous waste. Uric acid is much less water-soluble than urea. Why does this allow these organisms to conserve more water than a mammal with extensive kidney tubules for water reabsorption? A. The high solubility of uric acid allows the excretory system to reabsorb water. B. Uric acid levels stay high in the blood maintaining a strong osmotic gradient, which allows water to be reabsorbed. C. After precipitation*, uric acid no longer influences osmolarity; water returns to the hypertonic tissues. D. After precipitation*, uric acid no longer influences osmolarity; water leaves the hypertonic tissues.

after precipitation, uric acid no longer influences osmolarity; water returns to the hypertonic tissues

Based on this experimental setup, what results do you predict? A. All experimental groups will show changes in body weight. B. Only the db/db + ob/ob experimental group will show changes in body weight C. Only the db/db + Lean (WT) and ob/ob + Lean (WT) experimental groups will show changes in body weight D. None of the experimental groups will show changes because they all die from septic shock

all experimental groups will show changes in body weight

DNA mutations can be synonymous or nonsynonymous. A synonymous mutation in a gene is the result of a point mutation that - although it changes one base to another - does not alter the structure of the protein the gene encodes. This is due to the fact that different codons can encode the same the amino acid. For example, a mutation that changes a UUU codon to UUC will still code for phenylalanine (see Table 4.1). In contrast, a nonsynonymous mutation in a gene changes the structure of its associated protein, and can result in amino acid differences or truncated proteins. The CSAC was able to predict the rate at which human and chimpanzee genetic sequences diverge - or the rate at which these sequences acquire mutations and evolve - by dividing the number of nonsynonymous mutations that occur in a genetic sequence by the number of synonymous mutations. The higher this ratio for a sequence of interest, the faster that sequence is diverging and evolving. See the data table below, which lists the rates of divergence between chimpanzees and humans for a subset of gene types. What could the researchers have concluded from these data? A. Genes involved in pregnancy are not evolving/diverging as rapidly as genes involved in the immune response. B. Genes involved in skin development and maintenance are evolving/diverging the fastest. C. Genes that produce antibiotic-like compounds are evolving/diverging rapidly when compared to genes involved in the transportation of amino acids. D. Genes involved in the formation of carbohydrates are evolving/diverging the slowest. E. All of the choices are correct.

all of the choices are correct

Certain medications can cause potassium levels in the body to decrease. Which symptom would be consistent with a loss of potassium? irregular heartbeat fatigue muscle weakness All of these choices are correct.

all of these choices are correct

Imagine that a student studies all night for an exam the next day. The student remembers (almost) everything for her test, but within a week she forgets most of what she studied. Why? New neural circuits were not formed (or strengthened) in the student's brain. The student has not studied the material she was tested on repeatedly. The student's short-term memories regarding the test material were not successfully transformed into long-term memories. All of these choices are correct.

all of these choices are correct

Mountcastle noted that within the somatosensory cortex, neurons that respond to the same type of stimulus (deep versus cutaneous) are arranged in vertical columns. One way Mountcastle discovered this vertical arrangement was by inserting a measuring device (to record action potentials) into the somatosensory cortex at different angles. This approach is depicted in Figure 3 below. Which of the following statements is true regarding measuring devices that were inserted into the brain at angles of 45° and 90°? Figure 3 A. The measuring device inserted into the brain at a 90° angle will likely encounter neurons belonging to the same vertical column. B. The measuring device inserted into the brain at a 45° angle will likely encounter neurons that belong to different vertical columns. C. All of the neurons encountered by the measuring device inserted into the brain at a 90° angle will likely respond to the same type of stimuli. D. Neurons encountered by the measuring device inserted into the brain at a 45° angle will likely respond to different types of stimuli. E. All of the choices are correct.

all of these choices are correct

Second messengers: are removed in order to terminate a cellular signaling response. amplify the effects of the signal. are small intracellular molecules that participate in signal transduction. All of these choices are correct. play a role in activation of intracellular signal transduction.

all of these choices are correct

Sensory transduction requires: A) reaction of a receptor protein with a stimulus. B) All of these choices are correct. C) alteration of the conformation of a channel protein. D) a change in membrane potential.

all of these choices are correct

Termination is an important step in adrenaline signaling because it: allows organisms to respond to new stresses. prevents an excessive response to adrenaline. allows an appropriate level of response. All of these choices are correct.

all of these choices are correct

The conformational change in opsin, triggered by the absorption of light by retinal, activates a G protein. What do G proteins do in the cell? G proteins can trigger the synthesis of second messengers. G proteins contribute to signal pathways. G proteins influence the activity of other proteins and enzymes in a cell. All these choices are correct.

all of these choices are correct

The data plotted in both panels of Fig. 37.9 show that: A. force is minimal at both short muscle lengths and long muscle lengths. B. force is maximal at an intermediate muscle length, which corresponds to maximal actin-myosin overlap within the sarcomere. C. at short lengths, adjacent actin filaments within a sarcomere interfere with each other and run into the Z-disc, disrupting the number of myosin cross-bridges that can form. D. All of these choices are correct.

all of these choices are correct

Voltage-gated ion channels underlie the function of electrically excitable cells, such as nerve and muscle cells. Which of the following statements is TRUE about voltage-gated ion channels? Voltage-gated ion channels open and close in response to changes in membrane potential. Voltage-gated ion channels vary in terms of how rapidly they respond to changes in membrane potential. Voltage-gated ion channels involve a conformational change of the transmembrane protein in response to membrane voltage that changes the channel's permeability to ion flow through the channel. All of these choices are correct.

all of these choices are correct

What is an SNP? Question 1 choices Choice A., a single nucleotide polymorphism Choice B., a location where individual alleles differ by one base pair Choice C., a genetic difference that can occur between different individuals Choice D., All of these choices are correct.

all of these choices are correct

Which of the following INCREASES the amount of oxygen that a fish can extract from the surrounding seawater? ventilation of the gills with the aid of an operculum All of these choices are correct. gills with a large surface area countercurrent exchange very thin lamellae

all of these choices are correct

Which of the following are sequence motifs? promoters open reading frame hairpin structures All of these choices are correct. coding region

all of these choices are correct

Which of the following statements is TRUE regarding the bacteria present in the stomachs or intestines of humans? Intestinal bacteria can produce important vitamins. All of these choices are correct. Many intestinal bacteria aid in digestion. Intestinal bacteria may play a role in immune system function. Some stomach bacteria have been associated with cancers.

all of these choices are correct

The force generated by a muscle depends on: Question 3 choices Choice A., the number of sarcomeres contracting. Choice B., the degree of overlap between actin and myosin in the sarcomeres. Choice C., the number of cross bridges between actin and myosin in the sarcomeres. Choice D., the amount of ATP available. Choice E., All of these responses are required for force generation.

all of these responses are required for force generation

The primary advantage of a signaling cascade is that it: A. limits an abundant extracellular signal to a smaller intracellular response. B. allows extracellular molecules to be taken into the cell to initiate a response. C. provides a mechanism to use a single signaling molecule to produce a response in multiple cells. D. allows a cell to quickly shut off all phosphorylation events inside that cell without the signaling molecule itself entering the cell. E. allows a large intracellular response from a small number of extracellular signal molecules.

allows a large intracellular response from a small number of extracellular signal molecules

Carbonic anhydrase inhibitors are commonly prescribed to treat glaucoma. A side effect could be ___________ in stomach pH. A. An increase B. A decrease C. No change

an increase

Which of the following statements about the control of blood volume and blood pressure is NOT true? Angiotensin II causes the smooth muscle in the walls of the arterioles to contract. None of the answer options is false. Inactive angiotensinogen is converted to angiotensin II by an enzyme released from the lungs. A drop in blood pressure stimulates the cells of the juxtaglomerular apparatus to release renin. Angiotensin II stimulates the release of antidiuretic hormone, which increases salt and water uptake by the distal convoluted tubule.

angiotensin II stimulates the release of antidiuretic hormone, which increases salt and water take by the distal convoluted tubule

During heavy exercise, the pO2 in muscle may drop to 20 mm Hg. Considering the oxygen-hemoglobin dissociation curve below, what is the approximate percent O2 saturation of hemoglobin in venous blood returning from skeletal muscles during heavy exercise? /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_39/39_65.jpg approximately 20% nearly 0% approximately 75% approximately 100% approximately 50%

approximately 20%

Choose the correct statement that describes bacterial feeding strategies in the developing and mature microbiome: D.Bacteria in the developing microbiome consume complex sugars and degrade them in to simple sugars in their intracellular environment while bacteria in the mature microbiome mostly degrade complex sugars in the extracellular environment and consume the simple sugars that result. A.Humans are born with the greatest amount of unique microorganism Bacterial feeding strategies of the developing microbiome is the same as the mature microbiome C.Bacteria present in the mature microbiome utilize a feeding strategy in which they consume complex sugars and degrade them in to simple sugars in their intracellular environment. B.Bacteria present in the developing microbiome utilize a feeding strategy in which they degrade complex sugars in the extracellular environment and consume the simple sugars that result.

bacteria in the developing microbiome consume complex sugars and degrade them in to simple sugars in their intracellular environment while bacteria in the mature microbiome mostly degrade complex sugars in the extracellular environment and consume the simple sugars that result

Recall that cats—and other nocturnal predators—have a greater number of rod cells in their eyes compared to cone cells. What would you predict about the color vision of cats? Cats have (relatively) poor color vision, but this is independent of the number of rod or cone cells. Because of the decreased number of cone cells, cats have excellent color vision. Because of the increased number of rod cells, cats have excellent color vision. Because of the decreased number of cone cells, cats have (relatively) poor color vision.

because of the decreases number of cone cells, cates have (relatively) poor color vision

Why does an action potential travel in one direction down an axon? because it needs to reach the synapse to trigger release of neurotransmitter because voltage-gated potassium channels remain open longer because the diffusion of charge can only occur in one direction because voltage-gated sodium channels cannot immediately reopen

because voltage-gated sodium channels cannot immediately reopen

We breathe more quickly and deeply when we exercise. Why does this make sense? (Select all that apply.) Because when we exercise, we produce more CO2 and increased ventilation is necessary to rid ourselves of CO2. Because when we exercise, we hydrolyze more ATP to ADP and Pi, and O2 is necessary for the hydrolysis, so we increase our intake of oxygen. Because when we exercise, we use more ATP, and additional O2 is necessary to generate sufficient ATP. Because when we exercise, we consume more CO2 and must increase ventilation to supply the CO2.

because when we exercise, we produce more CO2 and increased ventilation is necessary to rid ourselves of CO2, because when we exercise, we use more ATP, and additional O2 is necessary to generate sufficient ATP

During a typical cardiac cycle, the atria of the heart contract ______ the ventricles contract. A. Before B. After C. At the same time as

before

Mountcastle was able to determine the depths at which neurons that responded to different stimuli were located in the cat somatosensory cortex. The actual graph from his paper is shown below in Figure 4. What could he have concluded from these data? Figure 4 Data from Mountcastle, V. B., 1957. Modality and topographic properties of single neurons of cat's somatic sensory cortex. J Neurophysiol. 20: 408-34. A. Both neurons that fire action potentials in response to deep stimuli and neurons that fire action potentials in response to cutaneous stimuli are located at different depths in the brain (mostly between 0-2000 μm). B. Neurons that fire action potentials in response to cutaneous stimuli are most abundant at a depth of 200 μm. C. Neurons that fire action potentials in response to cutaneous stimuli are located near the surface of the brain (at a depth of 400 μm or less). D. Neurons that fire action potentials in response to deep stimuli are located only in the deepest layers of the brain (at a depth of 2000 μm or greater). E. No neurons that fire action potentials in response to deep stimuli are located at a depth of less than 500 μm. Correct!

both neurons that fire action potentials in response to deep stimuli and neurons that fire action potentials in response to cutaneous stimuli are located at different depths in the brain (mostly between 0-2000 um)

The interior of a neuron is more negative than the outside due to the presence of: chloride ions. proteins. hydroxyl (OH-) groups. both proteins and chloride ions.

both proteins and chloride ions

Which of the following occurs during systole? Both atria contract. Both ventricles contract. The ventricles fill with blood. The left ventricle contracts. The atria fill with blood.

both ventricles contract

How are sound vibrations amplified in a vertebrate ear? by movements of the basilar membrane induced by fluid vibrations by differences in the surface area of the eardrum versus the oval window by movement of the bones of the middle ear by movement of the bones of the middle ear and by differences in the surface area of the eardrum versus the oval window

by movement of the bones of the middle ear and by differences in the surface area of the eardrum versus the oval window

Which of the following could have been a hypothesis for the experiment described in Figure 35.11? A. Changes in membrane potential are gradual when a nerve cell transmits an action potential. B. Changes in membrane potential resist movements of charged ions across the membrane. C. Changes in membrane potential depend on movements of ions into or out of the cell. D. Changes in membrane potential occur rapidly to signal an action potential. E. C and D

c and d

When circulating _____ levels are too high, production of parathyroid hormone would be _____. calcium; stimulated glucose; stimulated glucose; inhibited cortisol; inhibited calcium; inhibited

calcium; inhibited

Vertebrate smooth muscle cells are activated when Ca+ binds to: myosin. troponin. myosin kinase. calmodulin. tropomyosin.

calmodulin

The Yanomami have more bacterial diversity than the US samples. A. True B. False C. Cannot be determined.

cannot be determined

Essential amino acids are those that: can only be found in plants. provide essential vitamins. cannot be synthesized biochemically and must be taken in through the diet. include minerals such as calcium and iron.

cannot be synthesized biochemically and must be taken in through the diet

Insertions and deletions of single nucleotides: cause missense mutations. cause frameshift mutations. add or delete amino acids to or from the normal polypeptide. shorten chromosomes. cause cancer.

cause frameshift mutations

Which one of the following choices contains structures found in the hindbrain? cerebral cortex limbic system cerebellum and pons thalamus and hypothalamus

cerebellum and pons

How might researchers experimentally test what ion leaves the axon, causing the axon to become re-polarized after firing an action potential? Researchers could: A. change the concentration of Cl- ions in the solution bathing the axon. B. change the concentration of Na+ ions in the solution bathing the axon. C. create a short-circuit across the axon's membrane so that the membrane potential remains at 0 volts. D. change the concentration of K+ ions in the solution bathing the axon.

change the concentration of K+ ions in the solution bathing the axon

ATP hydrolysis allows for what component of skeletal muscle contraction? the actin head to bind to tropomyosin the myosin head to bind to actin calcium levels in the cytoplasm to rise the reorientation of tropomyosin and troponin cocking of the myosin head to its high-energy position

cocking of the myosin head to its high-energy position

Water levels are adjusted to meet the osmoregulatory needs of the organism in the _____ of the nephron under the control of _____, also called vasopressin. collecting ducts; diuretic hormone collecting ducts; antidiuretic hormone distal convoluted tubule; antidiuretic hormone loops of Henle; antidiuretic hormone distal convoluted tubule; diuretic hormone

collecting ducts; antidiuretic hormone

The human body has about 10 bacterial cells for every eukaryotic cell. Bacteria coat our skin, gut, and mouth. Also present are protists, Archaeans, and viruses. Collectively, these organisms are our microbiota. For most members of our microbiota, our body provides their environment (or space to live). They, in turn, have no effect on us. This is an example of: mutualism. commensalism. predation. an antagonistic relationship.

commensalism

What accounts for the diversity of cell types and functions in humans relative to simpler animals, despite not having significantly more genes than simpler animals? (Select all that apply.) Complexity arises from different combinations of proteins. Humans gain more genes through horizontal gene transfer. Complexity arises from differential gene expression. Many human genes can encode multiple proteins.

complexity arises from different combinations of proteins, complexity arises from differential gene expression, many human genes can encode multiple proteins

Animals that survive in very dry habitats will likely have a more _________BLANK as a result of the _________BLANKsteps of the excretory process. Question 8 choices Choice A., dilute urine; reabsorption and secretion Choice B., dilute urine; filtration and secretion Choice C., concentrated urine; filtration and secretion Choice D., concentrated urine; reabsorption and secretion

concentrated urine; reabsorption and secretion

The system diagrammed above is an example of _________BLANK flow and is _________BLANK efficient than _________BLANK flow. ( same directions) Question 1 choices Choice A., concurrent; less; countercurrent Choice B., concurrent; more; countercurrent Choice C., countercurrent; less; concurrent Choice D., countercurrent; more; concurrent

concurrent; less; countercurrent

Which photoreceptor cell type is present at high concentration in the fovea? cone cells bipolar cells rod cells amacrine cells

cone cells

You take a human smooth muscle cell and block the release of calcium from the sarcoplasmic reticulum. What effect does that have on contraction of that smooth muscle cell, and why? Contraction is completely blocked because calcium binding to troponin is required for contraction. Contraction still occurs because contraction in smooth muscle is completely independent of Ca2+ levels. Contraction still occurs because Ca2+ can enter the cell directly through Ca2+ channels in the plasma membrane and bind to calmodulin. Contraction still occurs because Ca2+ can enter the cell directly through Ca2+ channels in the plasma membrane and bind to troponin. Contraction is completely blocked because calcium binding to calmodulin is required for contraction.

contraction still occurs because Ca2+ can enter the cell directly through Ca2+ channels in the plasma membrane and bind to troponin

The system diagrammed above is an example of _________BLANK flow and is _________BLANK efficient than _________BLANK flow. (opposite directions) Question 3 choices Choice A., concurrent; less; countercurrent Choice B., concurrent; more; countercurrent Choice C., countercurrent; less; concurrent Choice D., countercurrent; more; concurrent

countercurrent; more; concurrent

You are designing your first template for homologous recombination (HR) to insert a mutation (A→C) into Exon 1 of a gene using the CRISPR/Cas9 system. You realize that your HR template DNA is likely to be cut by Cas9. /brainhoney/Resource/11009259,8,0,4E,3/Assets/LS%207C/CRISPR%20HR%20template.png Which of the HR templates below would be a better option for this experiment? B A D E C

d

ACE inhibitors are drugs that inhibit an enzyme called ACE that converts angiotensin I into angiotensin II. Treatment with an ACE inhibitor will cause blood pressure to _________. A. Increase B. Decrease C. Stay the same

decrease

You are doing an experiment on a new class of G protein−coupled receptor. You make several cell lines that each express the receptor, the corresponding G protein, and adenylyl cyclase. Each cell line has different mutations in these components. You decide to measure cyclic AMP (cAMP) in the cells of each cell line to understand the effect of each of these mutations. Below is a list of mutations. For each, indicate whether the amount of cAMP in the cells will increase, decrease, or stay the same. 1. A mutation in the G protein−coupled receptor that prevents it from binding to the G protein. The amount of cAMP in cells will: stay the same decrease increase

decrease

You are doing an experiment on a new class of G protein−coupled receptor. You make several cell lines that each express the receptor, the corresponding G protein, and adenylyl cyclase. Each cell line has different mutations in these components. You decide to measure cyclic AMP (cAMP) in the cells of each cell line to understand the effect of each of these mutations. Below is a list of mutations. For each, indicate whether the amount of cAMP in the cells will increase, decrease, or stay the same. A mutation in the α unit of the G protein that prevents it from binding to adenylyl cyclase but not the receptor. The amount of cAMP in cells will: stay the same increase decrease

decrease

You are doing an experiment on a new class of G protein−coupled receptor. You make several cell lines that each express the receptor, the corresponding G protein, and adenylyl cyclase. Each cell line has different mutations in these components. You decide to measure cyclic AMP (cAMP) in the cells of each cell line to understand the effect of each of these mutations. Below is a list of mutations. For each, indicate whether the amount of cAMP in the cells will increase, decrease, or stay the same. A mutation of the G protein−coupled receptor that removes the extracellular domain of the receptor. The amount of cAMP in cells will: increase decrease stay the same

decrease

The most common oral contraceptives are a combination of an estrogen and a progesterone. Taking an oral contraceptive therefore _________ the level of LH circulating in the bloodstream. A.Increases B. Decreases C.Does not change

decreases

You turn on a light so you can get a glass of water. At the moment the light turns ON, the amount of neurotransmitters released by your rods and cones ________. A. Increases B. Decreases C. Does not change

decreases

You turn on a light so you can get a glass of water. At the moment the light turns ON, the concentration of cGMP inside your rods and cones ________. Increases Decreases Does not change

decreases

Deletions that eliminate a multiple of three nucleotides can: shorten chromosomes from the telomeres inward. delete amino acids in a polypeptide chain. cause frameshift mutations in an open reading frame. cause cancer in a subset of somatic cells. cause nonsense mutations in an open reading frame.

delete amino acids in a polypeptide chain

Which of the following best describes what is happening during Region 1 of the action potential? A. Hyperpolarization due to cations leaving the cell B. Depolarization due to cations leaving the cell C. Hyperpolarization due to cations entering the cell D. Depolarization due to cations entering the cell

depolarization due to cations entering the cell

A cell with a resting membrane potential of -70 mV suddenly becomes more permeable to Ca2+ ions. This cell will A. Hyperpolarize B. Depolarize C. Neither (membrane potential will not change)

depolarize

If a hair cell bends toward the kinocilium, K+ channels will open and the cell will _________. A. Depolarize B. Hyperpolarize C. Stay at the same membrane potential

depolarize

An individual with vitamin D deficiency will experience which of the following problems? nervous system disorders anemia slow wound healing difficulty absorbing sufficient amounts of calcium from the diet bleeding gums and loss of teeth

difficulty absorbing sufficient amounts of calcium from the diet

The _____ is the first section of the small intestine, where food enters from the stomach. jejunum duodenum gizzard ileum

duodenum

In eukaryotes, activator proteins bind to _____; generalized transcription factors bind to _____. terminators; RNA polymerases DNA polymerases; RNA polymerases promoters; terminators enhancers; promoters promoters; enhancers

enhancers; promoters

Based on the diagram below, which exon would contain the start codon (AUG)? /brainhoney/Resource/11009259,8,0,4E,3/Assets/LS7C%20Gene%20Model%20Video.JPG Exon 4 Exon 2 Exon 6 Exon 3 Exon 5 Exon 1

exon 2

Older individuals have fragile skin that causes bed sores. The outer layer of skin can detach and blister in response to friction. Increased susceptibility to blister formation is caused by the loss of which component in the skin? A. Skin signal pathway transducers B. Cell cytoskeleton proteins C. Cell adhesion molecules D. Extracellular matrix proteins

extracellular matrix proteins

8. Phylogenetic analysis of 16S rRNA-encoding gene sequences from fecal microbiota of control or patients with C. difficile associated diarrhea (both initial and recurrent episodes) are shown below. [~]/JT/LS 7C/Microbiome Chang et al 2008 data.png People with recurrent CDI have more resilient microbiomes. False True

false

A cell in a chick embryo is tested to determine whether it is a stem cell of some kind. The results of these tests find: 1. The SR receptor is present 2. DIV genes are on 3. The DIFF(skin) genes are blocked 4. TF of the neural pathway is in the cytoplasm 5. Transducer 2 of the skin pathway is not phosphorylated Based on these results answer A for True or B for False The cell will no longer expresses ID genes.

false

All DNA sequences are transcribed into RNA. False True

false

All introns have identical lengths and sequences. False True

false

All neurons have either a sensory or a motor function. True False

false

Atrazine inhibits the production of testosterone and enhances production of estrogen in frogs. Atrazine acts as an aromatase inhibitor. True False

false

Calcitonin and PTH are peptide hormones. Mark A for True or B for False Calcitonin and PTH bind to transport proteins in the blood.

false

Calcium is necessary for repolarization. True False

false

Cas9 recognizes the PAM sequence 5'-NGG-3' where "N" denotes any nucleotide. There are millions to billions of PAM sequences present throughout the human genome. Mark A for True or B for False: sgRNA can hybridize with DNA next to any of these PAM sequences.

false

Circle plots show changes in cancer genomes vs. the reference genome. Use the circle plot below to answer the following question. /brainhoney/Resource/11009259,8,0,4E,3/Assets/Circos%20diagram.png Regions of the genome with higher tumor/normal cell read copy ratios are more likely to be associated with intrachromosomal rearrangements. True False

false

Consider the figure below showing an EKG trace below the typical action potential for the sinoatrial node. Note: You haven't seen the action potential for the pacemaker cells in the text. Indicate whether the following statements are true or false. /brainhoney/Resource/11009259,8,0,4E,3/Assets/EKG1.jpg 1. Ventricular diastole occurs at the interval labeled 2 on the graph

false

Consider the figure below. Mark A for True or B for False. The cells around region B use more ATP than those in region G.

false

If a human DNA sequence is not evolutionary conserved, it does not have any important functions. True False

false

Imagine that a doctor encounters a patient carrying a mutation that reduces collagen production. As a result, the arteries of this patient will likely be stronger and more resistant to aneurysms compared to arteries in an individual not carrying this mutation. True False

false

In a muscle affected by Botox, Ca2+ channels in the SR will be mostly open. True False

false

In a muscle affected by Botox, myosin will be primarily bound to ATP True False

false

Mark A for True or B for False: This tumor probably has an extra copy of chromosome 8

false

One of the roles of the kidneys is to help buffer body fluids, to keep fluids from becoming too acidic or too basic. The cells of the renal tubule wall secrete H+ into the tubule lumen, and absorb bicarbonate, passing it into the tissue fluid. Consider the reaction catalyzed by the enzyme carbonic anhydrase, shown in the accompanying figure and below. /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_41/41_112.jpg During heavy exercise, the reaction shifts to the right in the interstitial fluid around the nephron. True False

false

Patients with recurrent CDI have microbiomes with decreased beta diversity. true false

false

Sequencing results can determine SNPs in cancer cells or provide evidence for large-scale mutations. You sequenced a tumor genome and a healthy tissue genome, then aligned your sequences with a reference genome. /brainhoney/Resource/11009259,8,0,4E,3/Assets/JT/LS%207C/Tumor%20vs%20healthy%20cell%20ratio.png The blank region indicated by the arrow means that there are more reads in cancer cells compared to healthy cells. True False

false

Stimulation by the parasympathetic nervous system increases the permeability of the SA node to potassium ions, whereas stimulation by the sympathetic nervous system decreases the permeability of the SA node to this same ion. true false

false

Suppose two patients have inherited mutated copies of BRCA1 and have developed breast cancer. You collect tumor samples from each patient and look at the mutations. Mark A for True or B for False: If they have children, these patients can pass all of the new tumor mutations on to their offspring.

false

Suppose two patients have inherited mutated copies of BRCA1 and have developed breast cancer. You collect tumor samples from each patient and look at the mutations. Mark A for True or B for False: These tumors will have mostly the same mutations.

false

Surprisingly, the Yanomami tribe have similar microbiomes to the US. A. True B. False C. Cannot be determined.

false

The DNA sequence shown below comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The underlined codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. ...TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3' ...AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG-5' /brainhoney/Resource/11009259,8,0,4E,3/Assets/codon%20chart.jpg A mutation that changes the nucleotide at position 20 from A to G is a silent mutation. False True

false

The body temperature of pika no. 144 changes with the same magnitude as the ambient temperature throughout the day. Answer A for True or B for False

false

The changes in voltage seen at #2 and #4 in the figure are caused by similar movements, in the same direction, of the same types of ions across the membranes. true false

false

The changes in voltage shown in the figure are due to ligand-gated ion channels opening and closing along the axon. true false

false

The complexity of an organism is proportional to the number of genes in its genome. True False

false

The loop of Henle is a countercurrent exchanger because it creates a concentration gradient rather than simply maintaining it. True False

false

The open reading frame starts at exon 2. False True

false

The pulmonary vein carries deoxygenated blood. True False

false

The trace in the figure is following the voltage change as it moves down the axon. true false

false

To maintain the accuracy of the genome sequence, the DNA should not be cut into small pieces before sequencing. True False

false

Using current DNA-sequencing technology, it is possible to sequence an entire chromosome (e.g., human chromosome 1, which contains approximately 250 million nucleotides) as one long molecule. False True

false

You are looking at DNA-protein binding data in a 14 kb region of the genome. /brainhoney/Resource/11009259,8,0,4E,3/Assets/ls7cnanog.jpg This data provides biochemical and evolutionary evidence of functionality for a non-coding region of the genome. False True

false

You have discovered a mutation in adenylyl cyclase (AC) that prevents it from binding the G protein. Answer A for True or B for False This mutation will lead to elevated cAMP levels in the absence of a signal.

false

You turn on a light so you can get a glass of water. At the moment the light turns ON, the Sodium (Na+) enters the cell. A. True B. False

false

You turn on a light so you can get a glass of water. BEFORE you turn on the light, the Effector Enzyme is activated. True False

false

f the receptor also activates a phosphatase that targets P1, it could still produce a functional signal transduction pathway. True False

false

Which of the following statements about the protonephridia of freshwater flatworms is CORRECT? Fluid from the body enters the protonephridia without first being filtered. The urine leaving the body of a freshwater flatworm is more concentrated than its body fluids. The fluid passing through the tubules is not modified before excretion. Muscular contractions drive fluid movement through the excretory tubules. Protonephridia are surrounded by a capillary network to allow for selective reabsorption and secretion.

fluid from the body enters the protonephridia without first being filtered

Freshwater fish are in a hypotonic environment. How do their gill chloride cells function in this environment? Freshwater fish have chloride cells that actively move chloride ions into the gills, with sodium ions moving in the opposite direction. Freshwater fish have chloride cells that actively move chloride ions into the gills, with sodium ions following. Freshwater fish have chloride cells that actively move chloride ions out of the gills into the surrounding water, with sodium ions moving in the opposite direction. Freshwater fish have chloride cells that actively move chloride ions out of the gills into the surrounding water, with sodium ions following.

freshwater fish have chloride cells that actively move chloride ions out of the gills into the surrounding water, with sodium ions following

Which of the following animals has a heart in which oxygenated and deoxygenated blood mix? bird frog fish human mammal

frog

A template DNA strand contains the sequence 3'-ATGCTGAC-5'. This strand is transcribed: from right to left. from left to right.

from left to right

After suffering a stroke, a patient may be unable to speak. The stroke has affected the _____ of the brain. frontal lobe parietal lobe occipital lobe cerebellum

frontal lobe

Bipolar cells carry signals from rods and cones to: horizontal cells. ganglion cells. the retina. the visual cortex of the brain.

ganglion cells

Suppose a point mutation occurs in the Cas9 gene that disrupts the protein's ability to cut DNA. What do you expect to observe? A. Cas9 will no longer bind to the target DNA B. sgRNA and target DNA will no longer hybridize C. Gene editing will no longer occur D. BandC E. A,B,andC

gene editing will no longer occur

Select the answer option that lists the levels of genetic information in order from smallest to largest. gene; chromosome; DNA strand; genome DNA strand; gene; genome; chromosome DNA strand; chromosome; gene; genome gene; DNA strand; chromosome; genome genome; gene; chromosome; DNA strand

gene; DNA strand; chromosome; genome

Which of the following CORRECTLY describes the path of excretory fluids through a mammalian nephron? collecting duct, proximal convoluted tubule, loop of Henle, distal convoluted tubule, Bowman's space, glomerulus glomerulus, Bowman's space, loop of Henle, proximal convoluted tubule, distal convoluted tubule, collecting duct glomerulus, Bowman's space, proximal convoluted tubule, loop of Henle, distal convoluted tubule, collecting duct glomerulus, Bowman's space, proximal convoluted tubule, distal convoluted tubule, loop of Henle, collecting duct Bowman's space, glomerulus, proximal convoluted tubule, distal convoluted tubule, loop of Henle, collecting duct

glomerulus, Bowman's space, proximal convoluted tubule, loop of Henle, distal convoluted tubule, collecting duct

A mutation in P4 causes it to be active all of the time (even when it's unphosphorylated). What would be the most likely consequence of this mutation? A. Glycogen will be made in the absence of insulin B. Glycogen will not be made in the presence of insulin C. Glycogen enzyme will be phosphorylated in the presence of insulin D. P3 will be phosphorylated in the absence of insulin

glycogen will be made in the absence of insulin

In Fig. 36.20, you see a neuron's firing rate depicted as vertical lines representing action potentials arranged along a horizontal line. During his work, Mountcastle often represented neuron firing data in this manner. For example, as part of his research Mountcastle applied constant pressure to (that is, touched) the skin on a cat's leg for several seconds, and measured the firing rates of neurons in the somatosensory cortex just before, during, and after this stimulus. For a single neuron, he acquired data similar to that depicted in Figure 6 below. Figure 6 However, these data can also be represented in a graph, with the neuron's firing rate plotted on the y-axis and time plotted on the x-axis. Which of the following graphs best depicts this firing rate data? Graph 1 Graph 2 Graph 3 Graph 4 Graph 5 A. Graph 1 B. Graph 2 C. Graph 3 D. Graph 4 E. Graph 5

graph 1

Although the exact cause of Meniere's Disease remains a mystery, which of the following could most reasonably be caused by a build up of excessive endolymph fluid? A. Auditory canal becomes blocked B. Hair cell function is altered C. Stapes can no longer vibrate D. Tympanic membrane is ruptured

hair cell function is altered

Bisphosphoglyceric acid (BPG) is a byproduct of glycolysis released into the bloodstream when an animal's supply of oxygen is low. Like protons, it decreases hemoglobin's affinity for O2. The effect of high BPG levels would be that: hemoblobin releases more of its bound O2 than it would without BPG. hemoglobin now binds more oxygen at low partial pressures than at high partial pressures. hemoglobin picks up more O2 in the lungs than it would without BPG. hemoglobin loses its cooperative binding of oxygen.

hemoglobin releases more of its bound O2 than it would without BPG

Which of the following is false? Question 1 choices Choice A., The actions of both the beta and alpha cells in the pancreas are stimulated or inhibited by the amount of glucose they detect in the blood as it passes through the pancreas. Choice B., In the pancreas, the action of the beta cells opposes the action of the alpha cells in regulating blood glucose levels. Choice C., High blood glucose levels can result from an overproduction of insulin. High blood glucose stimulates the _________BLANK cells in the pancreas to secrete _________BLANK. Choice D., The pancreas releases glucagon into the blood in response to low blood sugar and releases insulin into the blood in response to high blood sugar.

high blood glucose levels can result from an overproduction of insulin

An individual who is experiencing a prolonged period of stress would likely have _____ levels of circulating _____ than an individual who was not experiencing stress. higher; ADH lower; ADH lower; ACTH lower; cortisol higher; cortisol

higher; cortisol

Which part of the digestive tract is the predominant location for water and mineral absorption? hindgut crop foregut midgut

hindgut

. Which one of the following pairs of people has the exact same genome? father and son None of the other answer options is correct. fraternal twins mother and daughter identical twins

identical twins

Which of the following statements correctly describe(s) the relationship between the classes of hormones and their behavior or function? Select all that apply. The general chemical nature of a hormone can be used to predict: how soluble the hormone is in water. whether the hormone will be able to move through the cell membrane. whether the hormone interacts with receptors on the cell membrane. whether the hormone interacts with receptors inside the cell. whether the hormone will increase or decrease a specific cell function.

how soluble the hormone is in water, whether the hormone will be able to move through the cell membrane, whether the hormone interacts with receptors on the cell membrane, whether the hormone interacts with receptors inside the cell.

Choose the correct statement that describes the development of the human gut microbiome: B.Humans are born with the least amount of unique microorganism species in their gut, but by the time they reach an elderly age they have the greatest amount of unique microorganism species. A.Humans are born with the greatest amount of unique microorganism species in their gut and as they get older specific microbial species are eliminated through competition for resources. Humans have the same type and number of microorganism species present in their gut at birth and at death. C.Humans are born with the least amount of unique microorganism species in their gut and have greatest amount of unique species once they develop in to adulthood.

humans are born with the least amount of unique microorganism species in their gut, but by the time they reach an elderly age they have the greatest amount of unique microorganism species

In humans, the stomach secretes: (Select all that apply.) cellulase. hydrochloric acid. pepsin, an enzyme that digests proteins. amylase. enzymes that digest lipids.

hydrochloric acid, pepsin, an enzyme that digests proteins, enzymes that digest lipids

In the figure below, panel a shows a photoreceptor and its postsynaptic cell in the dark, and panel b shows both cells in the light. What causes the change observed in this figure? A) Hyperpolarization of the rod cell in the light inhibits release of a neurotransmitter. B) Hyperpolarization of the rod cell in the dark causes release of a neurotransmitter. C) This figure is incorrect; dark and light are reversed. D) Depolarization of the rod cell in the light inhibits release of neurotransmitter.

hyperpolarization of the rod cell in the light inhibits release of a neurotransmitter

In the dark your rod cells are releasing neurotransmitter on to the bipolar cells. In the dark, your bipolar cells are _________. A. Hyperpolarized B. Depolarized C. At resting membrane potential

hyperpolarized

Consider the figure below. Around point F, the extracellular fluid surrounding the nephron is _______ compared to the fluid in the lumen of the nephron. A. Hypertonic B. Hypotonic C. Isotonic

hypertonic

In vertebrates, the nervous system directly interacts with the _________BLANK to control endocrine function in the body. Question 1 choices Choice A., hypothalamus Choice B., anterior pituitary Choice C., posterior pituitary Choice D., adrenal cortex

hypothalamus

Which portion of the forebrain regulates the endocrine system and body temperature? limbic system hypothalamus thalamus cerebrum

hypothalamus

Crispr could ... create a deadly version of smallpox that is resistant to vaccines and can wipe out millions of people. a. Already happened. b. Hypothetically possible. c. Pure fiction

hypothetically possible

Crispr could ... enable blind adults to see. a. Already happened b. Hypothetically possible. c. Pure fiction.

hypothetically possible

Crispr could ... make babies immune to H.I.V. a. Already happened. b. Hypothetically possible. c. Pure fiction

hypothetically possible

Crispr could ... turn a small coastal town in Argentina into a destination for bespoke gene-editing solutions. a. Already happened. b. Hypothetically possible. c. Pure fiction

hypothetically possible

Crispr could ...make malaria-carrying mosquitoes extinct. a. Already happened. b. Hypothetically possible. c. Pure fiction.

hypothetically possible

You discover a new type of marine organism that has the kidneys of a fish but no gills. Based on what you know about other aquatic organisms, the newly discovered organism is _____ compared to the surrounding water. hypertonic hypotonic isotonic

hypotonic

The force generated by a long muscle varies as it contracts through its range of movement. At which point is the greatest force generated? Question 5 choices Choice A., at the beginning of the contraction when the muscle is at its greatest length Choice B., in the middle of the contraction when the muscle is at an intermediate length. Choice C., near the end of the contraction when the degree of actin and myosin filament overlap is greatest, and the muscle is at its shortest length

in the middle of the contraction when the muscle is at an intermediate length

A post-synaptic neuron can undergo synaptic plasticity in response to repeated excitation from a pre-synaptic neuron. Protein synthesis and changes to the cytoskeleton will likely _______ the responsiveness of the post- synaptic neuron to subsequent stimulation. A. Increase B. Decrease C. Not change

increase

Low levels of dietary iodine would cause the levels thyroglobulin in the thyroid to ________. A. Increase B. Decrease C. Not change

increase

Organophosphates inhibit the activity of the enzyme acetylcholinesterase (AChE). Exposure to organophosphates will therefore __________ muscle stimulation by motor neurons. A.Increase B.Decrease C.Not change

increase

Serotonin is a neurotransmitter. Selective serotonin reuptake inhibitors (SSRIs) block the function of serotonin reuptake transporters. Taking an SSRI will cause the average concentration of serotonin found in synaptic clefts to... A. Increase B. Decrease C. Not change

increase

Signals from the sympathetic nervous system cause arteriole B to constrict. As a result, the amount of blood flowing through the other three arterioles will ____________. A.Increase B. Decrease C.Not change

increase

Sometimes while traveling, people are infected with a protist parasite, Giardia. One of the side effects of Giardia infection is diarrhea. When someone has diarrhea, they lose excessive water and salt from the body. The result is loss of Na+, dehydration that leads to decreased extracellular volume and plasma volume, and decreased arterial blood pressure. Given this would the vasopressin secretion of a person infected with Giardia: increase decrease stay the same

increase

Suppose the set point for blood calcium suddenly increased. As a result, the amount of PTH released by the parathyroid would __________. A. Increase B. Decrease C. Stay the same

increase

You are doing an experiment on a new class of G protein−coupled receptor. You make several cell lines that each express the receptor, the corresponding G protein, and adenylyl cyclase. Each cell line has different mutations in these components. You decide to measure cyclic AMP (cAMP) in the cells of each cell line to understand the effect of each of these mutations. Below is a list of mutations. For each, indicate whether the amount of cAMP in the cells will increase, decrease, or stay the same. A mutation of the G protein−coupled receptor that allows it to bind the α subunit of the G protein in the absence of ligand. The amount of cAMP in cells will: increase stay the same decrease

increase

Muscle contractions have _____ force at slower shortening contraction velocities compared to higher shortening contraction velocities. decreased increased less stable equal

increased

During certain stressful moments, some individuals will begin to hyperventilate—that is, their breathing will be very shallow and quick. A by-product of hyperventilation is much lowered levels of CO2 in the blood. Which of the following would you also expect to find? (Select all that apply.) increased stimulation of chemoreceptors in the brainstem decreased blood pH, less than 7.2. increased blood pH, greater than 7.2 decreased stimulation of chemoreceptors in the brainstem

increased blood pH, greater than 7.2, decreased stimulation of chemoreceptors in the brainstem

What benefit would high bacterial diversity likely give its host? A. Increased beta diversity B. Increased colonization resistance C. Decreases stability and resilience D. Decreases energy utilization and digestion

increased colonization resistance

Increased osmolarity of body fluids__________ ADH secretion A. Increases B. Decreases C. Has no effect on

increases

The researchers' experimental hypothesis was that changes in actin and myosin overlap would alter the number of myosin cross-bridges that could form within a sarcomere, and specifically that: A. increases in overlap favor more cross-bridges to form, increasing muscle force. B. increases in overlap disrupt cross-bridge formation, reducing muscle force. C. differences in overlap and cross-bridge formation have little effect on muscle force. D. overlap is minimal at intermediate sarcomere (and muscle fiber) lengths. E. None of the other answer options is correct.

increases in overlap favor more cross-bridges to form, increasing muscle force

When the diaphragm contracts, the volume of the lungs _____ and the pressure in the lungs ______ A. Increases; increases B. Increases; decreases C. Decreases; increases D. Decreases; decreases

increases; decreases

Neuron A releases a neurotransmitter that binds to a ligand-gated chloride channel in the plasma membrane of Neuron C. The synapse between Neuron A and Neuron C is most likely: A. Excitatory B. Inhibitory C. No idea...

inhibitory

Insulin injections are an important treatment for some diabetics. A serious potential side effect of insulin injections is hypoglycemia (low blood sugar). This would most likely occur under which of the following circumstances? Question 3 choices Choice A., failure to inject enough insulin Choice B., injecting too much insulin Choice C., failure to inject any insulin

injecting too much insulin

Meniere's Disease is linked to an excessive volume of endolymph fluid. Where in the ear is endolymph found? A. Outer ear B. Middle ear C. Inner ear D. B and C E. A,B,andC

inner ear

Which of the following statements correctly describe(s) peptide hormones? Select all that apply. Insulin and glucagon are good examples of peptide hormones. Most peptide hormones act on cells by binding to receptors on cell surfaces and triggering signaling cascades inside the cell. Enzymes modify cholesterol compounds to produce peptide hormones. The action of peptide hormones can cause changes in gene expression or can affect the function of metabolic enzymes in cells. Peptide hormones bind to intracellular receptors and the peptide-receptor complex acts as a transcription factor.

insulin and glucagon are good examples of peptide hormones, most peptide hormones act on cells by binding to receptors on cell surfaces and triggering signaling cascades inside the cell, the action of peptide hormones can cause changes in gene expression or can affect the function of metabolic enzymes in cells

In many cells, the adhesion to the extracellular matrix through integrins causes the activation of kinases in the cytoplasm. This suggests that: integrins are kinases. extracellular matrix proteins are receptors and integrins are ligands. integrins promote the activation of signal-transduction pathways.

integrins promote the activation of signal-transduction pathways

A chromosomal mutation where a segment breaks off, flips, and then reattaches itself is called a(n): inversion. translocation. reciprocal translocation. deletion. duplication.

inversion

Many mutations in receptor kinases that lead to cancer allow the receptor to dimerize and become activated, even in the absence of signaling molecules. An example is a mutant form of the EGF receptor kinase called Her2/neu. An antibody that prevents dimerization of Her2/neu receptor kinases is being tested for its effectiveness in preventing cancer. At which stage does this drug work? It prevents the signaling cell from producing the signal. It prevents the termination of the signal. It prevents the receptor from becoming activated. It prevents the receptor from binding to the signal.

it brevets the receptor from being activated

f a mutation caused the G protein to become permanently bound to GTP, what result can be predicted? Question 5 choices Choice A., It constantly signals its pathway to be "on." Choice B., It constantly signals its pathway to be "off." Choice C., It is unable to signal subsequent steps in the pathway. Choice D., It is unable to separate from the beta and gamma subunits.

it constantly signals its pathway to be "on"

What is the function of the vasa recta? It helps determine the final concentration of the urine. None of the answer options is correct. It filters the blood within the glomerulus. It secretes the hormone renin in response to a drop in blood pressure. It maintains the concentration gradient established by the loop of Henle.

it maintains the concentration gradient established by the loop of Henle

Chemoreceptors in the circulatory system detect changes in circulating <i>p</i>CO₂. If CO₂ concentrations get too high, the rate of ventilation increases. Why does this make sense? It makes sense because hemoglobin carries CO₂ and therefore blocks oxygen binding to the heme site, creating an oxygen deficiency. Actually it doesn't make sense. There is no relationship between CO₂ and ventilation rate. It makes sense because CO₂ is formed from O₂, and therefore CO₂ is a sign that oxygen is being consumed. It makes sense because tissues that are more actively working produce more CO₂.

it makes sense because tissues that are more actively working produce more CO₂

Which of the following are TRUE about the resting membrane potential? (Select all that apply.) It results from K+ ions diffusing out of the cell. It results from voltage-gated sodium channels remaining open for long periods of time. It results from the sodium-potassium pump moving more Na+ ions out of the cell than K+ ions into the cell.

it results from K+ ions diffusing out of the cell, it results from the sodium-potassium pump moving more Na+ ions out of the cell than K+ ions into the cell

You are examining a patient whose thyroid produces very little calcitonin. This patient will most likely have ______ calcium in their bones compared to a healthy individual. A.More B.Less C.The same amount of

less

Mutation rate in germ-line cells occur___________________ in somatic cells. less often than more often than at the same rate as

less often than

What percentage of oxygen in the air is typically extracted by the mammalian lung when an animal is resting? 26-50% 76-90% 51-75% 91-100% less than 25%

less than 25%

You are using mice to study the relationship between gut microbes and metabolism. You have three types of mice: mice with no microbes (GF), mice with normal microbes (CONV-R), and mice that were born GF but colonized with normal microbes as adults (CONV-D). Mice that have gut microbes eat _____ and have ________ metabolic rate compared to germ-free (GF) mice. A. More; a higher B. More; a lower C. Less; a higher D. Less; a lower

less; a higher

Shown here are four ligands (M, H, K, and L) and their corresponding receptors along with three genes (U, V, and W) whose activity the receptor controls through signal transduction. The arrows indicate gene activation, the T-bars indicate gene repression. /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_20/20_189.jpg If either U or V is required to activate W, which ligand (or ligands) result in W being active? (Select all that apply.) ligand M ligand H ligand K ligand L None of the answer options is correct.

ligand M, ligand H, ligand K

Shown here are four ligands (M, H, K, and L) and their corresponding receptors along with three genes (U, V, and W) whose activity the receptor controls through signal transduction. The arrows indicate gene activation, the T-bars indicate gene repression. /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_20/20_201.jpg If both U and V are required to activate W, which ligand (or ligands) result in W being active? ligand K -u off, v on, w on ligand L - u and v off, w on ligand M- u,v,w on ligand H- u on, v off, w on None of the answer options is correct.

ligand m

Ligand-gated ion channels are found within the postsynaptic neuron's cell membrane. Why are ligand-gated ion channels critical to how synapses communicate information? (Select all that apply.) Ligand-gated ion channels allow the postsynaptic cell to control, through intracellular signaling, to which neurotransmitters the postsynaptic cell responds. Ligand-gated ion channels open more rapidly than voltage-gated ion channels. Ligand-gated ion channels are found within a neuron's dendrites but not its axon. Ligand-gated ion channels enable specific neurotransmitters released by presynaptic neurons to exert either excitatory or inhibitory effects on the postsynaptic cell.

ligand-gated ion channels are found within a neurons dendrites but not its axon, ligand-gated ion channels enable specific neurotransmitters released by presynaptic neurons to exert either excitatory or inhibitory effects on the postsynaptic cell

What kind(s) of ion channels would you expect to find in the plasma membrane of a neuron's dendrites? A. Ligand-gated ion channels only B. Voltage-gated ion channels only C. Both of these channels

ligand-gated ion channels only

Which of the following brain regions controls drives, instincts, and emotion? cerebellum thalamus cerebrum limbic system

limbic system

The pancreas produces a variety of secretions, including: (Select all that apply.) methane from fermentation. lipase for fat digestion. bicarbonate ions to neutralize stomach acid. trypsin for further protein digestion. gastrin to stimulate HCl production.

lipase for fat digestion, bicarbonate ions to neutralize stomach acid, trypsin for further protein digestion

Some people have low levels of calcium circulating in the blood, a condition known as hypocalcemia. While for many this disorder has little to no effect, for some it can be life-threatening. How could low levels of calcium harm an individual? A. low levels of calcium would cause sustained depolarization of the presynaptic cell B. low levels of calcium would not have any effect on synaptic transmission C. low levels of calcium would result in fewer signals sent between the pre- and postsynaptic cell

low levels of calcium would result in fewer signals sent between the pre- and postsynaptic cell

Some people have low levels of calcium circulating in the blood, a condition known as hypocalcemia. While for many this disorder has little to no effect, for some it can be life-threatening. How could low levels of calcium harm an individual? Low levels of calcium would cause sustained depolarization of the presynaptic cell. Low levels of calcium would result in fewer signals sent between the pre- and postsynaptic cell. Low levels of calcium would not have any effect on synaptic transmission.

low levels of calcium would result in fewer signals sent between the pre- and postsynaptic cell

At the time that the ventricles begin to empty, blood pressure in aorta is _______ blood pressure in the ventricles. A. Higherthan B. Lower than C. The same as D. No way to know!

lower than

If salt moves across secretory cells by passive transport mechanisms, which side of the secretory cell must contain a higher concentration of salt ions? lumen of the blood vessel lumen of the secretory tube

lumen of the blood vessel

Ovulation is triggered by a surge of which of the following hormones? progesterone testosterone estrogen luteinizing hormone follicle stimulating hormone

luteinizing hormone

Which of the following is not part of a microarray used to detect SNPs? Question 2 choices Choice A., short DNA sequences attached to a glass slide Choice B., oligonucleotides that match the sequence of a known SNP site in the genome Choice C., mRNAs that are expressed from a specific gene Choice D., short DNA sequences synthesized with a specific sequence Choice E., oligonucleotides that differ in sequence only at the SNP itself and are positioned at different locations on a glass slide

mRNAs that are expressed from a specific gene

Imagine you created a toxin such that when a neuron fired an action potential, the toxin would bind immediately to the sodium-potassium pump at the top of the action potential, but the sodium and potassium channels would still function. What process(es) would be affected? A. the depolarization phase of an action potential B. returning to resting potential after the hyperpolarization phase of an action potential C. maintaining resting potential and returning to resting potential after the hyperpolarization phase of an action potential D. the hyperpolarization phase of an action potential E. maintaining resting potential

maintaining resting potential and returning to resting potential after the hyperpolarization phase of an action potential

Which of the following is not true of muscle fibers? Question 3 choices Choice A., Muscle fibers have more than one nucleus. Choice B., Actin and myosin filaments are arranged in parallel along the longitudinal axis on the myofibril. Choice C., Movement is generated by muscles when actin filaments interact with myosin filaments. Choice D., Many muscle fibers are packaged into a muscle fibril.

many muscle fibers are packaged into a muscle fibril

Imagine a gene in which the sequence that is transcribed into a GAG codon, which codes for glutamic acid, is mutated to GUG, which codes for valine. What type of mutation is this? missense frameshift nonsense base pair deletion silent

missense

The DNA sequence shown comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The bracketed codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. ...TTCAAGACAGAAGGGCcTGACTCAGACTGACATTCTCC-3' ...AAGTTCTGTCTTCCCG gACTGAGTCTGACTGTAAGAGG-5' Consider a mutation that changes the boxed nucleotide from C to A. What kind of mutation is this? A. Silent B. Missense C. Nonsense D. Frameshift E. Non-coding

missense

Imagine that a researcher is comparing the sequence of several protein-coding genes among mice, rabbits, and humans. She finds that, for most of these genes, the rabbit sequences are more similar to the human sequences than are the mouse sequences. What can she deduce? More sequences are conserved between rabbits and humans than between humans and mice. Humans and mice do not share a common ancestor. No similar proteins exist in mice and humans. Mice and humans share a more "recent" common ancestor than do rabbits and humans. Mice and rabbits do not share a common ancestor.

more sequences are conserved between rabbits and humans than between humans and mice

The cells that make up skeletal muscles are called: Question 1 choices Choice A., muscle bundles. Choice B., muscle fibers. Choice C., myofibrils. Choice D., sarcomeres.

muscle fibers

A mutation is defined as a change in the base sequence of a DNA molecule. Sometimes mutations cause no obvious changes, but other times mutations can have profound effects on the synthesis or the function of a protein. The nucleotide sequences of the DNA molecules in the figure below are the same except for a single base pair mutation highlighted in yellow. (In each instance, the bolded base pair is the starting point of transcription.) Normal sequence 5'-ATGATCGGATCGATCCAT-3' 3'-TACTAGCCTAGCTAGGTA-5' Mutation I 5'-ATGATCGGATTGATCCAT-3' 3'-TACTAGCCTAACTAGGTA-5' Mutation II 5'-ATGATCGGATAGATCCAT-3' 3'-TACTAGCCTATCTAGGTA-5' Mutation III 5'-ATGATCGGAACGATCCAT-3' 3'-TACTAGCCTTGCTAGGTA-5' Which of the mutations above would cause the synthesis of an incomplete (shorter than normal) version of the protein? mutation II mutation I None of the other answer options is correct. mutation III

mutation II

A mutation is defined as a change in the base sequence of a DNA molecule. Sometimes mutations cause no obvious changes, but other times mutations can have profound effects on the synthesis or the function of a protein. The nucleotide sequences of the DNA molecules in the figure below are the same except for a single base pair mutation highlighted in yellow. (In each instance, the bolded base pair is the starting point of transcription.) Normal sequence 5'-ATGATCGGATCGATCCAT-3' 3'-TACTAGCCTAGCTAGGTA-5' Mutation I 5'-ATGATCGGATTGATCCAT-3' 3'-TACTAGCCTAACTAGGTA-5' Mutation II 5'-ATGATCGGATAGATCCAT-3' 3'-TACTAGCCTATCTAGGTA-5' Mutation III 5'-ATGATCGGAACGATCCAT-3' 3'-TACTAGCCTTGCTAGGTA-5' Which of the mutations above would be least likely to cause a change in the function of the protein? None of the other answer options is correct. mutation II mutation III mutation I

mutation III

The CSAC also evaluated the extent to which exon and intron regions within chimpanzee and human genes diverged. They noted that - on average - exons are much less likely to diverge between these two species compared to introns. What could explain this discrepancy in the divergence of exons and introns in humans and chimpanzees? A. Mutations in exons could result in aberrant proteins. Thus, exons are less likely to diverge than introns. B. Mutations in introns can result in proteins with novel (positive) functions. Thus, introns are more likely to diverge than exons. C. All exons contain U bases, but introns do not. The U bases make exons resistant to mutations. Thus, exons are less likely to diverge than introns. D. If exons contained many mutations, this could interfere with their removal from mRNA. Thus, exons are less likely to diverge than introns. E. Introns are larger stretches of DNA compared to exons, and mutations in large DNA regions have less of an impact on the structure or function of proteins (mutations in large areas are diluted). Thus, introns are more likely to diverge than exons.

mutations in exons could result in aberrant proteins. Thus, exons are less likely to diverge than introns

When stomach acid reaches the duodenum, it triggers the release of bicarbonate ions, which increase the pH of the duodenum. This is an example of: A. Negative feedback B. Positive feedback C. Neither; this is not a feedback system

negative feedback

What is the difference between negative feedback and positive feedback mechanisms? Negative feedback mechanisms stabilize a system at a set point; positive feedback mechanisms change the set point. Negative feedback mechanisms return a system to a set point; positive feedback mechanisms amplify a response. Negative feedback mechanisms move a system away from a set point; positive feedback mechanisms stabilize a system at a set point.

negative feedback mechanisms return a system to a set point; positive feedback mechanisms amplify a response

Which of the following sequences is (are) represented in this dataset? A. 5'-CCGGTA-3' B. 5'-CGGGTA-3' C. Both of these D. Neither of these

neither of these

Consider two chambers of equal volumes. The chambers are separated by a selectively permeable membrane that only allows water through. 5 large particles on left, 14 small on the right What will happen to the water molecules? A. Net movement to the right B. Net movement to the left C. No net movement

net movement to the right

Consider two chambers of equal volumes. The chambers are separated by a selectively permeable membrane that only allows water through. more solute on right What will happen to the water molecules? A. Net movement to the right B. Net movement to the left C. No net movement

net movement to the right

When Mountcastle performed his experiments, he likely recorded action potentials in cats that were sedated and lying on their sides. If he was studying the response of somatosensory neurons to cutaneous stimuli such as skin pressure or touching the hair, how could he have checked that the action potentials he was recording were fired in response to the specific stimuli he was applying - and not fired in response to the stimulus of a table touching the cat's skin or hair? A. Neurons in the right side of the somatosensory cortex respond to stimuli applied to the left side of the body (and vice versa). Thus, Mountcastle could have laid a cat on its right side and touched the left leg. He could have taken recordings of action potentials fired by neurons in the right side of the brain. B. Neurons in the right side of the somatosensory cortex respond to stimuli applied to the right side of the body (and vice versa). Thus, Mountcastle could have laid a cat on its left side and touched its right leg. He could have taken recordings of action potentials fired by neurons in the right side of the brain. C. Neurons in the right side of the somatosensory cortex can respond to stimuli applied to either the right or left side of the body. Mountcastle would not have been able to distinguish between action potentials fired in response to the stimuli he was introducing and the stimulus of the table the cat was laying on. D. None of the other answer options is correct.

neurons in the right side of the somatosensory cortex respond to stimuli applied to the left side of the body (and vice versa). Thus, Mountcastle could have laid a cat on its right side and touched the left leg. He could have taken recordings of action potentials fired by neurons in the right side of the brain

When an action potential reaches the axon terminal: Question 1 choices Choice A., sodium ions are released from the axon terminal, enter the cell body of the postsynaptic neuron through its sodium channels, and may initiate an action potential in that neuron. Choice B., calcium ions are released from the axon terminal, bind to and open the sodium channels on the cell body of the next neuron, and may initiate an action potential in that neuron. Choice C., neurotransmitter molecules are released from the axon terminal, bind to and open the potassium channels on the cell body of the next neuron, and may initiate an action potential in that neuron. Choice D., neurotransmitter molecules are released from the axon terminal and bind to receptors on the postsynaptic neuron, causing either an inhibitory hyperpolarization or an excitatory depolarization.

neurotransmitter molecules are released from the axon terminal and bind to receptors on the postsynaptic neuron, causing either an inhibitory hyperpolarization or an excitatory depolarization

You discover a new type of marine organism that has the kidneys of a fish but no gills. What effect would the absence of gills have on excretion of nitrogenous waste? No effect. Fish kidneys excrete all nitrogenous waste. Nitrogenous excretion decreases because no nitrogen uptake is occurring at the gills. No effect. Nitrogenous wastes diffuse across the skin. Nitrogenous excretion increases at the kidneys because it cannot be lost at the gills.

nitrogenous excretion increases at the kidneys because it cannot be lost at the gills

Imagine you genetically engineered a neuron to produce voltage-gated Na+ and K+ channels that opened at the same time in response to a change in voltage. How would that change the recording shown in the figure? /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_35/35_76.jpg The peak would occur over a longer period of time. The peak voltage would be higher. No action potential would be generated. Threshold values would increase. The period of hyperpolarization would be longer.

no action potential would be generated

Imagine you genetically engineered a neuron to produce voltage-gated Na+ and K+ channels that opened at the same time in response to a change in voltage. How would that change the recording shown in the figure? A. the peak voltage would be higher B. the peak would occur over a longer period of time C. the period of hyperpolarization would be longer D. threshold values would increase E. no action potential would be generated

no action potential would be generated

Cas9 cleaves both strands of the target DNA. Which of the following could occur when cells will try to repair the damage after cleavage by Cas9? (Select all that apply.) no change in the targeted gene deletions of the targeted gene the insertion of a DNA sequence into the targeted gene mutations that result in changes to the open reading frame (ORF) of the targeted gene loss-of-function mutations within the targeted gene

no change in the targeted gene, deletions of the targeted gene, the insertion of a DNA sequence into the targeted gene, mutations that result in changes to the open reading frame (ORF) of the targeted gene, loss-of-function mutations within the targeted gene

Consider two chambers of equal volumes. The chambers are separated by a selectively permeable membrane that only allows water through. equal amounts of solute What will happen to the water molecules? A. Net movement to the right B. Net movement to the left C. No net movement

no net movement

Imagine that you are talking with one of your friends about your biology course. He states that the somatic nervous system is subdivided into sympathetic and parasympathetic components, and is responsible for involuntary responses. Is this statement correct? A. no, although the somatic nervous system controls involuntary responses, it is the autonomic nervous system that is subdivided into parasympathetic and sympathetic components B. no, although the somatic nervous system does have both sympathetic and parasympathetic subdivisions, it is responsible for voluntary responses C. yes, this statement is correct. The somatic nervous system has both sympathetic and parasympathetic components and controls involuntary responses D. no, the somatic nervous system is responsible for voluntary responses, and is not subdivided into sympathetic and parasympathetic components

no, the somatic nervous system is responsible for voluntary responses, and is not subdivided into sympathetic and parasympathetic components

At which point on the phylogeny shown did the amnion FIRST appear? -node C (humans) -node D -node E -node A -node B

node c (humans)

The presence of a gene in the genome does not indicate the expression of that gene. Which of the following elements can control gene expression? (Mark all that apply) Non-coding RNA (ncRNA) Protein such as transcription factors DNA enhancer sequences DNA topological domains

non-coding RNA (ncRNA), proteins such as transcription factors?

A mutation is defined as a change in the base sequence of a DNA molecule. Sometimes mutations cause no obvious changes, but other times mutations can have profound effects on the synthesis or the function of a protein. The nucleotide sequences of the DNA molecules in the figure below are the same except for a single base pair mutation highlighted in yellow. (In each instance, the bolded base pair is the starting point of transcription.) Normal sequence 5'-ATGATCGGATCGATCCAT-3' 3'-TACTAGCCTAGCTAGGTA-5' Mutation I 5'-ATGATCGGATTGATCCAT-3' 3'-TACTAGCCTAACTAGGTA-5' Mutation II 5'-ATGATCGGATAGATCCAT-3' 3'-TACTAGCCTATCTAGGTA-5' Mutation III 5'-ATGATCGGAACGATCCAT-3' 3'-TACTAGCCTTGCTAGGTA-5' 7. Which of the mutations above would result in the replacement of an amino acid with a nonpolar R group with a different, but similar, amino acid? mutation I None of the other answer options is correct. mutation II mutation III

none of the answer options is correct

Genome annotation includes all of the followings except: locations of genes conserved sequences start codons regulatory sequences none of these

none of these

A point mutation that changes a UAC codon into a UAG codon is a _____ mutation. missense silent frameshift nonsense

nonsense

The DNA sequence shown comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The bracketed codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. ...TTCAAGACAgAAGGGCCTGACTCAGACTGACATTCTCC-3' ...AAGTTCTGTcTTCCCGGACTGAGTCTGACTGTAAGAGG-5' Consider a mutation that changes the boxed nucleotide from G to T. What kind of mutation is this? A. Silent B. Missense C. Nonsense D. Frameshift E. Non-coding

nonsense

Point mutations that cause amino acid replacements are called: nonsense mutation. nonsynonymous (missense) mutation. synonymous (silent) mutation. transition mutation. stop mutation.

nonsynonymous (missense) mutation

Which tumor has more SNPs? A. Tumor 1 B. Tumor 2 C. They are about the same D. Not enough information

not enough information

Sometimes after falling backward and hitting their heads, people may say that they are "seeing stars." Which area of the brain was affected? frontal lobe cerebellum occipital lobe parietal lobe

occipital lobe

A neuron's ability to generate action potentials depends: Question 1 choices Choice A., on the axon reaching threshold and the opening of voltage-gated sodium channels, allowing sodium to enter the axon. Choice B., on the axon reaching threshold and the opening of voltage-gated sodium channels, allowing sodium to leave the axon. Choice C., on the immediate opening of voltage-gated potassium channels once threshold has been reached, allowing potassium to leave the axon. Choice D., on the immediate opening of voltage-gated potassium channels once threshold has been reached, allowing potassium to enter the axon.

on the axon reaching threshold and the opening of voltage-gated sodium channels, allowing sodium to enter the axon

G protein-coupled receptors are found: Question 1 choices Choice A., in the cytoplasm. Choice B., on the nuclear membrane. Choice C., on the cell surface. Choice D., inside the nucleus.

on the cell surface

A seizure in the primary motor cortex on the right side of the brain would most likely cause uncontrolled movement: A. On the left side of the body B. On the right side of the body C. On both sides of the body D. None of the above; a seizure in this region would not cause uncontrolled movement

on the left side of the body

Which one of following statements explains why genome annotation is an ongoing, dynamic process in need of continued updating? Certain structures like hairpins are not predictable using older annotation techniques. The functions and interactions of macromolecules are never the same. All of these choices are correct. Our understanding of genes and gene function changes. Sequences change daily because mutation rates are extremely high.

our understanding of genes and gene function changes

You are working with a team of scientists who are investigating the biochemical control system involved in how animals digest fats in their meals. You have evidence that there must be a signal molecule involved that is released soon after the fats are consumed. When this signal molecule is present it triggers activation of appropriate digestive enzymes and cellular uptake transporters until the meal has been fully digested. Based on this information, what type of signal molecule would you predict is involved in this process? Question 4 choices Choice A., hydrophobic hormone Choice B., peptide or amine hormone Choice C., cAMP Choice D., steroid hormone Choice E., protein kinase

peptide or amine hormone

_____ are chemical signals that, instead of being secreted into the bloodstream, are introduced by animals into their habitats. They can be used to attract mates and mark territories. Hormones Growth factors Neurotransmitters Pheromones

pheromones

How do mitogen-activated protein (MAP) kinases become inactive? Receptor kinases move apart in the membrane. Phosphatases remove phosphate groups. Ras hydrolyzes GTP to GDP. Ligand diffuses away from the ligand-binding site.

phosphates remove phosphate groups

In a typical neuron, what happens during an action potential when a voltage-gated potassium channel opens? Question 5 choices Choice A., potassium enters cell, cell depolarizes Choice B., potassium enters cell, cell repolarizes Choice C., potassium leaves cell, cell depolarizes Choice D., potassium leaves cell, cell repolarizes

potassium leaves cell, cell repolarizes

What drives the filtration that occurs in animal excretory systems? Question 2 choices Choice A., passive diffusion Choice B., active transport Choice C., pressure Choice D., electrochemical gradients Choice E., passive diffusion for some substances and active transport for others

pressure

Which of the following does NOT occur during the follicular phase of the menstrual cycle? FSH levels increase. Progesterone levels increase to high levels. Ten to twelve oocytes begin to mature. The uterine lining is shed. All of these choices are correct.

progesterone levels increase to high levels

Which process is responsible for creating MOST of an animal's nitrogenous waste? protein breakdown during metabolism toxins in the environment respiration consuming nitrogen in food

protein breakdown during metabolism

Epigenetic modification is a change in ________________. DNA sequence None of the above RNA sequence Protein sequence

protein sequence?

The complement system refers to: proteins circulating in the blood that are activated by antibodies or molecules on pathogens. proteins present on macrophages that recognize foreign proteins. proteins circulating in the blood that are activated by opsonization. proteins that are activated when histamine levels increase.

proteins circulating in the blood that are activated by antibodies or molecules on pathogens

Which of the following is not part of the process of using a microarray to detect SNPs in an individual's DNA? Question 3 choices Choice A., DNA from the individual is isolated from his or her cells. Choice B., Sequences from the region containing the SNP are amplified. Choice C., Amplified DNA is labeled with a fluorescent dye. Choice D., Proteins from the gene are allowed to stick to the microarray. Choice E., DNA is hybridized to the oligonucleotides to allow exact base pairing.

proteins from the gene are allowed to stick to the microarray

Which of the following is the opening in the eye through which light passes? iris lens cornea pupil

pupil

Crispr could ... enable parents to ensure that their baby will grow up to be a genius with supermodel looks and a creative streak, as soon as boutique fertility labs are legal. a. Already happened. b. Hypothetically possible. c. Pure fiction

pure fiction

Crispr could ... knock out bipolar disorder. a. Already happened. b. Hypothetically possible. c. Pure fiction

pure fiction

Crispr could ... turn chihuahuas into Great Danes with a just a few quick, targeted gene edits. a. Already happened. b. Hypothetically possible. c. Pure fiction

pure fiction

Cells of the excretory tubule _________BLANKwater by osmosis, from which we can conclude that the solute concentration in these cells must be _________BLANK than in the filtrate. Question 5 choices Choice A., excrete; higher Choice B., reabsorb; higher Choice C., excrete; lower Choice D., reabsorb; lower

reabsorb; higher

A consecutive sequence of codons following a start codon is called a: genetic code. peptide. reading frame. template strand. gene.

reading frame

Inhibition of the flexor muscle during the knee-extension reflex is an example of: All of these choices are correct. homeostasis. reciprocal inhibition. negative feedback.

reciprocal inhibition

When nonhomologous chromosomes exchange parts, a(n) _____ has occurred. closed reading frame reciprocal translocation mismatch inversion base exclusion

reciprocal translocation

Mountcastle measured the action potentials of different neurons in the cat somatosensory cortex in response to different types of stimuli. What did he likely use as a negative control in these experiments? A. Recordings of action potentials fired by cat neurons in response to touch stimuli applied to the skin. B. Recordings of action potentials fired by cat neurons in response to the movement of a joint (a deep stimulus). C. Recordings of action potentials fired by cat neurons in response to stimuli applied to the hair. D. Recordings of action potentials fired by neurons in a cat not exposed to any type of stimuli. E. None of the answer options could have been used as a negative control by Mountcastle.

recordings of action potentials fired by neurons in a cat not exposed to any type of stimuli

When comparing the sequences of human and chimpanzee chromosomes, the CSAC evaluated the divergence value for entire chromosomes, and also for different chromosomal regions. In fact, scientists noted that certain chromosomal regions are more likely to experience mutations and diverge in both humans and chimpanzees. These researchers collected the following data for human and chimpanzee chromosome 1 (this is the actual divergence graph depicted in Figure 2 of the paper); a regression line, which represents the overall divergence trend for all areas of chromosome 1, has been superimposed over this data. What could researchers have concluded from these data? A. Central chromosome regions (abutting the centromere) are the most likely to diverge. Thus, mutations are more likely to occur in these central areas. B. Regions near the end of the chromosome arms (near the telomeres) are the most likely to diverge. Thus, mutations are more likely to occur in these "outer" regions. C. Intermediate chromosome regions, lying in the middle of either chromosome arm, are the most likely to diverge. Thus, mutations are more likely to occur in these intermediate areas. D. Outer (by the telomeres) and central (by the centromere) chromosomal regions demonstrate a high degree of divergence. Thus, mutations are equally likely to occur in these chromosomal regions. However, intermediate chromosomal regions (in the middle of the arms) do not diverge at all, and likely never demonstrate mutations. E. All chromosomal regions demonstrate the same degree of divergence. Thus, mutations are equally likely to occur in the outer, middle, and central portions of a chromosome.

regions near the end of the chromosome arms (near the telomeres) are the most likely to diverge. Thus, mutations are more likely to occur in these "outer" regions

What would the concentration of cytoplasmic Ca2+ mostly likely look like on this graph? above the line relatively stable same as line

relatively stable

Hair cells function by: firing action potentials directly. using chemosensory receptors. stabilizing homeostasis. releasing neurotransmitters.

releasing neurotransmitters

A single base deletion in the open reading frame of a gene's DNA sequence can result in ____________. replacement of a correct amino acid with a premature stop codon replacement of multiple correct amino acids with alternative amino acids replacement of a correct amino acid with an alternative amino acid all of the above

replacement of multiple correct amino acids with alternative amino acids

The CSAC noted that the chimpanzee and human genomes differ by about 4%; 1% of this difference is due to point mutations, and the remaining 3% difference is due to chromosomal insertions or deletions. Researchers noted that approximately 35 million point mutations exist between the human and chimpanzee genomes (where each point mutation affects a single nucleotide). However, the chromosomal deletions and insertions studied by the CSAC scientists were sometimes as large as 15kb or more (affecting over 15000 nucleotides at a time). Considering the size differences of point mutations and chromosomal insertions and deletions, how many chromosomal insertions and deletions do you suspect researchers identified between the genomes of humans and chimpanzees? A. Researchers likely identified 35 million chromosomal insertions and deletions between the human and chimpanzee genomes. B. Researchers likely identified more than 35 million chromosomal insertions and deletions between the human and chimpanzee genomes. C. Researchers likely identified fewer than 35 million chromosomal insertions and deletions between the human and chimpanzee genomes. D. There is no way to predict how many chromosomal mutations separate the human and chimpanzee genomes. E. None of the other answer options is correct.

researchers likely identified fewer than 35 million chromosomal insertions and deletions between the human and chimpanzee genomes

Why are some body cells responsive to a particular hormone, whereas others are not? Responsive cells are located closer to the gland that releases the hormone. Whether or not a cell responds to a hormone depends entirely on what type of cell it is (liver cell vs. fat cell vs. nerve cell), because hormones only activate one type of cell. Responsive cells express a receptor specific for the hormone. Responsive cells have complex signal transduction pathways, whereas cells that do not respond to a particular hormone lack these pathways. All of these choices are correct.

responsive cells express a receptor specific for the hormone

Which of the following is/are the light-absorbing compound used by photoreceptors? both opsin and retinal opsin rhodopsin retinal

retinal

In which of the following heart chambers would deoxygenated blood be found? right atrium and left atrium right atrium and left ventricle right atrium and right ventricle left atrium and left ventricle left atrium and right ventricle

right atrium and right ventricle

Cone cells most likely evolved from: retinal. rhodopsin. rod cells. ommatidia.

rod cells

Which of the following organisms would be able to extract the GREATEST percentage of oxygen from their respiratory medium? humans blue whales sparrows salmon seagulls

salmon

In maintaining homeostasis of body temperature, what role does the hypothalamus play? effector stimulus sensor response

sensor

Repeated DNA sequences represent a special challenge in genome sequence assembly. Which of the following would be harder to assemble correctly, assuming the number of copies of the repeat can be determined? sequences containing repeats longer than the DNA fragments to assemble sequences containing repeats shorter than the DNA fragments to assemble

sequences containing repeats longer than the DNA fragments to assemble

The kangaroo rat is a desert mammal that conserves water by producing highly concentrated urine (urine very low in water). You compare the relative lengths of the loops of Henle in the kangaroo rat with those from a mouse species native to a temperate area where water is readily available. You find that the loops of Henle are relatively: Question 3 choices Choice A., shorter in the kangaroo rat. Choice B., shorter in the mouse. Choice C., about the same in both.

shorter in the mouse

When an appropriate signal binds to a G protein-coupled receptor, what is the best description of how the information is passed across the plasma membrane? Question 2 choices Choice A., Binding of the signal molecule triggers the cell to produce G protein. Choice B., The signal molecule is transported across the plasma membrane by the receptor protein. Choice C., Signal binding causes a conformational change in the cytoplasmic portion of receptor protein.

signal binding causes a conformational change in the cytoplasmic portion of receptor protein

The power stroke corresponds to which event in muscle contraction? binding of the myosin head to actin cocking of the myosin head detachment of myosin from actin sliding of actin relative to myosin filaments

sliding of actin relative to myosin filaments

Which of the following occurs when a neuron is depolarized? Question 1 choices Choice A., Sodium ions enter the neuron through voltage-gated sodium channels. Choice B., Sodium ions diffuse along the outside of the neuron, bringing nearby regions to threshold. Choice C., Potassium ions enter the neuron through voltage-gated potassium channels. Choice D., Calcium ions enter the cell through voltage-gated calcium channels.

sodium ions enter the neuron through voltage-gated sodium channels

You turn on a light so you can get a glass of water. At the moment the light turns ON, your retinal ganglion cells will _____firing action potentials. A. Start B. Stop C. None of the above. (retinal ganglion cells do not fire action potentials)

start

What effect does the nervous system have on the heart rate? A. stimulation by either the sympathetic or parasympathetic nerves causes pacemaker cells in the SA node to depolarize more slowly B. stimulation by sympathetic nerves sets the resting heart rate of the pacemaker cells in the SA node C. stimulation by parasympathetic nerves causes the heart rate to slow down D. stimulation by sympathetic nerves causes the pacemaker cells of the AV node to depolarize more rapidly than the pacemaker cells of the SA node E. the nervous system does not directly affect the heart rate

stimulation by parasympathetic nerves causes the heart rate to slow down

Predict which type of channel is associated with ion transport in stereocilia. stretch-gated channel and voltage-gated channel ligand-gated channel stretch-gated channel voltage-gated channel

stretch-gated channel

Which of the following substances are removed from the filtrate and returned to the blood during the reabsorption step? Select all that apply. sugars electrolytes proteins vitamins amino acids

sugars, electrolytes, vitamins, amino acids

Muscle and liver cells respond to insulin by: Question 5 choices Choice A., taking up glucose and storing it as glycogen. Choice B., breaking down glycogen and releasing glucose. Choice C., breaking down glycogen and storing glucose. Choice D., breaking down glucose and releasing glycogen

taking up glucose and storing it as glycogen

During an auditory hallucination, sound is perceived without an auditory stimulus. Based on what you learned about the brain last week, stimulation in which lobe of the brain would be most likely to generate an auditory hallucination? A. Frontal lobe B. Occipital lobe C. Parietal lobe D. Temporal lobe

temporal lobe

Which brain region is associated with language in humans? frontal lobe temporal lobe occipital lobe parietal lobe

temporal lobe

An interneuron may receive multiple stimuli from the same sensory neuron over a very short period of time. The firing rate of the receiving neuron is proportional to the number of signals received from the sensory neuron over time. Of which of the following is this an example? A. spatial summation B. action potential C. temporal summation D. hyperpolarization

temporal summation

In response to LH and FSH, testes secrete: sperm. TDF. ejaculate. testosterone. estrogen.

testosterone

ou are a doctor and have a patient who has been injured by a rusty nail. As a precaution, you vaccinate her against tetanus. In response to the vaccine, how does her body produce antibodies against C. tetani and prevent future illness due to tetanus? Every B cell in her body produces antibodies against C. tetani. The B cell with appropriate antibody is stimulated to divide, producing plasma cells that make antibodies to C. tetani, and memory cells that "remember" C. tetani. Every cell in her immune system produces antibodies against C. tetani. The B cell that produces the appropriate antibody undergoes genomic rearrangement in order to produce other cells that produce the same antibody.

the B cell with appropriate antibody is stimulated to divide, producing plasma cells that make antibodies to C. tetani, and memory cells that "remember" C. tetani

The sterile womb hypothesis refers to: The absence of microorgamism in the environment of a developing fetus. The distinct microbiota present in the developing fetus gut and the newborn child gut. The strict maternal regulation of microorganism species that are able colonize a child before and after birth. An old hypothesis that has been proven wrong by recent technological advancements in microbiology research.

the absence of microorganism in the environment of the developing fetus

Which of the following are true for the hypothalamus and pituitary gland? Select all that apply. The general chemical nature of a hormone can be used to predict: The action of the neurons from the hypothalamus is direct for the posterior pituitary, that is, the neurons extend from the hypothalamus to the posterior pituitary where the axon terminal releases hormones that go directly into the blood. The action of the neurons from the hypothalamus is indirect for the anterior pituitary, that is, the action potentials in the neurons in the hypothalamus cause formation of new action potentials in different neurons in the anterior pituitary. Neurosecretory cells of the hypothalamus secrete releasing factors that enter the anterior pituitary via a portal system to cause release of hormones from the anterior pituitary. Release factors from neurosecretory cells of the hypothalamus cause release of hormones into the blood from the posterior pituitary gland. Release factors from the posterior pituitary stimulate release of specific hormones into the blood from the anterior pituitary.

the action of the neurons from the hypothalamus is direct for the posterior pituitary, that is, the neurons extend from the hypothalamus to the posterior pituitary where the axon terminal releases hormones that go directly into the blood, neurosecretory cells of the hypothalamus secrete releasing factors that enter the anterior pituitary via a portal system to cause release of hormones from the anterior pituitary

Figure 9.15 shows how normal signaling works with a Ras protein acting downstream of a receptor kinase. You examine a cell line in which Ras is always activated even in the absence of a signaling molecule. This causes constant activation of the kinases in the MAP kinase pathway. Which of the following conditions would be MOST likely to turn off this abnormally active signaling pathway? /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_9/9_156.jpg the addition of a drug that prevents the dimerization of the receptor kinase the addition of a drug that prevents the final kinase from interacting with its target protein in the nucleus the addition of a drug that increases the binding affinity of Ras for MAP kinase enzymes in the cytoplasm the addition of a drug that prevents the phosphorylation of the receptor kinase

the addition of a drug that prevents the final kinase from interacting with its target protein in the nucleus

What causes the inactivation of a G protein? A phosphatase removes the inorganic phosphate group from GTP. The alpha subunit catalyzes the hydrolysis of GTP to GDP and inorganic phosphate. The inactive receptor catalyzes the replacement of GTP by GDP. The beta and gamma subunits trigger the hydrolysis of GTP to GDP.

the alpha subunit catalyzes the hydrolysis of GTP to GDP and inorganic phosphate

The pituitary gland and a part of the hypothalamus are among only a few parts of the brain that are not protected by the blood-brain barrier. One explanation for this could be: Question 6 choices Choice A., they are not actually part of the brain. Choice B., they cannot produce sufficient hormone quantity without a blood supply. Choice C., the barrier would block hormone secretion. Choice D., the toxic substances blocked by the barrier do not affect them. Choice E., they developed from epithelial cells, not neurons.

the barrier would block hormone secretion

How is the order of DNA fragments determined to obtain the sequence of the entire genome? Question 3 choices Choice A., They are sorted by size using gel electrophoresis. Choice B., The base sequences are aligned by matching short regions at the ends that overlap. Choice C., They are converted into sentences that are then assembled. Choice D., They are matched up to chromosomes prepared from the nucleus.

the base sequences are aligned by matching short regions at the ends that overlap

A mutation in P3 causes it to be active all of the time (even if it's dephosphorylated). What would be the most likely consequence of this mutation? A. The cell will express genes regulated by TF1 in the presence of signal B. The cell will express genes regulated by TF2 in the absence of signal C. The cell will express genes regulated by TF1 and TF2 in the presence or absence of signal D. The cell will fail to express any genes due to mixed signals

the cell will express genes regulated by TF1 in the presence of signal

How can the cells within your body become different cell types? (Select all that apply.) The cells have different genes. The cells' genes are regulated. The cells are in different local environments. Cells differentiate as they divide by mitosis.

the cells' genes are regulated, the cells are in different local environments

What causes the increase in cytosolic calcium that triggers the fusion of secretory vesicles to the membrane and the release of neurotransmitters into the synaptic cleft? Question 2 choices Choice A., the hyperpolarization of the membrane at the axon terminal Choice B., the release of calcium from intracellular calcium stores Choice C., the opening of ligand-gated calcium channels in the axon terminal membrane Choice D., the change in conformation of voltage-gated calcium channels in the axon terminal membrane

the change in conformation of voltage-gated calcium channels in the axon terminal membrane

The sequences of human chromosomes 1, 2, 3, 4, etc. are very close to those of chimpanzee chromosomes 1, 2, 3, 4, etc. Researchers of the CSAC compared the sequences of corresponding human and chimpanzee chromosomes and counted the number of base pairs that differed between them. In this manner, scientists were able to determine the extent to which human and chimpanzee chromosomes differed - or diverged - from one another. If homologous human and chimpanzee chromosomes demonstrate a divergence value of 0.010, this means that the sequences of the chromosomes in these two species differ by about 1%. The higher the divergence value, the more nucleotide differences exist between the sequences. If researchers collected data similar to the above, what could they have concluded about human and chimpanzee chromosomes? A. The chimpanzee X chromosome and human X chromosome are the most divergent, and demonstrate the most nucleotide differences when their sequences are compared. B. Chimpanzee chromosome 8 and human chromosome 8 are the most divergent, and demonstrate the most nucleotide differences when their sequences are compared. C. Chimpanzee chromosome 20 and human chromosome 20 are the most divergent, and demonstrate the most nucleotide differences when their sequences are compared. D. The chimpanzee Y chromosome and human Y chromosome are the most divergent, and demonstrate the most nucleotide differences when their sequences are compared. E. Chimpanzee chromosome 1 and human chromosome 1 are the most divergent, and demonstrate the most nucleotide differences when their sequences are compared.

the chimpanzee Y chromosome and human Y chromosome are the most divergent, and demonstrate the most nucleotide differences when their sequences are compared

Fish in a marine environment must maintain a relatively constant ion concentration in their tissues and blood. How do the chloride cells in the gills aid fish in the removal of excess ions? The chloride cells actively move ions into the body and water follows by osmosis. The chloride cells create a countercurrent system where ions are lost from the body and water is absorbed to dilute other ions (NaCl). The chloride cells create a countercurrent system where water is lost from the body and chloride ions are absorbed. The chloride cells actively remove ions from the body and water follows by osmosis.

the chloride cells actively remove ions from the body and water follows by osmosis

The reasoning behind the use of fecal transplants from healthy individuals is that: the competition from the introduction of other bacteria into the gastrointestinal tract keeps C. difficile numbers down. antibiotics are administered with the fecal transplant, thus controlling populations of C. difficile. C. difficile feeds on other bacteria that are introduced with the fecal transplant. the fecal matter from healthy patients does not have C. difficile.

the competition from the introduction of other bacteria into the gastrointestinal tract keeps C. difficile numbers down

Which of the following statements about the corpus luteum is FALSE? Progesterone secreted by the corpus luteum maintains the uterine lining. The corpus luteum is maintained first by FSH and then by hCG. If the egg is not fertilized then the corpus luteum degenerates. It is composed of follicle cells that remain in the ovary following ovulation. None of the other answer options is false.

the corpus luteum is maintained first by FSH and then by hCG

The duct that connects the pancreas to the duodenum can sometimes become blocked. What is the result? Nothing happens because the pancreas does not produce digestive enzymes. The digestive enzymes produced by the pancreas enter the large intestine instead and digestion proceeds as normal. The digestive enzymes are not affected because they are stored in the gallbladder until they are needed in the duodenum. The digestive enzymes produced by the pancreas still enter the duodenum because they travel by the blood to reach the duodenum, not by a duct. The digestive enzymes back up into the pancreas and may start to digest the pancreas.

the digestive enzymes back up into the pancreas and may start to digest the pancreas

Lateral inhibition is the result of a sensory neuron causing which of the following? Question 4 choices Choice A., the direct inhibition of adjacent interneurons Choice B., the direct inhibition of adjacent sensory neurons Choice C., the direct inhibition of adjacent motor neurons

the direct inhibition of adjacent interneurons

In systemic tissue fluids, the enzyme carbonic anhydrase catalyzes the reaction CO2 + H2O → H2CO3 (which then can dissociate into H+ and HCO3-). In fact, CO2 released from cells is converted to HCO3- ions and travels in that form in the bloodstream. HCO3- is reconverted to CO2 + H2O in the pulmonary capillaries by the same enzyme, and there the CO2 is exhaled. How is it possible for the same enzyme to catalyze reverse reactions? There must be two forms of carbonic anhydrase. One form catalyzes the forward reaction CO2 + H2O → H2CO3 and the other catalyzes the reverse reaction H2CO3 → CO2 + H2O. The lungs contain an allosteric inhibitor that prevents the formation of carbonic acid. The direction of a reversible reaction is influenced by the concentrations of reactants and products. In pulmonary circulation, the low CO2 concentration favors the formation of CO2 and H2O.

the direction of a reversible reaction is influenced by the concentrations of reactants and products. In pulmonary circulation, the low CO2 concentration favors the formation of CO2 and H2O

In systemic tissue fluids, the enzyme carbonic anhydrase catalyzes the reaction CO2 + H2O → H2CO3 (which then can dissociate into H+ and HCO3-). In fact, CO2 released from cells is converted to HCO3- ions and travels in that form in the bloodstream. HCO3- is reconverted to CO2 + H2O in the pulmonary capillaries by the same enzyme, and there the CO2 is exhaled. How is it possible for the same enzyme to catalyze reverse reactions? The lungs contain an allosteric inhibitor that prevents the formation of carbonic acid. There must be two forms of carbonic anhydrase. One form catalyzes the forward reaction CO2 + H2O → H2CO3 and the other catalyzes the reverse reaction H2CO3 → CO2 + H2O. The direction of a reversible reaction is influenced by the concentrations of reactants and products. In pulmonary circulation, the low CO2 concentration favors the formation of CO2 and H2O.

the direction of the reversible reaction is influenced by the concentrations of reactants and products. In pulmonary circulation, the low CO2 concentration favors the formation of CO2 and H2O

Fish deal with similar issues. If a saltwater fish were unable to regulate chloride - what would happen? A. The fish would swell with water. B. Nothing, sodium would still be secreted. C. The fish would find fresh water to live. D. The fish would loose water and shrivel up.

the fish would swell with water

How will SNP microarray results differ in an analysis of DNA from an individual who is homozygous for one allele compared with an individual who is heterozygous for both alleles? Question 5 choices Choice A., The strength of the fluorescent glow will be stronger in the analysis of DNA from the homozygous individual. Choice B., The fluorescent signal will be detected for both A−T and G−C base pairs in analysis of DNA from the heterozygous individual, but for only one of these base pairs in DNA from homozygotes. Choice C., DNA from heterozygous individuals will not be hybridized to the microarray, but base-pair matching hybridization will occur using DNA from heterozygotes.

the fluorescent signal will be detected for both A-T and G-C base pairs in analysis of DNA from the heterozygous individual, but for only one of these base pairs in DNA from homozygotes

The partial pressure of a gas is: equivalent to the total atmospheric pressure. the difference in concentration of that gas inside and outside of a cell. the fractional concentration of the gas multiplied by the overall, atmospheric pressure. a measure of how quickly a gas moves across a respiratory surface. the weight of a given volume of the gas.

the fractional concentration of the gas multiplied by the overall, atmospheric pressure

Which of the following allows the determination of the strength of a signal? Question 1 choices Choice A., the intensity of the action potential exhibited by the local sensory neurons Choice B., the frequency of action potentials exhibited by the local sensory neurons Choice C., the degree to which adjacent interneurons are inhibited Choice D., the frequency of action potentials exhibited by adjacent interneurons

the frequency of action potentials exhibited by the local sensory neurons

Suppose that frog embryos are genetically manipulated so that the epidermal cells expressed both E-cadherin and N-cadherin on their cell surface. The neuronal tissue and epidermal tissues are collected from the embryos and treated as illustrated in Figure 10.12b. Which of the following would you predict would happen now that N-cadherin is also present on the surface of the epidermal cells? /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_10/10_91.jpg The genetically modified epidermal cells would adhere to each other and to neuronal cells. The genetically modified epidermal cells would adhere to each other, and not to the neuronal cells, because they would still be epidermal cells regardless of the presence of an additional cell adhesion protein on their surface. The genetically modified epidermal cells would adhere to neuronal cells and would no longer adhere to epidermal cells.

the genetically modified epidermal cells would adhere to each other and to neuronal cells

In vertebrates, which of the following frequently serves as the first intermediary between the areas of the brain that perceive sensory stimuli and the rest of the endocrine system? the anterior pituitary gland the hypothalamus the thyroid gland the adrenal glands the posterior pituitary gland

the hypothalamus

Imagine that a young girl suffers a horseback-riding injury, and one of her ribs punctures her diaphragm. How will this injury affect the girl's breathing? The injury will make it easier to increase negative air pressure in her chest cavity, making inhalation easier. The injury will not affect her at all, as intercostal muscles are responsible for breathing. The injury will make it more difficult to decrease negative air pressure in her chest cavity, making inhalation more difficult. The injury will make it more difficult to increase negative air pressure in her chest cavity, making inhalation more difficult.

the injury will make it more difficult to increase negative air pressure in her chest cavity, making inhalation more difficult

What does this negative resting potential mean? A. The inside (ICF) of the axon is more negatively charged than the outside (ECF) B. The outside of the axon (ECF) is more negatively charged than the inside (ICF)

the inside (ICF) of the axon is more negatively. charged than the outside (ECF)

Suppose there is a mutation in a laminin-binding integrin gene that causes a loss of function in the cytoplasmic domains of the integrin. Which of the following would you expect to observe as a result of this mutation? Cell adhesion to laminin would decrease, but laminin-meditated gene expression would remain the same. The integrin would be unable to signal the cytoplasm when it had bound to laminin. Tissues would be weakened because the integrin could no longer associate with microfilaments in adherens junctions. The integrin would function normally because the cytoplasmic domain is not responsible for binding to laminin.

the integrin would be unable to signal the cytoplasm when it had bound to laminin

Consider the mammalian heart. Why is the muscular wall of the left ventricle thicker than that of the right ventricle? The left ventricle must contract with more force in order to send blood to the body's extremities. This difference stems from the fact that frogs have a thicker left ventricular muscle mass. The left ventricle has more nerve endings for contraction, and more muscle mass must be there to accommodate the extra neurons. The ventricle wall must be thicker to inhibit diffusion between the right and left ventricle.

the left ventricle must contract with more force in order to send blood to the body's extremities

How are SNP alleles in an individual detected using a microarray? Question 4 choices Choice A., The DNA from the individual is sequenced using dideoxy sequencing. Choice B., The location on the microarray of the hybridizing DNA is visualized using a microscope. Choice C., DNA primers on each side of the SNP are hybridized for PCR.

the location on the microarray of the hybridizing DNA is visualized using a microscope

Shortly after eating a candy bar, where would the increased concentration of glucose be first evident? Question 2 choices Choice A., the lumen of the small intestine Choice B., the cytoplasm of the epithelial cells lining the lumen of the small intestine Choice C., the blood flowing past the basal membrane of the epithelial cells of the lumen

the lumen of the small intestine

Transmission of impulses along a neuron in the vertebrate nervous system ordinarily occurs in only one direction because, following passage of an action potential, the neuron is temporarily in a refractory period or hyperpolarized. This is caused by which of the following? Question 2 choices Choice A., the movement of potassium ions out of the axon Choice B., the movement of potassium ions into the axon Choice C., the movement of sodium ions out of the axon Choice D., the movement of sodium ions into the axon

the movement of potassium ions out of the axon

The gray matter on the outside of the brain appears gray because: all dendrites in the brain are located there. the neuronal cell bodies are located here. the neurons are protected by something other than myelin that makes it appear gray. the neurons are not myelinated.

the neuronal cell bodies are located here

Aging can sometimes lead to an increase in the stiffness at the base of the basilar membrane. What effect would this have on a person's hearing? The person would only be able to hear loud sounds. The person would not be able to distinguish the amplitude of a sound. The person would lose the ability to hear high-pitched sounds. The person would lose the ability to hear low-pitched sounds.

the person would lose the ability to hear high-pitched sounds

Which of the following statements is TRUE regarding a basic amino acid? All of these choices are correct. The hydrophilic R group of a basic amino acid will be located in the interior of a protein. The positively charged R group of a basic amino acid could bind DNA. A basic amino acid would be considered both polar and hydrophobic. The R group of a basic amino acid would only be able to form covalent bonds with other molecules.

the positively charged R group of a basic amino acid could bind to DNA

The hypothalamus uses action potentials to directly stimulate hormone release from: Question 3 choices Choice A., the anterior pituitary only. Choice B., the posterior pituitary only. Choice C., both the anterior and posterior pituitary. Choice D., neither the anterior nor the posterior pituitary.

the posterior pituitary only

Each neuron within the somatosensory cortex has a receptive field associated with it, an area that - when stimulated by a specific sensation - causes that neuron to fire an action potential. As part of his work, Mountcastle mapped the receptive fields of neurons located in the same vertical column. He collected data similar to those depicted in Figure 5 below, which shows receptive fields on a cat leg in red. What could Mountcastle have concluded regarding the receptive fields for neurons located in the same vertical column? Figure 5 A. The receptive field for the neuron located at a depth of 350 μm (near the surface of the vertical column) is the smallest in size. B. The receptive field for the deepest neuron (located at a depth of 1910 μm) is located on the paw of a cat. C. There is no overlap in the location of receptive fields for neurons located at different depths in the same vertical column. D. The receptive fields for all of the neurons in this vertical column are oval-shaped and occur in (roughly) similar areas of the cat leg. E. The receptive fields for neurons located near the surface of the vertical column are located in the paw, and the receptive fields for the deepest neurons in the vertical column are located in the central part of the leg.

the receptive fields for all of the neurons in this vertical column are oval-shaped and occur in (roughly) similar areas of the cat leg

Phosphatases are a family of enzymes that remove phosphate groups from specific proteins; these phosphate groups had been added to the proteins by protein kinases. Vanadate is an inhibitor of phosphatases in eukaryotic cells. What effect would vanadate have on the response of cells to signals received by receptor kinases? The response of the cell would last longer than it normally would. The signal would still bind the receptor, so there would be no effect. The response of the cell would be shorter than it normally would.

the response of the cell would last longer than it normally would

Phosphatases are a family of enzymes that remove phosphate groups from specific proteins; these phosphate groups had been added to the proteins by protein kinases. Vanadate is an inhibitor of phosphatases in eukaryotic cells. What effect would vanadate have on the response of cells to signals received by receptor kinases? The signal would still bind the receptor, so there would be no effect. The response of the cell would be shorter than it normally would. The response of the cell would last longer than it normally would.

the response of the cell would last longer than it normally would

In the disease elephantiasis, lymph vessels become blocked as a result of infection with parasitic worms. Which of the following processes would be impacted by this disease? the generation of pressure to filter materials through the capillary walls the flow of water back into the capillaries by osmosis the exchange of oxygen and other materials between the blood and body cells the diffusion of water and small molecules across the wall of the capillary the return of excess interstitial fluid to the bloodstream

the return of excess interstitial fluid to the bloodstream

At high altitudes, the percentage of oxygen is ___________ the percentage of oxygen at sea level. A. Higher than B. Lower than C. The same as

the same as

The percent maximum isometric force that a muscle fiber produces is plotted against the estimated number of myosin cross-bridges formed with actin. A. The scatterplot shows a negative correlation between force and number of cross-bridges. B. The scatterplot shows a positive correlation between force and number of cross-bridges. C. The data plotted above represent continuous data. D. The data plotted are qualitative data. E. None of the other answer options is correct.

the scatterplot shows a positive correlation between force and number of cross-bridges

Imagine a genomic researcher who is analyzing the genome of different types of cats. She finds that a particular sequence in the North American Bobcat genome is exactly identical to a sequence found in the common house cat, while most other sequences in those two genomes differ at many nucleotides. (The most recent common ancestor between bobcats and house cats is estimated to be about 6.8 million years, plenty of time for mutation to generate DNA sequence variation.) Which of the following could explain the identical sequence in these otherwise differing genomes? (Select all that apply.) The sequence encodes a gene that is critical for life and cannot be easily mutated while retaining function. The sequence encodes a protein critical for the production of fur color. The sequence is contained in a retrovirus that has infected both species. The sequence is from an intron of a gene that encodes a muscle protein.

the sequence encodes a gene that is critical for life and cannot be easily mutated while retaining function, the sequence is contained in a retrovirus that has infected both species

You feel something brush past your arm. This sensation is perceived in your brain by... A. Broca's area B. Wernicke's area C. The primary motor cortex D. The somatosensory cortex

the somatosensory cortex

Dilated pupils, inhibited digestive activity, increased respiratory rate, and release of glucose from the liver are all signs of activity of: A. the parasympathetic division of the autonomic system B. the somatic nervous system C. the sympathetic division of the autonomic system D. both divisions of the autonomic nervous system

the sympathetic division of the autonomic nervous system

Action potentials typically move in one direction along the neuron away from the cell body. This is due to which of the following? Question 5 choices Choice A., the temporary hyperpolarization of the axon membrane following the action potential spike Choice B., the temporary inactivation of sodium and potassium channels following the action potential spike Choice C., the movement of sodium ions out of the cell through voltage-gated potassium channels Choice D., the myelination of the axon membrane

the temporary hyperpolarization of the axon membrane following the action potential spike

You sequenced a tumor genome and a healthy tissue genome. You find that there are twice as many reads mapping to a region on chromosome 18 for the tumor sample versus the healthy cell sample. Which of the following is most consistent with this observation? A. The tumor has a deletion in chromosome 18 B. The tumor has a duplication in chromosome 18 C. The tumor has an inversion in chromosome 18 D. The tumor has a translocation between chromosome 18 and another chromosome E. None of the above; this must be an experimental error

the tumor has a duplication in chromosome 18

You sequenced a tumor genome and have identified an interesting sequence read. The first half of this read maps to a region of chromosome 3 in the reference genome and the second half of the same read maps to a region of chromosome 20 of the reference genome. Which of the following is most consistent with this observation? A. The tumor has deletions in chromosomes 3 and 20 B. The tumor has duplications in chromosomes 3 and 20 C. The tumor has inversions in chromosomes 3 and 20 D. The tumor has a translocation between chromosome 3 and chromosome 20 E. None of the above; this must be an experimental error

the tumor has a translocation between chromosome 3 and chromosome 20

Metanephridia differ from protonephridia in all of the following ways EXCEPT that: fluid from the body cavity enters protonephridia without first being filtered. the urine produced in both systems is more dilute than the body fluids. metanephridia are surrounded by an extensive capillary network, whereas protonephridia are not. fluid enters metanephridia through a funnel-shaped opening. selective reabsorption of materials occurs via cells lining the tubules in protonephridia and via capillaries in metanephridia.

the urine produced both systems is more dilute than the body fluids

Oxytocin and cholecystokinin are transported through the bloodstream and arrive at the uterus at the same time. Oxytocin causes the uterus to contract, whereas cholecystokinin has no effect. Why? Oxytocin can diffuse through the plasma membrane of uterine cells, whereas cholecystokinin cannot. The uterus has receptors for oxytocin, but not for cholecystokinin. Oxytocin is at a higher concentration in the bloodstream than cholecystokinin. Oxytocin blocks the activity of cholecystokinin. Oxytocin alters gene expression patterns, whereas cholecystokinin does not.

the uterus has receptors for oxytocin, but not for cholecystokinin

images that you see in your peripheral vision are not as sharp as those directly in front of you because: Question 1 choices Choice A., there are fewer rod cells in areas of the retina where images from the periphery are focused. Choice B., the rod cells in the periphery are sensitive to blue and green light only. Choice C., the lens cannot focus images well on areas of the retina where images from the periphery are projected. Choice D., there is a higher concentration of cone cells in the center of the retina in an area called the fovea.

there is a higher concentration of cone cells in the center of the retina in an area called the fovea

If the partial pressure of oxygen outside of a cell is 100 mmHg and the partial pressure of oxygen inside of a cell is 25 mmHg, which of the following statements is CORRECT? There will be a net movement of oxygen from outside the cell to inside the cell. There will be no net movement of oxygen in either direction. There will be a net movement of carbon dioxide into the cell. There will be a net movement of carbon dioxide out of the cell. There will be a net movement of oxygen from inside the cell to outside the cell.

there will be a net movement of oxygen from outside the cell to inside the cell

Two solutions of water and dissolved potassium and glucose are separated by a selectively permeable membrane that only permits the passage of water. If the two solutions have the same total solute concentration, but solution 1 has a higher concentration of potassium and a lower concentration of glucose than solution 2, which of the following statements is CORRECT? There will be net water movement from solution 1 to solution 2. There will be no net movement of water molecules between the solutions. There will be net potassium movement from solution 1 to solution 2. There will be net glucose movement from solution 2 to solution 1. There will be net water movement from solution 2 to solution 1.

there will be no net movement of water molecules between the solutions

Your immune system plays a vital role in defending your body against pathogens (Chapter 43). Even your skin can be considered a component of the immune system, as it acts as a barrier to bacteria, viruses and fungi. From the table in the previous question, you may have noticed that genes involved in the immune response, the production of antibiotic-like compounds, and skin development/maintenance all diverge rapidly in humans and chimpanzees. What could explain this pattern of divergence? A. These genes have to diverge rapidly in order to keep up with the evolution of pathogens. Random mutations that occur in host cells that confer improved pathogen resistance will be selected for. B. Any immune cell that encounters a pathogen will die. Thus, genes involved in the immune response must diverge/evolve rapidly in order for new immune cells to keep being produced. C. As a result of infection, pathogens induce mutations in an organism's genome. As pathogens primarily interact with immune system cells, the genetic material of these cells is more likely to undergo mutations. D. The rate at which a gene evolves or diverges is completely random. Genes involved in the immune response evolve rapidly due to chance. E. None of the answer options is correct.

these genes have to diverge rapidly in order to keep up with the evolution of pathogens. Random mutations that occur in host cells that confer improved pathogen resistance will be selected for

Bacteria are able to utilize energy sources present in their extracellular environment because: They can consume complex and simple sugars through specific transporters and enzymes present in their membrane. They can absorb complex and simple sugars in their extracellular environment through simple diffusion. They can consume complex and simple sugars through exocytosis They can consume complex and simple sugars through endocytosis

they can consume complex and simple sugars through specific transporters and enzymes present in their membrane

The digestive tract is well adapted for digestion and absorption. For most nutrients, once material is in the digestive tract, the digestive system does not vary its rate of absorption according to body needs. This is an example of a homeostatic positive feedback mechanism. This is an example of a homeostatic negative feedback mechanism. This response is not homeostatic.

this response is not homeostatic

Referring to Figure 10.14, identify which type of cell-cell interaction is most likely to force the products of digestion to be absorbed across microvilli of intestinal cells rather than allowing them to leak between cells. /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_40/40_136.jpg hemidesmosomes gap junctions tight junctions plasmodesmata desmosomes

tight junctions

Which of the following junctions would you predict to be most important for the function of the bladder? A. adherens junctions B. gap junctions C. hemidesmosomes D.tight junctions

tight junctions

A cell in a chick embryo is tested to determine whether it is a stem cell of some kind. These tests find: 1. The SR receptor is present 2. DIV genes are on 3. The DIFF(skin) genes are blocked 4. TF of the neural pathway is in the cytoplasm 5. Transducer 2 of the skin pathway is not phosphorylated Answer A for True or B for False The skin signal is not present.

true

Assume that blood pressure drops in a person because of an injury. Indicate which of the following occur by selecting "true" for does occur or "false" for does not occur. The sympathetic nervous system stimulates the adrenal glands. true false

true

Biochemical, evolutionary, and genetic evidence of functionality can help identify single nucleotide polymorphisms (SNPs) that are important in controlling gene expression or contributing to disease progression.\ True False

true

Consider the figure below. Mark A for True or B for False. The osmolarity of tissue fluids surrounding the nephron is higher at point D than at point G.

true

Consider the genome browser data associated with TP53. [~]/JT/TP53 tracks.jpg Track A provides genetic evidence of functionality. True False

true

Different ion channels are responsible for generating the voltage change seen at #2 and #4 in the figure. true false

true

During starvation, humans and other animals deplete glycogen and fat reserves first, followed by protein. True False

true

For your summer internship you decide to help farmers characterize the microbiotas of their pigs. Below is a graphical representation of the diversity observed after sampling and sequencing the microbiotas present in the small intestine (jejunum and ileum) and large intestine (cecum) of their fattest pigs. Reference the data presented below to address the following statement. /brainhoney/Resource/11009259,8,0,4E,3/Assets/Figure%20Microbioms%20w8%20PEQ.png Each point on the graph above represents one microbial species present in the either the small intestine or the large intestine. False True

true

For your summer internship you decide to help farmers characterize the microbiotas of their pigs. Below is a graphical representation of the diversity observed after sampling and sequencing the microbiotas present in the small intestine (jejunum and ileum) and large intestine (cecum) of their fattest pigs. Reference the data presented below to address the following statement. /brainhoney/Resource/11009259,8,0,4E,3/Assets/Figure%20Microbioms%20w8%20PEQ.png Points that cluster together have greater 16s rRNA gene sequence similarity than points that are farther apart. True False

true

Neuron A sends an EPSP to Neuron D at the same time that Neuron C sends an IPSP to Neuron D. Mark A for True or B for False The IPSP will cause the region of Neuron D near the synapse to become hyperpolarized.

true

One of the roles of the kidneys is to help buffer body fluids so that they are not too acidic or too basic. The cells of the renal tubule secrete H+ into the tubule lumen, and absorb bicarbonate (HCO3-), passing it into the tissue fluid. Consider the reaction catalyzed by the enzyme carbonic anhydrase, shown in the accompanying figure and below. /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_41/41_116.jpg During heavy exercise, the reaction shifts to the right in the nephron (lumen of the tubule). True False

true

Phylogenetic analysis of 16S rRNA-encoding gene sequences from fecal microbiota of control or patients with C. difficile associated diarrhea (both initial and recurrent episodes) are shown below. [~]/JT/LS 7C/Microbiome Chang et al 2008 data.png Bacteroides are reduced in patients with recurrent CDI. True False

true

Single nucleotide polymorphisms (SNPs) may indicate genetic variance observed in a population of individuals or mutations found in a cancer genome. True False

true

The light blue arrow indicates an intergenic region of the genome in the diagram below./brainhoney/Resource/11009259,8,0,4E,3/Assets/LS7C%20Intergenic.jpg True False

true

The voltage change shown in the figure is an all-or-nothing response true false

true

The voltage changes shown in the figure are measured just across the plasma membrane. true false

true

Using the Cas9 system, a potential regulatory sequence of DNA and a reporter gene (GFP) is introduced into a model organism such as zebra fish. Examining the expression of the reporter gene can tell us whether that regulatory sequence is important for gene expression. True False

true

When compared to the leg muscles of an Olympic sprinter, the muscles of an Olympic marathoner would likely show a greater proportion of oxidative slow-twitch fibers. True False

true

Whichever DNA strand is transcribed, the RNA polymerase reads the template strand from 3′ to 5′. False True

true

Most mammals excrete _____; most aquatic animals excrete _____; birds, insects, and many reptiles excrete _____. uric acid; urea; ammonia ammonia; urea; uric acid uric acid; ammonia; urea urea; ammonia; uric acid urea; uric acid; ammonia

urea; ammonia; uric acid

To determine if Aeromonas and Vibrio can co-exist in the Zebrafish gut you colonize germ free zebrafish larva with Aeromonas first and then expose the Zebrafish+Aeromonas to Vibrio. You sample and count the number of bacteria present in the gut at multiple times throughout the experiment. The results from your experiment are shown in log scale below: Based on my groups interpretation of the data provided, we can conclude: A. Aeromonas and Vibrio can persistently co-exist in the larval zebrafish gut. B. In the larval zebrafish gut, Aeromonas are able to out compete Vibrio because they were the first colonizers. C. Vibrio are able to out compete Aeromonas in the larval zebrafish gut. D. Vibrio are able to utilize food sources present in the larval zebrafish gut better than Aeromonas.

vibrio are able to out compete aeromonas in the larval zebrafish gut

Below is a diagram of O2 uptake at the fish gill. The values shown indicate percent fluid saturation of O2. Which choice below identifies the fluid and the direction of flow CORRECTLY? blood right, water left water and blood left water right, blood left blood left, water right water left, blood right

water left, blood right

When researchers in the CSAC constructed the chimpanzee genome, they did so by isolating and sequencing genetic material derived from chimpanzee lymphocytes, which are a type of white blood cell. What would happen if researchers additionally sequenced genetic material from brain cells and granulocytes (another type of white blood cell that is distinct from lymphocytes) isolated from the same chimpanzee? A. If researchers used brain cells or granulocytes, they would likely produce a whole genome sequence that is very different from that constructed using lymphocyte material. B. Since granulocytes and lymphocytes are both types of white blood cell, whole genome sequences using either of these genetic sources would be identical. However, a whole genome sequence constructed using brain cells would be very different. C. Whole genome sequences constructed using lymphocytes, granulocytes, and brain cells would likely be identical or nearly identical. D. The researchers likely chose to sequence the chimpanzee genome using lymphocyes as this is the only cell type that contains genetic material. E. None of the other answer options is correct.

whole genome sequences constructed using lymphocytes, granulocytes, and brain cells would likely be identical or nearly identical

You measure levels of Ca2+ in various locations within a motor neuron and a skeletal muscle fiber when the motor neuron is NOT depolarized, and the muscle fiber is at rest. Where do you expect to find high levels of Ca2+? A) bound to troponin B) within the sarcoplasmic reticulum of the muscle fiber C) diffusing into the motor neuron through specialized channels in the plasma membrane D) binding to the receptors at the motor endplate of the muscle cell E) within the T-tubules

within the sarcoplasmic reticulum of the muscle fiber

What is the end result of activating the MAP kinase pathway? phosphorylation of multiple cytosolic proteins a change in gene expression synthesis of second messenger molecules ion flow

a change in gene expression

The basal lamina is: a specialized form of the extracellular matrix found beneath all epithelial tissues. an area found wherever two different types of tissues meet. an area found beneath all connective tissues that helps them adhere to underlying muscle. a specialized form of the extracellular matrix found only in the skin.

a specialized form of the extracellular matrix found beneath all epithelial tissues

Intermediate filaments: play an important role in maintaining cell shape. have a diameter that is larger than a microfilament, but smaller than a microtubule. All of these choices are correct. play an important role in preventing skin from tearing by shear stress. undergo little change in length in comparison to microtubules and microfilaments.

all of these choices are correct

Cadherins bind to which type of cytoskeletal element(s)? both intermediate filaments and microfilaments microfilaments microtubules intermediate filaments

both intermediate filaments and microfilaments

The extracellular matrix is particularly important for which type of tissue? nervous connective muscle epithelial

connective

The FIRST step following PDGF binding of the receptor is: activation of MAP kinase. phosphorylation. dimerization. activation of gene expression.

dimerization

A cell can only respond to signals from other cells, not from the physical environment. False True

false

Structures known as microvilli are associated with: communication between cells. increased surface area for gas exchange. increased surface area for nutrient absorption. adhesion to the extracellular matrix.

increased surface area for nutrient absorption

In skin, the cells of the epidermis connect to the basal lamina through cellular junctions known as hemidesmosomes. Select the cytoskeletal element that helps maintain the integrity of this connection. intermediate filaments microfilaments both intermediate filaments and microfilaments microtubules

intermediate filaments

Cephalization is thought to be an adaptation for: (Select all that apply.) predation. forward locomotion. organ function. taste perception.

predation, forward locomotion

Which of the following statements is TRUE? All animals have a nervous system, all animals sense and respond to the environment, and it is necessary to have a nervous system to sense and respond to the environment. It is necessary to have a nervous system to sense and respond to the environment. All animals have a nervous system and it is necessary to have a nervous system to sense and respond to the environment, but not all animals sense and respond to the environment. All animals sense and respond to the environment. All animals have a nervous system.

all animals sense and respond to the environment

Microtubules form from dimers of _____BLANK and ______BLANK subunits that polymerize into a ____________BLANK. Question 1 choices Choice A., +tubulin; −tubulin; double helix Choice B., beta-tubulin; gamma-tubulin; beta sheet Choice C., alpha-tubulin; beta-tubulin; hollow tube , Choice D., an amino acid; phosphate; double helix

alpha-tubulin; beta-tubulin; hollow tube

Which of the following CORRECTLY lists the types of cellular communication from shortest to longest distance traveled by the signaling molecule to reach its responding cell? paracrine, autocrine, endocrine autocrine, paracrine, endocrine autocrine, endocrine, paracrine endocrine, paracrine, autocrine

autocrine, paracrine, endocrine

Microtubules can grow by addition of tubulin dimers to _______________BLANK, and they can shorten by removal of dimers from ______________BLANK. Question 4 choices Choice A., the plus end; the minus end Choice B., the minus end; the plus end Choice C., both plus and minus ends; the minus end Choice D., both plus and minus ends; both plus and minus ends Choice E., the plus end; both plus and minus ends

both plus and minus ends; both plus and minus ends

Cell movement can be facilitated by microfilaments in what way? Question 3 choices Choice A., by gliding past each other using energy from ATP Choice B., by bending according to transmembrane signals Choice C., by dynamic growing and shrinking at the ends

by dynamic growing and shrinking at the ends

Cadherins are: (Select all that apply.) cell adhesion molecules found in cell junctions. proteins involved in attachment of cells to the extracellular matrix. proteins involved in attachment of cells to neighboring cells. proteins that provide a pathway for molecules to move between cells.

cell adhesion molecules found in cell junctions, proteins involved in attachment of cells to neighboring cells

Which of the following is a component of the extracellular matrix produced by an animal cell? cellulose All of these choices are correct. collagen cadherin

collagen

An epithelial tissue is defined as a: few cells embedded into an extensive extracellular matrix. collection of contractile cells. network of cells that use chemical communication. collection of cells that lines cavities or outside surfaces.

collection of cells that lines cavities or outside surfaces

A pathologist is carrying out an autopsy. Upon opening the chest cavity, the pathologist sees a thick, fibrous tissue surrounding the heart. This is likely: connective tissue. epithelial tissue. muscle tissue. neural tissue.

connective tissue

Could an isolated melanin granule move along an actin microfilament? Yes, motor proteins all use ATP to cause a conformation change. No, motor proteins are specific for the type of filament they bind. None of the other answer options is correct. Yes, melanin granules have motor proteins.

no, motor proteins are specific for the type of filament they bind

The ability of microtubules to undergo rapid ___________BLANK and slower ____________BLANK is associated with the ability of the ______________BLANK to explore the cell and locate chromosomes. Question 3 choices Choice A., polymerization; depolymerization; microtubules Choice B., depolymerization; polymerization; spindle apparatus Choice C., synthesis; hydrolysis; cytoskeleton elements Choice D., synthesis; hydrolysis; microtubules

depolymerization; polymerization; spindle apparatus

Membrane potential is determined by the: number and type of phospholipids present in a membrane. difference in concentration of ions and charged molecules on the two sides of a cell's plasma membrane. number and types of ion-channel proteins present in the plasma membrane of a cell. concentration of cholesterol in a membrane.

difference in concentration of ions and charged molecules on the two sides of a cells plasma membrane

Mammalian steroid hormones are signaling molecules that function in which of the following types of cell signaling? paracrine autocrine All of these choices are correct. endocrine

endocrine

Which signaling system involves the LONGEST time interval between release of a signaling molecule and activation of a receptor? endocrine contact-dependent paracrine autocrine

endocrine

Which of the following CORRECTLY matches a cell or group of cells with its ability to differentiate into different specialized cells? fertilized egg: pluripotent mesoderm: pluripotent fertilized egg: multipotent endoderm: multipotent ectoderm: totipotent

endoderm: multipotent

The presence of excess EGF receptors can result in: normal cell division. diminished cell division. excessive cell division.

excessive cell division

The muscle cells and nerve cells in a mouse look very different and serve very different functions in the mouse's body. These differences are because the muscle cells and nerve cells in the mouse: have different chromosomes. have different ribosomes. copy different genes. use different genetic codes. express different genes. have different genes.

express different genes

What does a ligand-gated channel do? It triggers the activity of a phosphatase. It binds small, nonpolar signaling molecules. It allows ions to move across the plasma membrane. It activates a G protein

it allows ions to move across the plasma membrane

The fertilized egg is totipotent, which means: the Y chromosome does not create interference to the expression of X-linked genes. it can give rise to a complete organism. it only contains genetic material from the female. it can be removed and donated to a surrogate womb. it forms the membranes that surround and support the developing embryo.

it can give rise to a complete organism

In the image of a microtubule shown above, the plus and minus ends are labeled. If the motor protein shown is dynein, what can you say about the direction in which the vesicle is being carried? Question 6 choices Choice A., It can go in either direction on microtubules. Choice B., It is going to the right (toward the plus end). Choice C., It is going to the left (toward the minus end). Choice D., The direction cannot be determined from the data provided.

it is going to the left (toward the minus end)

Which one of the following statements about intracellular transport is TRUE? Kinesin moves substances along microfilaments. Kinesin and dynein move substances along microfilaments. Kinesin and dynein move substances along microtubules. Kinesin and myosin move substances along microtubules.

kinesin and dynein move substances along microtubules

Shown here are four ligands (M, H, K, and L) and their corresponding receptors along with four genes (S, T, U, and V) whose activity the receptor controls through signal transduction. The arrows indicate gene activation, the T-bars indicate gene repression. ligand M= both on ligand H= u on, v off ligand K= u off, v on ligand L= both off Which ligand acts as a signal resulting in gene U being active and V inactive? ligand M ligand H None of the other answer options is correct. ligand K ligand L

ligand h

Shown here are four ligands (M, H, K, and L) and their corresponding receptors along with four genes (S, T, U, and V) whose activity the receptor controls through signal transduction. The arrows indicate gene activation, the T-bars indicate gene repression. ligand M= both on ligand H= u on, v off ligand K= u off, v on ligand L= both off Which ligand acts as a signal resulting in gene U being inactive and V being active? ligand H ligand M ligand K None of the other answer options is correct. ligand L

ligand k

Microfilaments help a cell ____________________BLANK Question 2 choices Choice A., strengthen the plasma membrane. Choice B., maintain its size and shape. Choice C., separate chromosomes during anaphase of mitosis.

maintain its size and shape

Review the experiments by Kohler and Lipton described in Figure 9.5. What is the key difference between blood serum and blood plasma that affects their ability to help fibroblasts grow in culture? Serum contains more platelet cells than plasma, and platelet cells promote cell growth. Plasma contains more platelet cells than serum, and platelet cells inhibit cell growth. Molecules found in serum promote cell growth; these molecules are not found in plasma. Molecules found in plasma inhibit cell growth; these molecules are not found in serum.

molecules found in serum promote cell growth; these molecules are not found in plasma

Sensory neurons are involved in all of the following EXCEPT: hearing. muscle contraction. vision. taste.

muscle contraction

A receptor that is inside the cell would require a __________ signal molecule that can ____________________the plasma membrane. Choice A., polar; pass through Choice B., polar; bind to Choice C., nonpolar; pass through Choice D., nonpolar; bind to

nonpolar; pass through

Notch and Delta are both transmembrane proteins involved in cell communication in the developing nervous system of vertebrate animals. What makes Notch different from Delta? Notch is a receptor, and Delta is a signaling molecule. All of these choices are correct. Notch is required at higher density than Delta to alter cell fate. Notch is a signaling molecule, and Delta is a receptor.

notch is a receptor, and delta is a signaling molecule

In the figure, arrow B is pointing at the _____ in the _____. /brainhoney/Resource/11009259,8,0,4E,3/Assets/resources/chapter_35/35_41.jpg synaptic cleft; neuron neurotransmitter; synaptic cleft vesicle; dendrite nucleus; cell body nucleus; glial cell

nucleus; cell body

Which of the following would be more likely to cause development of a microvillus on an intestinal epithelial cell? Question 4 choices Choice A., plus (+) end growth of microfilaments at the tip of the microvillus and shrinkage at the minus (−) end Choice B., plus (+) end growth of microfilaments at the tip of the microvillus but no shrinkage at the minus (−) end Choice C., minus end growth of microfilaments at the tip of the microvillus and shrinkage at the plus (+) end

plus (+) end growth of microfilaments at the tip of the microvillus but no shrinkage at the minus (-) end

The extracellular matrix is a network of: proteins found in the cellular membrane that allow for substances to enter the cell. proteins and polysaccharides outside the cell that play a role in structural support. channel proteins found in the cellular membrane that allow for communication. proteins and polysaccharides inside the cell that keep organelles in place.

proteins and polysaccharides outside the cell that play a role in structural support

In many signaling pathways, once a signaling molecule binds to a receptor, the receptor becomes phosphorylated. This initial phosphorylation step BEST demonstrates:9.8 termination. cellular response. receptor activation. signal transduction. either cellular response or signal transduction.

receptor activation

Which is the CORRECT order for these steps in cell signaling? receptor activation, response, signal transduction receptor activation, signal transduction, response response, signal transduction, termination signal transduction, receptor activation, response

receptor activation, signal transduction, response

A constitutively active receptor will do what in the presence of its ligand? remain activated be down-regulated be inhibited turn off

remain activated

Microfilaments are composed of ____________BLANK in ____________BLANK arrangement. Question 1 choices Choice A., polymers of actin protein; a hollow tube-like Choice B., repeating actin subunits; a thin double-helix , Choice C., polymers of tubulin; a double-helix Choice D., alpha and beta dimer subunits; a double-helix

repeating actin subunits; a thin double-helix

f the vesicle being carried in the figure above (in an animal cell) contains content that is to be excreted from the cell at the plasma membrane, it is probably being transported toward the __________BLANK by the motor protein ____________BLANK. Question 7 choices Choice A., left; dynein Choice B., left; kinesin Choice C., right; dynein Choice D., right; kinesin

right; kinesin

When an environmental stimulus is received, the signal is usually transmitted through three types of nerve cells. In which order is the signal transmitted through these cells? motor neurons, sensory neurons, interneurons sensory neurons, interneurons, motor neurons interneurons, sensory neurons, motor neurons motor neurons, interneurons, sensory neurons sensory neurons, motor neurons, interneurons

sensory neurons, interneurons, motor neurons

Signal transduction in development is often amplified by: methylation of the target cell's DNA. histone modification in chromosomes. sequential phosphoryation of proteins in the cytoplasm. opening and closing of nuclear pores.

sequential phosphoryation of proteins in the cytoplasm

A _________ expresses a gene or genes that direct production of the signaling molecule, and the _______________ expresses a gene or genes that direct production of the _________________. Choice A., signaling cell; responding cell; receptor protein Choice B., responding cell; signaling cell; receptor protein Choice C., signaling molecule; responding cell; signaling cell Choice D., responding cell; receptor protein; signal protein

signaling cell; responding cell; receptor protein

When cells communicate by the signaling process, one cell produces a _________________ that must be received by the ___________on or in the responding cell. Choice A., signaling particle; signal enzyme Choice B., signaling molecule; signal receptor Choice C., hydrophilic signal; hydrophilic receptor Choice D., cell division signal; plasma membrane Choice E., nonpolar signal; nonpolar receptor

signaling molecule; signaling receptor

Motor proteins cause movement by: (1) undergoing a conformational change, (2) harnessing energy from ATP, and (3) binding to the cytoskeleton. Statements (1) and (3) are correct. Statements (2) and (3) are correct. Statements (1) and (2) are correct. Statements (1), (2), and (3) are correct.

statements (1), (2), and (3) are correct

Which one of the following is NOT a cell surface-type receptor? receptor kinase G protein-coupled receptor ligand-gated receptor steroid receptor

steroid receptor

Which of the following is NOT the role of an interneuron? conveying information from the internal environment of an animal maintaining homeostasis relaying information from sensory to motor neurons stimulating a muscle to contract

stimulating a muscle to contract

What part of a cell's cytoplasm is responsible for the diversity of nerve cell shape? the nucleus All of these choices are correct. the endomembrane system the cytoskeleton

the cytoskeleton

Imagine that you are examining a mouse that does not produce basal lamina in the skin. How will this mouse be different from a normal, wild-type mouse? Cellular junctions will fail to form between the cells of the epidermis. The epidermis and dermis will be strongly connected. The epidermis will not be connected to the dermis. The dermis will be disorganized and will lack blood vessels. All of these choices are correct.

the epidermis will not be connected to the dermis

The MOST likely reason(s) a metastatic tumor cell might lose its connection to the basal lamina would be: a change in the composition of the basal lamina. the loss of integrin proteins from the cell's surface, or a change in the type of integrin proteins present on the cell's surface. a change in the type of integrin proteins present on the cell's surface. the loss of integrin proteins from the cell's surface.

the loss of integrin proteins from the cells surface, or a change in the type of integrin proteins present on the cells surface

The ability of a specific tissue or organ to respond to the presence of a hormone is dependent on: the presence of the appropriate receptors on the cells of the target tissue or organ. nothing. All hormones of the body are able to stimulate all cell types because hormones are powerful and nonspecific. the location of the tissue or organ with respect to the circulatory path. the membrane potential of the cells of the target organ.

the presence of the appropriate receptors on the cells of the target tissue or organ

Consider Figure 20.25. Imagine that there is a mutation in the gene for the Notch receptor in the progenitor cell. How does mutation affect vulva development? The progenitor cell will remain a type 1 cell. The progenitor cell will become a type 2 cell. The type 2 cell will differentiate into a type 1 cell. The EGF receptor cannot bind its ligand.

the progenitor cell will remain a type 1 cell

Gap junctions and plasmodesmata have what feature in common? They both are made up of protein subunits located in the plasma membrane. They both allow direct transport of materials between cells. They both attach to the cytoskeleton. They are both found in plant cells.

they both allow direct transport of materials between cells

Which of the following best describes a role that microfilaments play in the structure and function of red blood cells? Question 5 choices Choice A., They anchor and orient the O2-bearing hemoglobin protein molecules. Choice B., They provide a track for directing O2 to the proper cellular locations. Choice C., They maintain the biconcave shape to maximize gas exchange.

they maintain the biconcave shape to maximize gas exchange

A researcher has discovered a new ligand that can pass through the cell membrane and bind to a receptor in the nucleus. Which of the following statements is FALSE regarding this ligand? This ligand likely has a similar structure to cholesterol. This ligand is likely nonpolar. This ligand is likely a steroid. This ligand likely binds to a transmembrane receptor. This ligand likely plays a role in transcription.

this ligand likely binds to a transmembrane receptor

How does an "activated" receptor transfer information into the cell? by decreased phosphorylation of the receptor through a conformational change of the receptor by altering the ligand-binding site of the receptor by increased translation of the receptor

through a conformational change of the receptor

How do cells connect to the extracellular matrix? through cadherins through integrins through gap junctions through tight junctions

through integrins

Which of the following cell junctions is involved in creating a barrier between cells? desmosome tight junction adherens junction

tight junction

Each answer option below lists terms that classify cell types according to their developmental potential. Which of the options lists the terms from those capable of differentiating into the greatest number of different specialized cells to those capable of differentiating into the least number of different specialized cells? multipotent, totipotent, pluripotent multipotent, pluripotent, totipotent pluripotent, totipotent, multipotent totipotent, multipotent, pluripotent totipotent, pluripotent, multipotent

totipotent, pluripotent, multipotent

Signaling molecules involved in paracrine and autocrine signaling: travel by diffusion. remain attached to the plasma membrane. travel in the circulatory system.

travel by diffusion

The strength of collagen comes from its: ability to bind to polysaccharide molecules. triple helical structure and bundling. triple helical structure and bundling, as well as its amino acid sequence. amino acid sequence.

triple helical structure and bundling

Ganglia were the evolutionary precursor to the centralized concentration of neurons that we now call a brain. False True

true

Signaling pathways have been conserved in a wide range of organisms. True False

true

Some cell junctions allow materials to pass between adjacent cells so that they work together as a unit. False True

true

Why are some mutations of Ras associated with cancer? Ras activates the MAP kinase signal transduction pathway. Ras binds to growth factor receptors. Ras alters ion flow across the cell membrane. Ras is a type of second messenger.

was activates the MAP kinase signal transduction pathway