MCB 150: Quests

Réussis tes devoirs et examens dès maintenant avec Quizwiz!

Helicobacter pylori,

The Berkeley Pit is an abandoned, open-pit mine in Butte, Montana. Accumulating water reacts with a variety of heavy metals (e.g., arsenic, cadmium, copper, zinc) in mineral deposits to form sulfuric acid. This sulfuric acid then leaches more of these minerals, creating a cycle that has produced a pH of 2.5. Consequently, when a flock of geese entered the waters of Berkeley Pit in 1995, they quickly died—but not before depositing some microorganisms that have adapted and continue to grow. Had humans instead of geese deposited microorganisms into the Berkeley Pit, which of the following microbes living in/on humans (known as commensal microbes) are the most likely to have survived? - Clostridium difficile, adapted to the large intestine - Streptococcus oralis, adapted to the mouth - Staphylococcus aureus, adapted to human skin - Pseudomonas aeruginosa, adapted to the large and small intestine - Helicobacter pylori, adapted to the human stomach (and the cause of stomach ulcers)

shock absorbers

The DAPC does for muscle integrity what the _______________ do/does for an automobile. - shock absorbers - gas tank - steering wheel - brakes

line graph; dependent; Y

The Illinois Department of Public Health (IDPH) provides data on COVID-19 cases and testing that is updated daily. The table below shows the number of confirmed cases statewide for each day in the month of January 2022 as of yesterday. - If you wanted to display these data visually, a _______________ would be the most appropriate choice, and the number of new cases would be the _______________ variable and be displayed on the _____ axis. If the descriptive term does not apply to a particular graph type, it will be represented as N/A for not applicable.

two sets of base triplets

The MCB 150 TAs just discovered life on Mars. They have identified the genetic macromolecule for this alien lifeform and want to determine how its genetic information in encoded. Channeling their inner Chargaff, they compiled the following data about the chemical composition of this new macromolecule: Which of the following best describes how these molecules interact to form a genetic code? - Three sets of base triplets - Three sets of base pairs - Two sets of base triplets - Two sets of base pairs

Encode a protein able to bind multiple ncRNAs

The MCB 150 TAs' semester-long quest to understand Martian life continues. After sequencing the genome of the organism they discovered (Gladiator glacies), they want to know if this organism contains a system comparable to the Type II CRISPR-Cas system studied in class. Which of the following must be true for G. glacies to have a Type II CRISPR-Cas system? - Silence protein translation when fed a dsRNA corresponding to the gene's sequence - Encode a protein able to bind multiple ncRNAs - Contain a crispr locus with multiple spacers - Be immune to any bacteriophage to which it is subjected - Encode a protein resembling Dicer

fatty acids amino acids

The chemical group shown below can be found in _______________. Choose all that apply. - fatty acids - amino acids - nucleotides - monosaccharides

hydrolysis of a carbohydrate

The figure below could represent the _______________. - synthesis of a protein - elongation of a nucleic acid - hydrolysis of a carbohydrate - The figure could represent all of the above.

breaking down more Protein N than it is synthesizing Protein M

The figure below represents a eukaryotic cell with two different types of receptors, (A) and (B). (A) and (B) are both able to bind the same ligand (L), but activation of (A) leads to a different cellular response than activation of (B). There are approximately equal numbers of (A) and (B) on the surface of this cell, and if every receptor were activated, there would be approximately as many molecules of (M) synthesized as molecules of (N) broken down. The Kd of Receptor (A) for (L) is 500 mM, and the Kd of Receptor (B) for (L) is 100 mM. If the actual concentration of (L) present and distributed evenly around the cell is 300 mM, the cell would be _______________.

Hydrogen bond

The figure below represents a single polypeptide chain with its amino (N) and carboxyl (C) ends labeled. Match the labeled region in the polypeptide with the appropriate type of molecular stabilizing force. W?

Hydrophobic Region

covalent bond

Ionic Bond

extracellular space

The figure below represents a transmembrane glycoprotein at the plasma membrane of an animal cell: The side of the membrane labeled (B) is the ------- - cytoplasm - extracellular space - glucose - nucleus

UUA → GUA

The figure below represents a transmembrane protein crossing a biological membrane: In the mRNA for the wild-type version of this protein, an in-frame UUA codon specifies the amino acid at the position labeled (B). Which single base substitution change is most likely to result in the protein retaining at least some of its function

lane 5

The figure below represents gel electrophoresis of purified samples of DNA: Lane 1 includes molecular standards of the base pair length shown, from 100 bp to 350 bp in length. Lane 2 includes all relevant alleles from two different CODIS loci, one with fragment lengths between 100 and 175 bp, the other with fragment lengths between 225 and 325 bp. Lane 3 is the DNA profile at those two loci from a blood sample found at a crime scene. If Lanes 4 and 5 are DNA profiles from two suspects, the more likely suspect is the one whose DNA profile is in _______________.

None of the above statements about the figure shown are correct.

The figure below represents three protein coding genes labeled (X), (Y), and (Z) in a section of double-stranded DNA: Identify the correct statement about the figure above. - If this region of DNA came from a eukaryote, it is possible that all three genes are controlled by a single promoter and a single transcriptional terminator. - If transcription of gene (X) uses the top strand as a template and transcription of gene (Z) uses the top strand as a template, then transcription of gene (Y) will use the bottom strand as template. - The three genes would be transcribed by a single type of RNA polymerase in bacteria but three different types of RNA polymerases in eukaryotes. - If the same change of a G to a T occurs at positions (M) and (N), only the change at position (N) would be considered a mutation. - None of the above statements about the figure shown are correct.

promotor; coding

The figure below represents transcription in E. coli: The region in the rectangle labeled (A) is most likely to be identified as a(n) ------ and the strand labeled (B) is most accurately referred to as the ---------.

5' - TGGATCAGTC - 3'

The following figure represents information from a dideoxy chain termination sequencing reaction. The letters to the right of the electrophoresis results indicate the ddNTP that was incorporated at that position. Identify the sequence of the newly-synthesized fragment that yielded these results.

The frog-\alphaα gene and the mouse-\alphaα gene are orthologs.

The following figure represents the evolution of the \alphaα- and \betaβ-globin genes in different animal species: Identify the correct relationship below. - The frog-\alphaα gene and the frog-\betaβ gene are orthologs. - The frog-\alphaα gene and the frog-\betaβ gene are identical. - The frog-\alphaα gene and the mouse-\alphaα gene are paralogs. - The frog-\alphaα gene and the mouse-\alphaα gene are orthologs.

3.0

The following figure represents two cells, labeled (A and (B), shown at the same scale: If cell (B) has a surface area-to-volume ratio of 0.3, the surface area-to-volume ratio of cell (A) is most likely __________. - 0.003 - 3.0 - 0.03 - 3.0 - 30

antiporter; primary active transport

The sodium/potassium ATPase ------ is an example of --------.

hydrogen bonding

Using a curling iron to temporarily introduce curls into straight hair most directly affects _______________. - hydrogen bonding - hydrophobic effects - peptide bonds - ionic bonding - disulfide linkages

Attenuated vaccine

Using a weakened but still viable form of the pathogen

C30H52O26

What is the chemical formula of an oligosaccharide composed of five hexose sugars? - C30H60O30 - C25H40O20 - C25H50O25 - C30H52O26 - C30H50O25

What is the probability that a mouse pup (male or female) from a heterozygous normal-size mother (Ifg2 Igf2-) and a homozygous dwarf father (Igf2- Igf2-) is normal-sized? 0% 25% 50% 75% 100%

cis-acting

When Xist RNA is transcribed, it associates only with the X chromosome from which it was transcribed. Xist RNA can therefore be considered an example of ------ factor.

gene expression stops during M-phase

When a human cell is progressing normally through the cell cycle, M-phase is usually the shortest in duration. This is primarly because _______________. - DNA replication is a surprisingly fast process - there are no checkpoints in M-phase - gene expression stops during M-phase - DNA repair is easier when chromosomes are condensed

Using alternative splicing to produce different versions of proteins in different cell types

Which of the following is an example of post-translational regulation? - Preventing a ribosome from recognizing a start codon by hiding a ribosome binding site - Positioning a repressor protein on an operator region to prevent RNA polymerase from binding - Stalling a ribosome by limiting the availability of certain charged tRNA molecules - Using alternative splicing to produce different versions of proteins in different cell types - Inactivating a functional protein by phosphorylating it

2 molecules of CO2

Which of the following is not a net product of glycolysis per molecule of glucose? Consider only the reactions of glycolysis and not what may occur before or after. - 2 molecules of ATP - 2 molecules of NADH - 2 molecules of CO2 - 2 molecules of pyruvate - All of the above are net products of glycolysis per molecule of glucose.

TTGCAA GGGCCC ATATAT CTATAG

Which of the following sequences are most likely to be recognized by a Type II restriction enzyme? Only one strand of a double stranded DNA sequence is shown, and all sequences are given 5'-3'. Choose all that apply. TTGCAA GGGCCC ATATAT TACTAC CTATAG CCCCCC

GTP hydrolysis by EF1

Which step in translation is most directly affected by ricin? - Recognition of the 5' methylguanosine cap structure - Peptidyl transferase activity - GTP hydrolysis by EF2 - GTP hydrolysis by EF1 - Entry of a Release Factor into the A site

PstI; Kanamycin; Tetracycline

You are attempting to insert a gene of interest into the cloning vector below: In this vector, E identifies an EcoRI restriction site in the coding region of a gene which confers resistance to the antibiotic Kanamycin (KanR). P identifies a PstI recognition site in the coding region of a gene which confers resistance to the antibiotic Tetracycline (TetR). If the goal is to select for successful transformation of a recombinant vector by growing transformed cells on media containing Kanamycin, you should insert your gene of interest into the ------ and look for colonies that are resistant to -------- and sensitive to (killed by) --------.

All fragments would be 11 nucleotides in length.

You are peforming a dideoxy chain termination sequencing reaction, and include the following components: 1. Template DNA inserted into a sequencing vector 2. Sequencing primers that anneal to the vector immediately upstream of the insertion site 3. ddATP, ddTTP, ddCTP, ddGTP fluorescently labeled with unique colors 4. DNA polymerase in its optimal conditions (buffers, temperature, pH, etc.) If the primer is 10 nucleotides in length and the inserted template DNA is 100 nucleotides in length, what fragment length(s) would you expect in your gel electrophoresis? Assume for this question that you stop reading the gel when you encounter vector sequence on the other side of the inserted template. - All fragments would be from 12-109 nucleotides in length. - Every fragment length from 11-110 nucleotides would be represented on your gel. - All fragments would be 11 nucleotides in length. - All fragments would be 110 nucleotides in length.

poly-T

You are preparing to use a reverse transcriptase to create cDNA from a sample containing purified mature eukaryotic mRNA. If you are preparing a primer using only one type of nucleotide, the primer most likely to be successful would be __________. - poly-G - poly-A - poly-T - poly-C - No primer composed of a single type of nucleotide can be used to prepare cDNA from these mRNAs.

highly methylated

You are studying mice with the Avy mutation in the Agouti gene. If one of the mice has dark fur, it most likely has a(n)------- for the Agouti gene compared to a mouse with lighter fur.

Detectable expression of the genes in every spot on this chip is observed from normal cells, cancer cells, or both.

You are working in a cancer lab and are interested in identifying some genes that are important in the onset of lung cancer. You have several genes you think may be involved, so you "print" spots of the candidate DNA sequences on a microarray slide. After doing this, you isolate mRNA from both normal lung cells and cancerous lung cells. You make fluorescently-tagged cDNA from each mRNA sample; the cDNAs from normal cells are tagged with a green-colored molecule and the cDNAs from cancer cells are tagged with a red-colored molecule. You hybridize the cDNAs with the microarray and get the following data. (Green spots are labeled with "G", red spots are labeled with "R".) Identify the correct statement below. - Detectable expression of the genes in every spot on this chip is observed from normal cells, cancer cells, or both. - Because spots B4 and B6 are green, this is an indication that these genes do not contribute to cancer. - The level of expression of the gene in spot B5 is the same as the level of expression of the gene in spot C7 - The genes in spots A1 and C6 are likely candidates for tumor suppressor genes. All of the statements about the microarray are correct. - None of the statements about the microarray are correct.

Chain elongation is terminated in the presence of Zidovudine.

Zidovudine (shown below) is an analog of thymidine and can be phosphorylated into a nucleoside triphosphate the same as thymidine. Zidovudine has been shown to have anti-cancer effects, specifically in leukemia. Based on the structure of Zidovudine, what is the most likely explanation of how it kills leukemic cells? - The transition from G0 to S is stimulated with the addition of Zidovudine. - Chain elongation is terminated in the presence of Zidovudine. - Zidovudine activates the transcription factor p53. - Zidovudine activates CDK1 and halts DNA repair.

DNA polymerase I and primer removalc

-------- is responsible for breaking phosphodiester linkages in a 5' to 3' direction during ---------.

conversion of a C-G base pair to a T-A base pair

A cytosine base is exposed to an alkylating agent which converts it to 5-methylcytosine. This is followed by spontaneous deamination of the 5-methylcytosine, most likely leading to ________________. - the loss of nucleotide excision repair systems - conversion of a C-G base pair to a T-A base pair intrinsic apoptosis through activation of death receptors - a chromosomal translocation event - activation of the mismatch repair system

The genomes of cells (A) and (B) differ, so the proteins they are capable of synthesizing as responses will differ.

A hormone is discovered to elicit a different cellular response in cell type (A) than it does in cell type (B) within the same organism. Which of the following is the least likely explanation for this observation? - Different transcription factors are ultimately expressed in cell (A) and cell (B) as a response to the hormone. - The receptor for the hormone on cell (A) is different than the receptor for the hormone on cell (B), leading to a different initial response. - The genomes of cells (A) and (B) differ, so the proteins they are capable of synthesizing as responses will differ. - Chromatin accessibility may differ between cell (A) and cell (B) leading to different proteins ultimately being expressed. - All of the above explanations are equally likely to account for the observation.

1 is False; 2 is True

A hypothetical kinase recognizes the following consensus motif in order to properly identify its natural substrate: R-X-R-D-X-S/T-D In this motif, X represents any amino acid, and the other letters are one-letter amino acid abbreviations, which can be quickly looked up here. Consider the following two statements: 1. The motif is likely to be found on the insulin receptor investigated during class activities. 2. It is possible to find this motif on different types of proteins in a cell.

204

A messenger RNA is 615 nucleotides long, including the sequences for the initiator and termination codons, and ignoring the untranslated regions at the 5' and 3' ends. The number of amino acids in the protein made from this mRNA would be _______________. - 614 - 613 - 205 - 204 - 203

polar; nonpolar; amphipathic

A phospholipid has both _______________ and _______________ regions, making it _______________. - acidic; basic; neutral - polar; nonpolar; amphipathic - positively-charged; negatively-charged; dipolar - cyclic; linear; water-soluble

Molecule A is glucose, molecule B is urea

A planar phospholipid bilayer was formed across a small hole in a partition that separates two aqueous compartments, as shown in the figure below. A mixture of two molecules, A and B, was added to one of the compartments and the fate of both molecules was followed over time. 120 minutes later, molecule A was evenly distributed between the two aqueous compartments, while the distribution of molecule B was unchanged. What is the least likely identity of molecules A and B?

Fusion of nearby glucose transporters to the cell membrane

A single cell can have multiple different responses to the binding of insulin to its surface. Identify the response most likely to be classified as a short-term effect as opposed to a long-term effect. - Initiating a relay followed by a protein kinase cascade - Direct activation of a transcription factor - Fusion of nearby glucose transporters to the cell membrane Initiating a second messenger response - All of the above would be classified as short-term effects.

Frameshift

An additional nucleotide is mistakenly incorporated into a coding region

Missense

An amino acid specifying codon is changed to a codon specifying a different amino acid

Same sense

An amino acid specifying codon is changed to a different codon that specifies the same amino acid

Nonsense

An amino acid specifying codon is changed to a stop codon

naked DNA nucleosomes 30nm fibers radial loop domains metaphase chromosomes

Arrange the following levels of DNA organization from least compact to most compact. - nucleosomes - 30nm fibers - radial loop domains - metaphase chromosomes - naked DNA

atoms molecules cells tissues organs organisms population community ecosystem

Arrange the levels of biological organization from smallest to largest. - organs - community - population - organisms - tissues - atoms - ecosystems - molecules - cells

Repetitive DNA Introns and regulatory sequences of genes Exons of protein coding genes and genes for rRNA and tRNA

Arrange the types of sequences in the human genome in order from most prevalent to least prevalent. Most prevalent - Repetitive DNA - Exons of protein coding genes and genes for rRNA and tRNA - Introns and regulatory sequences of genes Least prevalent

Mosaicism of M-linked traits occurs in males of the species. The males of this species inactivate an M chromosome.

As the MCB 150 TAs continue to investigate life on Mars, they discover a diploid, multicellular organism with sex chromosome production and function resembling humans. However, in this life form, the males have two copies of the sex chromosome M (MM), while the females have one copy of the sex chromosome M and one copy of the sex chromosome J (MJ). Which of the following statements is most likely correct about this life form? Choose all that apply. - Mosaicism of M-linked traits occurs in males of the species. - Females of this species have structures resembling Barr bodies in their cells. - The males of this species inactivate an M chromosome. - Males and females of this species are equally likely to practice dosage compensation.

Water

Bea Kemist is investigating an organism from another planet to see if it uses a similar system of cellular respiration. She exposes cells to a radioactive isotope of oxygen in O2. If this alien organism uses the same system of cellular respiration as you have studied, which of the following molecules will be radiolabeled (i.e., contain radioactive oxygen)? Choose all that apply. - NADH - FADH2 - Pyruvate - Carbon dioxide - Water

Hydrolysis of a coronaviral genome

CRISPR-Cas13 is a system with a spacer of 22-30 nucleotides and a nuclease activity that degrades ss-RNA. Identify the most likely practical application of this system. - Targeted knockout of an activated oncogene - Hydrolysis of a coronaviral genome - Repair of a mutated tumor suppressor gene - Insertion of a new gene of interest into a specific location in the host genome - All of the above are equally likely to be applications of the CRISPR-Cas13 system.

CAP site TATA box Enhancer

Categorize each of the following as exerting either a cis-effect or a trans-effect. - CAP site - TATA box - Enhancer - Mediator - cAMP-CAP

Mediator cAMP-CAP

Categorize each of the following as exerting either a cis-effect or a trans-effect. - CAP site - TATA box - Enhancer - Mediator - cAMP-CAP

Glycolysis Transcription and translation DNA repair

Choose any activity listed below carried out by cells in G0. Glycolysis Transcription and translation DNA repair DNA replication Mitosis and cytokinesis

Bacterial chromosomes are chopped to pieces, causing the lysis (death) of those bacterial cells in the patient.

Ciprofloxacin (structure shown below) is an antibiotic that inhibits bacterial DNA gyrase (a kind of topoisomerase) from ligating back together the DNA that it cuts. Based on this information and your understanding of DNA replication, which of the following statements best describes how cipro works in a human patient? - Human topoisomerase is inhibited, causing extensive DNA damage which in turn activates p53, the intrinsic apoptosis pathway, and release of cytochrome c from the mitochondria. - Ciprofloxacin binds to the Death receptor of cells infected with bacteria. Once the Death-Inducing Signaling Complex (DISC) trimer is formed, these infected cells undergo apoptosis via the extrinsic pathway. - Bacterial chromosomes are chopped to pieces, causing the lysis (death) of those bacterial cells in the patient. - Bacterial topoisomerase is inhibited, causing extensive DNA damage which in turn activates the bacterial equivalent of intrinsic apoptosis including the release of cytochrome c from their mitochondria.

E. coli DNA polymerase I E. coli DNA polymerase III

Classify each type of nucleic acid-synthesizing enzyme as one of the following: DNA-dependent, DNA-synthesizing DNA-dependent, RNA-synthesizing RNA-dependent, DNA-synthesizing RNA-dependent, RNA-synthesizing Each enzyme belongs in only one category, and each category can have zero, one, or more representatives. - E. coli DNA polymerase I - E. coli Primase - E. coli DNA polymerase III - Human telomerase

E. coli Primase

Human telomerase

Nothing

Abiraterone

Consider the following medications used in cancer treatment: - Topotecan is a Topoisomerase I inhibitor derived from the phytochemical camptothecin. - Vincristine binds to tubulin and prevents dimers from polymerizing into microtubules. - Abiraterone prevents CYP17A1 from producing androgens (male-specific steroids like testosterone), depriving testosterone-dependent prostate cancers of this steroid. Identify the treatment(s) that would be classified as precision medicine(s). Choose all that apply. - Vincristine - Topotecan - Abiraterone

intracellular; extracellular

Consider the following signaling molecules labeled (C) and (D): Molecule (C) is more likely to bind to an --------, while molecule (D) is more likely to bind to --------. Use each drop-down item only once.

1 and 2 True

Consider the following statements about ecstasy (MDMA): 1. Ecstasy causes serotonin receptors to lose affinity for serotonin, leading to reduced physiological effects of serotonin. 2. Ecstasy can cause either hypothermia or hyperthermia.

1 and 2 are both false

Consider the following statements about eukaryotic messenger RNA molecules: 1. The first three bases in a eukaryotic mRNA are AUG and specify a non-modified version of methionine. 2. The last three bases in a eukaryotic mRNA are a stop codon recognized by a single release factor.

Statements 1 and 2 are false

Consider the following statements about genomes: 1. There is a linear relationship between the size of a eukaryote's genome and the number of protein-coding genes. 2. Although prokaryotic genomes are typically smaller than eukaryotic genomes, a higher percentage of a prokaryote's genome consists of repetitive sequences.

1 and 2 are false

Consider the following statements about immunity: 1. Different antibodies can be raised to different antigens on a pathogen because the size of a bacterial or viral pathogen is so much larger than the size of a single antibody. 2. Herd immunity is more easily reached when R0 values are high.

Statement 1 is false, Statement 2 is true.

Consider the following statements about linkage: 1. One map unit of distance is equivalent to a 10% recombination frequency. 2. If a two-factor testcross produces very few recombinants, the two genes are far apart.

1 and 2 are true

Consider the following statements about mutations: 1. Mutations in an organism's genome can be either spontaneous or induced. 2. Transcription and translation are more prone to error than DNA replication.

Statement 1 is true, Statement 2 is false.

Consider the following statements about the cell cycle: No S-phase checkpoint is observed because the commitment to replicate DNA is essentially irreversible. Failure to progress beyond a cell cycle checkpoint always results in apoptosis for that cell.

1 is TRUE; 2 is FALSE

Consider the following two statements about CRISPR-Cas systems: 1. During the adaptation phase, the proteins encoded by cas1 and cas2 genes form a complex that recognizes bacteriophage DNA as being foreign and cleaves it into small pieces. 2. Cas9 protein does not degrade DNA in the crispr locus because the adapted spacers are preceded by PAM sequences.

statement 1 is true and 2 is false

Consider the following two statements about RNA interference (RNAi): 1. IF Fire and Mello had conducted their classic experiment with RNA that was similar in sequence to the wild-type mex-3 RNA but not identical, their results would have been the same. 2. Because the exogenous RNA molecules in Fire and Mello's experiment were created in vitro, there was no need for Dicer to act when the RNAs were introduced into the cells.

1 and 2 are true

Consider the following two statements about genetic regulation: 1. Some repressor proteins act by binding enhancer sequences and thereby blocking activators from exerting their effects. 2. A regulatory region that controls the expression of a gene can be located in an intron of a neighboring gene.

irreversible; Complex IV

Cyanide is a(n) ------- inhibitor of ---------.

individual amino acids potentially being specified by multiple codons

Degeneracy in the genetic code refers to _______________. - individual codons potentially specifying multiple amino acids - individual amino acids potentially being specified by multiple codons - codons possessing a potentially variable number of nucleotides - a given codon specifying a different amino acid in Bacteria, Archaea, and Eukaryotes

Vector vaccine

Delivering the nucleic acid from one virus via a different virus

False

Desiring to know the mechanism of replication for the alien from the previous question, the TAs performed an experiment similar to Meselson and Stahl. Shown below are some of the data from these experiments: Based on these data, the Martian lifeform appears to use the same mechanism of replication as life on Earth. True or False?

struggling so much in chemistry she considered changing her major

During class, a small portion was shown of an interview with Jennifer Doudna, who shared in a 2020 Nobel Prize for her work on CRISPR-Cas9 as a gene editing tool. In that interview, Doudna admitted to _______________ when she was a freshman in college in Hawaii. Please note you do need to answer this question correctly in order to earn the 2 points for the question. - spending too many hours on the beach and too few at the bench - forgetting the words to a solo she was singing during a choir concert - struggling so much in chemistry she considered changing her major - working so many hours in the lab that she was failing all her classes at one point - wishing she had attended the University of Illinois and majored in MCB

During the case study on Duchenne Muscular Dystrophy, information was retrieved from external journal articles. One of those articles can be found here: https://www.sciencedirect.com/science/article/pii/S1319562X1000046X According to the data in that article, which of the following DMD exons is not deleted in a frequency of 6.7% of the patients studied? - 19 - 48 - 12 - 45

Nucleotide excision repair Methyl-directed mismatch repair Proofreading

Each of the following systems is involved in correcting mistakes that occur in DNA. Identify the system(s) that involve the direct activity of a DNA polymerase. Choose all that apply. - Nucleotide excision repair - Methyl-directed mismatch repair - Proofreading - Direct repair

1 is TRUE; 2 is FALSE

Enzyme X and Enzyme Y are experimentally determined to have the same Vmax. The Km of Enzyme X is 0.2 mM, while the Km of Enzyme Y is 2.0 mM. Consider the following statements about these enzymes: 1. Enzyme X has a higher affinity for its substrate than Enzyme Y has for its substrate. 2. At an actual substrate concentration of 1.1 mM, the reaction catalyzed by Enzyme X would have a higher velocity.

C and D

Enzyme X catalyzes the conversion of substrate S into product P. The activation energy of this reaction is shown below, where the solid line represents the uncatalyzed reaction and the dashed line represents the catalyzed reaction. The change in Gibbs free energy (ΔG) of the uncatalyzed reaction is represented by the distance between _______________.

Subunit vaccine

Giving patients a purified component of the pathogen

Water will enter and leave the cell but more will leave.

Human red blood cells have a solute concentration of 0.27 M. If red blood cells are placed in a solution with a solute concentration of 0.35 M, what will be the likely outcome? - The cell is not permeable to either water or salt, so no change will be detected. - Water and salt will enter the cell. - Water will enter and leave the cell but more will leave. - Water and salt will leave the cell. - Water will enter and leave the cell but more will enter.

Both eliminate the need for Primase by using synthetic primers.

Identify any statement below that is true for both dideoxy chain termination sequencing and PCR. Choose all that apply. - Both eliminate the need for Primase by using synthetic primers. - Both require a mix of dNTPs and ddNTPs. - Both require a template strand of known sequence. - Both involve multiple changes in temperature during repeated rounds of nucleic acid synthesis.

5' methylguanosine cap Alternative splicing

Identify if each item below is commonly found in bacteria, eukaryotes, or both bacteria and eukaryotes. Each item belongs in only one category, and each category can be used zero, one, or more times. - 5S rRNA - Aminoacyl tRNA synthetases - 5' methylguanosine cap - Alternative splicing - Sigma Factors

Aminoacyl tRNA synthetases 5S rRNA

Sigma factors

Aconitae (a Krebs cycle enzyme) Histone H1 (a protein that interacts with DNA)

Identify if each of the proteins below would be co-translationally sorted or post-translationally sorted. Note that for co-translational sorting, it should not be assumed that the protein is initially sorted into the environment where it is eventually localized. Co-translational sorting or Post-translational sorting - Aconitae (a Krebs cycle enzyme) - Insulin (a secreted protein) - Histone H1 (a protein that interacts with DNA) - Glucocerebrosidase (a lysosomal acid hydrolase) - Signal peptidase (an enzyme working in the ER)

Insulin (a secreted protein) Glucocerebrosidase (a lysosomal acid hydrolase) Signal peptidase (an enzyme working in the ER)

deoxyribose thymine

Identify if each structure is typically found in DNA only, RNA only, or both DNA and RNA. - phosphate - thymine - guanine - ribose - cytosine - uracil - deoxyribose - adenine

phosphate guanine adenine cytosine

Identify if each structure is typically found in DNA only, RNA only, or both DNA and RNA. - phosphate - thymine - guanine - ribose - uracil - cytosine - uracil - deoxyribose - adenine

uracil ribose

Identify if each structure is typically found in DNA only, RNA only, or both DNA and RNA. - phosphate - thymine - guanine - ribose - uracil - cytosine - uracil - deoxyribose - adenine

A loss-of-function mutation in a tumor suppressor gene A gain-of-function mutation in a proto-oncogene

Identify if the following mutations are likely to promote tumor development. Choose all that apply. - A loss-of-function mutation in a tumor suppressor gene - A gain-of-function mutation in a tumor suppressor gene - A loss-of-function mutation in a proto-oncogene Correct answer: - A gain-of-function mutation in a proto-oncogene

Alternative splicing provides a mechanism for an organism to possess a larger proteome than its genome would suggest.

Identify the correct statement about alternative splicing. - Alternative splicing provides a mechanism for an organism to possess a larger proteome than its genome would suggest. - The catalytic activity to carry out alternative splicing is found in the large ribosomal subunits. - Alternative splicing is a common mechanism for prokaryotic genomes to remain streamlined and efficient. - During alternative splicing, all of the exons are used, but some of the introns are not removed. - All of the above statements about alternative splicing are correct.

CAP can only exert its effect when paired with cAMP

Identify the correct statement about lactose metabolism in E. coli. - An inducible operon is on by default and can be inactivated when necessary -CAP can only exert its effect when paired with cAMP - The lac operon structural genes are each under the control of their own tightly regulated promoters -Positive regulation of the lac operon involves removing the repressor protein from the operator and allowing transcription to occur - All of the above statements about lactose metabolism in E. coli are correct.

Retrotransposons are likely to propogate more frequently than DNA transposons.

Identify the correct statement below about transposons. - Retrotransposons are more common in prokaryotes, while DNA transposons are more common in eukaryotes. - Retrotransposons are likely to propogate more frequently than DNA transposons. - DNA transposons produce full-length transcripts which facilitate movement to a different position in the genome. - Both types of transposons utilize an integrase enzyme coded for on the transposon itself.

The backbone of a single polypeptide chain has one available amino group and one available carboxyl group.

Identify the correct statement below regarding a single polypeptide chain. - Single polypeptides are nucleic acids connected by peptide bonds. - The backbone of a single polypeptide chain has one available amino group and one available carboxyl group. - The tertiary structure of a single polypeptide is stabilized by hydrogen bonding in the peptide backbone. - Quaternary forces result from one region of a single polypeptide interacting with a different region of that same polypeptide.

An activated G-protein is a transmembrane protein complex. G-protein cannot interact productively with GPCR in the absence of ligand binding to the GPCR. The α subunit of a G-protein has a nucleotide binding site that is occupied by GDP when the G-protein is in an inactive state.

Identify the correct statements about GPCR and/or G-proteins. Choose all that apply. - An activated G-protein is a transmembrane protein complex. - G-protein cannot interact productively with GPCR in the absence of ligand binding to the GPCR. - The α subunit of a G-protein has a nucleotide binding site that is occupied by GDP when the G-protein is in an inactive state. - When an activated G-protein separates into the α subunit and the β/γ dimer, only the α subunit initiates a transduction pathway leading to a cellular response.

When either of them co-infects a host cell with another virus, they reduce the severity of the infection by the other virus. They are dependent on the resources of a larger virus to complete their own replication cycles.

Identify the correct statements about Sputnik and/or Mavirus. Choose all that apply. - Mavirus is referred to as temperate because it can integrate into the host cell's genome. - They infect the same type of cell and enter that host cell the same way. - When either of them co-infects a host cell with another virus, they reduce the severity of the infection by the other virus. - They are dependent on the resources of a larger virus to complete their own replication cycles.

The template molecule is read from 3' to 5'. The nucleotides in the newly-synthesized strand are complementary to the nucleotides in the template strand. The newly-synthesized strand is antiparallel to the template. The newly-synthesized strand is polymerized from 5' to 3'.

Identify the correct statements about template-directed nucleic acid synthesis. Choose all that apply. - The newly-synthesized strand is polymerized from 5' to 3'. - The template molecule is read from 3' to 5'. - The nucleotides in the newly-synthesized strand are complementary to the nucleotides in the template strand. - The newly-synthesized strand is antiparallel to the template.

eventually reach a state of equilibrium require a source of energy so that atoms and molecules can encounter each other typically need to be catalyzed to occur at biologically relevant rates

Identify the correct statements below. Choose all that apply. Chemical reactions in biological systems ____________________. - eventually reach a state of equilibrium - require a source of energy so that atoms and molecules can encounter each other - can only proceed in one direction - typically need to be catalyzed to occur at biologically relevant rates - are incapable of occurring in aqueous environments

A malignant tumor has spread into neighboring tissues, while a benign tumor has not spread to neighboring tissues. The cells in a benign tumor have acquired fewer relevant mutations than the cells in a malignant tumor.

Identify the differences between a benign tumor and a malignant tumor. Choose all that apply. - A benign tumor is more likely to metastasize than a malignant tumor. - A malignant tumor has spread into neighboring tissues, while a benign tumor has not spread to neighboring tissues. - The cells in a benign tumor have acquired fewer relevant mutations than the cells in a malignant tumor. - A benign tumor is considered cancerous, while a malignant tumor is not considered cancerous.

In irreversible enzyme inhibition, if the concentration of inhibitor molecules is greater than the concentration of enzyme, the effects of the inhibitor can be overcome by increasing the concentration of natural substrate

Identify the incorrect statement about enzyme inhibition. - A competitive enzyme inhibitor will raise the Km of the enzyme but not the Vmax. - A non-competitive enzyme inhibitor does not have to physically resemble the enzyme's natural substrate. - In irreversible enzyme inhibition, if the concentration of inhibitor molecules is greater than the concentration of enzyme, the effects of the inhibitor can be overcome by increasing the concentration of natural substrate. - A non-competitive enzyme inhibitor binds to the enzyme's allosteric site, preventing the substrate from being converted to product. - None of the above; all of these statements about enzyme inhibition are correct.

The dystrophin protein is the largest protein in the human proteome.

Identify the incorrect statement about the DMD gene and/or dystrophin protein. - The dystrophin protein is the largest protein in the human proteome. - Dystrophin makes contact with cytoplasmic actin but not actin filaments in sarcomeres. - The DMD gene is the largest gene in the human genome. - The dystrophin protein is involved in maintenance of the structural integrity of muscle cell membranes.

Telomerase RISC Ribosomes

Identify the molecule(s) below which contain ncRNA as part of their structure. Choose all that apply, and note that the question is asking about the molecule, not what it may be working on. - Telomerase - RISC - RNA polymerase I - Ribosomes

The lacO regulatory sequence Allolactose The protein product of the lacI gene

Identify the molecule(s) or sequence(s) below that directly participate in establishing or relieving negative regulation of the lactose operon in E. coli. Choose all that apply. - The lacO regulatory sequence - Allolactose - Glucose -The protein product of the lacI gene

nonhomologous end joining; homology-directed repair

If the goal of a CRISPR-Cas gene editing system was to knock out an active gene, it would most likely take advantage of the host cell's -------- system. If the goal was to replace a section of host DNA with new DNA, it would most likely take advantage of the host cell's ------ system.

decreasing; increasing; increasing

If the membrane from the previous question was in danger of becoming too stable because the temperature was decreasing rapidly, the membrane could be made more fluid by -------- the average fatty acid tail length, -------- the amount of unsaturated fatty acids, and -------- the amount of cholesterol.

A mutation in the lacO region preventing repressor from binding

In Jacob and Monod's classic experiment studying lac operon regulation in E. coli, their constitutive phenotype was caused by a mutation in the lacI gene leading to a non-functional repressor. What other mutation would have led to the same constitutive phenotype? - A mutation in the lac operon core promoter preventing RNA polymerase from binding - A mutation in the lacO region preventing repressor from binding - A mutation in the lacZ region of the lac operon leading to non-functional \betaβ-galactosidase - A different mutation in the lacI gene leading to a repressor that can bind to the operator but cannot be lifted by inducer molecules - All of the above mutations would lead to the same constitutive phenotype for the lac operon observed by Jacob and Monod.

The contractile ring is composed of actin, and the cells were not stained for actin.

In the fluorescence images from the previous question, DNA is stained in blue (the thicker, puffy structures) and microtubules are stained in green (the thinner, spindly structures). Why is the contractile ring not visible in any of the panels of this image? - None of the panels represent the point in the cell cycle where the contractile ring would be present. - These images are taken at such a high resolution that the contractile ring is out of the field of view. - The contractile ring is composed of actin, and the cells were not stained for actin. - There are so many microtubules in these cells that the contractile ring is simply hidden.

ubiquitin; proteasome

Individual proteins that are damaged or are no longer needed are tagged with -------- groups and targeted to a -------.

glycosidic; glucose and galactose

Individuals who are lactose intolerant are deficient in the enzyme lactase, which breaks the __________ bond in lactose, releasing ____________________. - glycosidic; glucose and galactose - ester; glycerol and phosphates - peptide; galactose and fructose - glycosidic; fructose and glucose - peptide; glycine and lysine

Nuclear localization signal

It is necessary for what signal to be present on a molecule of HIV integrase? - Nuclear localization signal - ER signal peptide - Extracellular matrix binding domain - Mitochondrial targeting signal - HIV integrase does not require any of these signals.

(6) and (8)

Lanes 6, 7, and 8 in the previous question show the DNA profiles of three possible parents of the individual whose DNA is profiled in Lane 4. The parents provided the profiles in lanes

They are stored within vacuoles away from microtubules.

Like docetaxel, vincristine and vinblastine interfere with microtubule function and are produced by a plant—the Madagascar periwinkle, Catharanthus roseus. What is the most likely explanation why the plants which produce these compounds are not negatively affected by them? - Plants do not use microtubules. - These plants express a modified version of actin unaffected by these molecules. - Plants reach a stage at which they no longer need to grow and have their cells divide. Only then do the plants produce these compounds. - They are stored within vacuoles away from microtubules.

Structural molecule in plants

Match the glucose polymer on the left with the appropriate description on the right. Use each item only Cellulose

Energy storage in plants

Match the glucose polymer on the left with the appropriate description on the right. Use each item only Starch

Structural molecule in animals

Match the glucose polymer on the left with the appropriate description on the right. Use each item only Chitin

Energy storage in animals

Match the glucose polymer on the left with the appropriate description on the right. Use each item only Glycogen

Autocrine signaling

Match the labeled example of cell signaling in the figure to the appropriate description. - Contact-dependent signaling - Paracrine signaling - Autocrine signaling - Endocrine signaling

Contact-dependent signaling

Match the labeled example of cell signaling in the figure to the appropriate description. - Contact-dependent signaling - Paracrine signaling - Autocrine signaling - Endocrine signaling

Endocrine signaling

Match the labeled example of cell signaling in the figure to the appropriate description. - Contact-dependent signaling - Paracrine signaling - Autocrine signaling - Endocrine signaling

Paracrine signaling

Match the labeled example of cell signaling in the figure to the appropriate description. - Contact-dependent signaling - Paracrine signaling - Autocrine signaling - Endocrine signaling

presence of lactose and absence of glucose

Maximal expression of the lac operon will only occur in the _______________. - absence of both lactose and glucose - presence of both glucose and lactose - presence of glucose and absence of lactose - presence of lactose and absence of glucose

tumor suppressor; TP53

More than 50% of all human cancers involve a mutation in the ------- -------- gene named ----.

Epidermal growth factor receptor (EGFR) Insulin (a secreted protein)

Mutations to SRP72 (the RNA component of the signal recognition particle) are known to cause some forms of familial bone marrow failure. Which of the following protein(s) is/are potentially affected by such deleterious mutations? Choose all that apply. - Cytochrome c - Epidermal growth factor receptor (EGFR) - uS7 (a small ribosomal subunit protein from all domains of life) - Insulin (a secreted protein)

no ATP will be produced through oxidative phosphorylation

Oligomycin A is a research antibiotic (as opposed to a therapeutic antibiotic) which inhibits ATP synthase by blocking its proton channel. If a mammal is exposed to a high dose of oligomycin A, _______________. Choose all that apply. - no ATP will be produced through oxidative phosphorylation - NADH cannot be oxidized at the electron transport chain - the electrochemical gradient will be lost - feedback inhibition of glycolysis will be accelerated - no ATP will be produced through substrate level phosphorylation

5' - AGUCUGACAUUGCAAUCGUGACCU - 3'

One strand of a section of DNA reads: 5' - AGGTCACGATTGCAATGTCAGACT - 3' What would be the 5' to 3' sequence of the mRNA transcribed from this DNA if the strand shown was used as a template?

Microtubules

Organization and movement of chromosomes in mitosis

mRNA vaccine

Pfizer/BioNTech and Moderna COVID-19 vaccines

1 and 2 incorrect

Polypeptide X has a primary sequence of 100 amino acids, including three cysteines. Polypeptide Y has a primary sequence of 75 amino acids with no cysteines. Consider the following statements about these polypeptides. 1. Since Polypeptide Y has no cysteines, the two polypeptides cannot associate as subunits and therefore no quaternary structure is possible. 2. The maximum number of disulfide bonds possible in the tertiary structure of Polypeptide X is three. Identify if each of these statements is correct.

blocker; decoy

RNA molecule (A) is produced and processed by a cell, and functions to inhibit translation of Protein X. When the cell determines that additional molecules of Protein X need to be produced, RNA molecule (B) is produced which is complementary to RNA molecule (A). In this scenario, RNA (A) is functioning as -------,and RNA (B) is functioning as --------.

MCB 150: Quests

Ensembles d'études connexes

Basic Linux Commands Quiz

Hesi quiz 6

Codes, Standards and Practices 2, lvl 2 - Class Questions

Abeka English Literature Appendix quiz Y

Ch. 21-22

Plant Science (Ch. 1,3,4,5&6)

AI Interview Questions

Quiz No. 5

Pediatrics Test 1

OTITIS MEDIA 2

Microeconomics

Chem Day 3

intro to business chapter 14

MIS 320 Final 3rd 20

History Exemption Test UGA

BF Ch. 9

Words do not pay Vocabulary

Praxis 5038

Anatomy unit test

DLC3-Writing Argumentative Papers