Microbiology

The high heat of the denaturation step breaks the hydrogen bonds between the two strands.

How do the strands separate during PCR?

The prophage in specialized transduction carries with it pieces of the host chromosomal DNA.

How does specialized transduction differ from regular lysogeny?

The organism lives in an environment rich in organic material, particularly amino acids and proteins.

Functional analysis of the genome of a prokaryote shows that 20% of the genome is for metabolism, 1 % for biosynthesis of amino acids, 8% for peptide ABC transporters, and 2% for replication. What can you determine about the environment in which this organism lives?

In horizontal gene transfer, genes are transferred from one mature adult organism to another. In vertical gene transfer, genes are transferred from adults to offspring.

Horizontal gene transfer refers to the transfer of genes from one organism to another, as occurs during conjugation between bacteria. How does this differ from vertical gene transfer?

They provide a 3' end for the DNA polymerase.

What is the function of the primers in PCR?

To package and protect the viral genome

What is the function of the structural elements of a virus?

Allolactose

What is the inducer molecule in the lac operon?

To ensure that the cell has a supply of tryptophan at all times

What is the overall function of the trp operon?

94 °C, 60 °C, 72 °C

What is the sequence of the temperatures of a typical PCR reaction?

72 °C

What is the temperature used for the extension step?

Transduction transfers DNA from the chromosome of one cell to another.

What is unique about transduction compared to normal bacteriophage infection?

to determine the extent to which a gene is being transcribed in a particular tissue

What might be a reason that a researcher would decide to use Northern blotting instead of Southern blotting?

Deoxyribonucleoside triphosphates

What provides the energy for DNA polymerization in a PCR reaction?

ss-DNA ds-RNA ds-DNA

What structure can the viral genome take?

The virus would not be able to infect new hosts.

What would be the fate of a lytic bacteriophage if the host cell died prior to the assembly stage?

When an electrophoresis gel is run, small differences in the environment (e.g., the gel composition and current) can influence how far the fragments travel. Having a standard sample allows one to compare the test fragments with fragments of known size that have been run under the same conditions.

When a DNA gel is run, a standard sample with fragments of known size is often run in one well. Why is it important to use a standard sample?

hybridization

When a known single-stranded DNA probe is mixed with unknown nucleic acid sequences to look for similarity, it is called

the DNA from the previous host can recombine with the new host chromosome.

When a transducing phage interacts with a new host cell,

RNA polymerase can transcribe mRNA.

When the cell is NOT in the presence of tryptophan

the repressor proteins bind to the operator.

When the cell is not in the presence of lactose

isolate DNA of interest; fragment the DNA; insert DNA into vector; insert vector into host; host replication of recombinant vector

Which choice below lists the steps necessary for genetic cloning in the correct order?

budding or lysis of host cell

Which of the following are viable methods of release of newly assembled viral particles?

It can replace the base thymine, and can base pair with guanine rather than adenine.

Which of the following describes how 5-bromouracil might create a mutation?

When glucose is present, the lac operon is inhibited.

Which of the following examples describes a type of catabolite repression?

The structural genes

Which of the following genetic elements is transcribed into a single mRNA?

RNA viruses

Which of the following groups contains some representatives with genomes that are so small that they may have as few as two genes?

Viruses are obligate parasites and no living organisms are obligate parasites.

Which of the following is NOT a way in which viruses are different from living organisms?

proteins

Which of the following is NOT included in the genome?

Sequencing a gene, diagnosing a disease, and providing enough DNA for cloning into another organism

Which of the following is an application that uses PCR?

DNA strands that differ in a few bases may still be able to hybridize

Which of the following is true about hybridization?

Viruses are very specific in which cells they infect. For a virus to be taken up by a cell, it must find a cell with appropriate receptors on the surface; it cannot be taken up by cells without the appropriate receptors.

Which of the following is true about viral infection?

Benzopyrene

Which of the following might result in a frameshift mutation?

The deletion of two nucleotides in a codon

Which of the following would result in a frameshift mutation?

a yeast cell

Which of these organisms is likely to have the largest genome?

Repressible operons

Which operons are always transcribed unless deactivated?

Inducible operons

Which operons are never transcribed unless activated?

The organism wants transcription to occur only when the substrate (the activator protein) of the gene product is present.

Which statement best explains why positively controlled genes have weak promoters and need an activator protein to help the RNA polymerase bind?

Plant and bacterial cells contain cell walls that limit the virus from budding out and obtaining the envelope.

Why does the structure of plant and bacterial cells illustrate the reason for having few enveloped viruses that infect these cells?

It can withstand the high temperatures associated with PCR.

Why is DNA polymerase from Thermus aquaticus ideal for PCR?

Taq polymerase is produced by an extremophile prokaryote and is able to work at relatively high temperatures.

Why is a special polymerase, such as Taq polymerase, required for PCR?

Tryptophan binds to and activates the repressor proteins; the repressor proteins, in turn, bind to the operator, preventing transcription.

Why is the tryptophan operon turned off in the presence of tryptophan?

The operator region

With which genetic region does the repressor protein interact?

The protein will be truncated so much that it is unlikely to function normally.

A single base substitution happens to cause a nonsense mutation early in the gene for a protein. What will be the result?

contains fragments of the host chromosome instead of the viral genome.

A transducing phage

a mutation

A change in the nucleotide sequence of DNA that is passed on to daughter cells is referred to as __________.

a chemical-modifying mutagen

A chemical that removes the amine groups from certain nucleotides would be classified as

ssRNA

A retrovirus has a genome that consists of

an auxotroph

An organism that cannot synthesize methionine is an example of

genome, transcriptome, proteome, metabolome

Arrange the following genetic components in the correct order.

Each base is identified with a different fluorescent color.

Automated sequencing techniques require only one lane on an electrophoresis gel rather than four. What is one method that makes this possible?

both elements contain nonessential genes

Chromosomal islands are similar to plasmids b/c

Eukaryotes have more introns in their chromosomes.

Determine why some prokaryotes have less DNA but more genes than eukaryotes.

5' to 3'

In which direction does DNA polymerase synthesize the new DNA strand?

Assembly

In which stage does formation of mature viruses occur?

Penetration

In which stage is the viral DNA introduced into the cell?

These bacteria may be able to adapt rapidly to a new environment (e.g., an environment with an antibiotic).

Some bacteria have unusually high mutation rates. Is there an adaptive reason why they might have such high mutation rates?

It binds to the operator when activated.

how do the repressor proteins block the transcription of the structural genes?

Mutagens

increase the likelihood of mutations in DNA.

The operator

where on the DNA strand does a repressor bind?

DNA moves toward a positive charge due to the negative charge on its phosphate groups. The charge is consistent because all DNA nucleotides have a single phosphate group rather than having more diverse patterns of charges. Because the charge is relatively consistent, size is the most important factor determining how far fragments move.

Electrophoresis can be used to separate molecules by size, shape, and charge. When DNA samples are run in an electrophoresis gel, the different bands produced generally represent fragments of different sizes. Why is the size of the fragment the most critical factor in determining how far it migrates on a gel when DNA fragments are compared?

When a frameshift mutation occurs, it causes changes in many bases downstream and can affect many of the amino acids in the protein.

Frameshift mutations can be very severe. What is one reason why they are often so serious?

detect the presence of a genetic element detect if DNA was inserted in a vector detect the absence of a genetic element.

Reporter genes can be used to

nonionizing radiation.

Thymine dimers result from

capsid and genome

What component(s) make up the structure of a virion?

It is always transcribed.

When is the repressor protein transcribed?

can alter nitrogenous bases of DNA, resulting in incorrect base pairing.

A nucleotide-altering chemical

To quickly increase the number of copies of a specific DNA sequence

What is the end goal of PCR?

In a persistent infection, the host cell is continually releasing new viral particles slowly. In a latent infection, there are periods of time where the virus is not replicating and creating new viral particles.

Differentiate between persistent and latent animal virus infections.

They require a host in order to reproduce.

How are viruses different from cells?

DNA-binding proteins can catalyze transcription. DNA-binding proteins can block transcription. DNA binding proteins can activate transcription.

How can DNA binding proteins (DBP) regulate transcription?

The prophage takes an antibiotic resistance gene with it and is packaged with the newly synthesized viral DNA.

How can specialized transduction contribute to the transfer of antibiotic resistance genes in a bacterial population?

Generalized transduction is initiated during lytic cycle of a virulent bacteriophage; specialized transduction is initiated during the lysogenic cycle of a temperate bacteriophage.

How is generalized transduction different from specialized transduction?

The entire viral particle can penetrate an animal cell, while only the viral genome can penetrate a bacterial cell.

How is penetration different in animal viruses as compared to bacterial viruses?

two

If a restriction enzyme that recognizes GGCAT and cuts between the two guanine residues is mixed with DNA that has the sequence CCGATTATAATCCCGCGGCATATTAGGGCGG, how many pieces would the resulting product be?

Northern blotting

If an electrophoresis gel is run with RNA and then a DNA probe is used to identify the fragments of interest, what is the process called?

ligase

In DNA cloning, fragments of DNA need to be joined together (e.g., to add a fragment into a vector). What common enzyme is used for this process?

They differ in their genotype and in their phenotype.

In a culture of bacteria, there are some individuals that are unable to synthesize histidine. What is the best and most likely description of how these individuals differ from the other bacteria in the culture?

transformation

Increasing genetic variability by the uptake of DNA from the environment is

When replication occurs, complementary base pairing may fail because the base analog may not be treated in the same way as the base that it replaced.

One group of chemical mutagens includes the base analogs. How do these lead to mutations?

transcriptional regulation (regulation of whether transcription occurs)

One reason that regulation of gene expression is important is that it saves energy and materials from being used when they are not needed. Although most genes have more than one form of regulation acting upon them, at which point would regulation be most efficient in conserving energy and materials if the product of a gene is not needed?

polymerase chain reaction.

PCR stands for

they are easily inserted into cells by transformation they can replicate independently of the chromosome they can contain genes for antibiotic resistance used for plasmid selection

Plasmids are commonly used as cloning vectors because __________.

The host DNA integrates, with the prophage, into the new recipient chromosome.

What happens to the packaged DNA of a specialized transduced phage when it infects a new recipient cell?

Because they cut only at specific sequences in DNA, they are useful in cutting harmful DNA (such as viral DNA) without harming the organism that produces them (which can protect those sequences in its own DNA).

Restriction endonucleases are found in nature. They are extremely useful for genetic engineering. Why do organisms produce them?

a virus that contains RNA with the same nucleotide sequence as the functional mRNA that its host cell will translate to produce viral products

Some viruses have plus sense RNA genomes. Which of the following could describe one of those viruses?

Enveloped viruses are often coated with animal cell membrane as they leave the cell. This membrane is a major component of the viral envelope. The viral proteins are more readily recognized by the immune system, as they are more distinct from the materials normally found in and on the cells. However, the envelope can contain several types of viral components as well.

Some viruses, especially animal viruses, have an envelope surrounding their nucleocapsid. This envelope may have viral proteins embedded in it. Why are the viral proteins more readily recognized and targeted by the immune system than the envelope?

It is important to compare the rate of mutations with the chemical to the normal background mutation rate. Mutations occur spontaneously even without the presence of a mutagen.

The Ames test is commonly used to test whether a particular chemical is mutagenic. When you conduct an Ames test, you need two groups of plates. One group of plates contains bacteria that are exposed to the chemical of interest, while the other plates contain bacteria that are not exposed to the chemical. Why is the latter group needed if you are just interested in the rate of mutation caused by the chemical?

near the beginning of the coding region of a protein

The addition of two bases to the genome of a prokaryote would be most damaging if located

the chemical tested is a mutagen

The appearance of an abundance of colonies close to the test disk after an Ames test would suggest

easy to grow and transform with engineered DNA

The cells used as hosts for cloning vectors are

comparative genomics

The field of study that can reveal how genes function, reveal how organisms interact with the environment, and show evolutionary relationships is

AUU, AUC, and AUA all code for Ile

The genetic code has many important characteristics. For example, a specific codon always means the same thing in a particular species. Codons mean the same thing in most species (even though there are some exceptions). In some cases, a particular amino acid can be specified by more than one codon (the genetic code is degenerate). Which of the following answers describes an example of the degenerate nature of the code?

The machine that controls the heat of the reaction, cycling between the different temperatures of the different steps during PCR

What is a thermocycler?

To code for enzymes involved in catabolizing lactose.

What is the basic function of the lac operon?

genes, function, and evolutionary history

The genome sequence of an organism can provide information about the organism's

Biosynthesis

The host DNA is usually degraded during which stage?

Because the major groove is wider, it is more accessible to binding proteins.

The major site of protein binding in DNA is the major groove. Why is this a good site for binding?

It requires very pure and high-quality DNA samples.

The polymerase chain reaction, PCR, has revolutionized molecular genetics. Despite all of the advantages of PCR, it does have limitations. Which of the following is NOT a limitation of PCR?

induction and catabolite repression

The synthesis of β-galactosidase is regulated by

missense mutation

There are several different types of mutations possible in the base sequence of DNA. If a GGC (glycine) codon were changed to UGC (cysteine), it would be termed a

a start codon and a ribosomal binding site (RBS)

To determine if you have identified a functional open reading frame (ORF), you should have found __________ within the sequence.

The promoter

To what genetic element does the RNA polymerase bind?

middle and late proteins

Viral structural proteins and proteins involved in the release of new viral particles that are synthesized after genomic replication begins would be considered

RNA replicases (RNA-dependent RNA polymerases) for RNA viruses

Viruses rely on the host cell machinery to make new viruses, but they sometimes provide their own enzymes (such as reverse transcriptase, which is an RNA-dependent DNA polymerase). Which of the following types of enzymes would a virus need to provide in order to replicate within a cell? In other words, which of these enzymes would not normally be found in a cell unless a virus provided it?