Mol Gen 4500 Module 3 Test
What are three key differences between a genomic and a cDNA library?
-cDNA library is not a complete collection of genes, it does not contain introns. Genomic library is a complete collection of genes. -Genomic library is collected from fragments of genomic DNA whereas cDNA library is collected from fragments of mRNA -cDNA has to use reverse transcriptase to make DNA in order to be cloned into the vector, in genomic libraries they can use the initial fragments of DNA and don't need reverse transcriptase
A typical prokaryotic genome has 1 million base pairs of DNA, containing a few hundred genes. 1000 base pairs of DNA, containing a few thousand genes. 1 million base pairs of DNA, containing 1000 genes. 1000 base pairs of DNA, containing a few hundred genes.
1 million base pairs of DNA, containing 1000 genes.
List the three basic components required for a bacterial cloning vector and briefly describe the purpose of each.
1) Origin or replication - ensures that the vector is replicated within the cell 2) Selectable markers - enable any cells containing the vector to be selected or identified 3) One or more unique restriction sites - sites where DNA fragments can be inserted
Discuss two problems revealed by transgenic crops resistant to glyphosate
1) They are resistant to herbicides such as Roundup as glyphosate is a common ingredient in them, causing glyphosate resistant weeds. 2) No long-term studies have been conducted on the long-term effects of GMO foods on people and the environment
Most of the bacterial genomes described in the text have fewer than 50 genes 500 genes 5,000 base pairs 10,000 genes 10,000 base pairs
10,000 genes
Assume that a given plasmid vector to be used in a cloning experiment contains 4000 base pairs of DNA. Assume also that the restriction endonuclease Cuj cuts this plasmid at the following sites (starting from an arbitrary zero point): 1000, 1500, and 3000. Given complete digestion of the plasmid with the endonuclease so that only linear fragments are produced, what sizes of DNA are expected? Enter the fragment sizes in base pairs from smallest to largest, separated by commas.
500 bp, 1500 bp, 2000 bp
Explain how to carry out chromatin immunoprecipitation (CHiP).
A crosslinking reagent is added to the cell expressing the transcription factors, causing the transcription factors to covalently bind to their regulatory DNA sequence. The chromatin with associated proteins are then isolated by using an antibody that is with large insoluble beads, they are then spun out of solution with the attached protein and target sequence. The chromatin immunoprecipitants are then stripped of the protein and the targeted DNA is sequenced. Sequenced regions are used to map chromosomal positions.
What is comparative genomics? How does its study contribute to our understanding of genetics?
Aligning genome sequences from different organisms to determine their evolutionary history. Shows how our genomes change and how DNA works.
Clones can be of a cell, an organism, or a molecule. What characteristic do they all have in common? All contain mutations All are alternate forms of the ancestor All are derived from a single ancestor All require plasmid cloning techniques
All are derived from a single ancestor
What do PCR, reverse transcription, and dideoxy DNA sequencing all have in common? All produce DNA chains as a product. All produce RNA as a product. All produce lipid as a product. All produce RNA as a product.
All produce DNA chains as a product.
Under ideal conditions, how many copies of all the sequences of the host genome should be represented in a genomic library? Why?
At least one should be represented. Typically, library construction includes a several-fold greater number of clones than necessary for one representative of each fragment in order to increase the likelihood of cloning difficult fragments and stochastic loss.
What are BACs and YACs? What are the main differences between them?
BACs- Bacterial Artificial Chromosomes can contain inserts up to 300kb YACs- Yeast Artificial Chromosomes can contain inserts from 100kb-1Mb
Software application used to compare a segment of genomic DNA to sequences throughout major databases
BLAST
Many eukaryotic proteins can't be made in bacteria. Give two reasons why this may be.
Bacteria dont contain introns so they do not have the correct mechanisms for splicing. Proteins will fold differently in Bacteria then they will in eukaryotes
Which of the following are the important proteins needed for cloning a eukaryotic gene into a bacterial plasmid? DNA ligase DNA polymerase Both B and C restriction enzymes specific for the target genes
Both B and C
Your commensal microbiota can help keep you healthy because:
Commensal microbiota occupy niches in the skin that otherwise might be available to pathogenic bacteria?
Aligning genome sequences from different organisms to determine their evolutionary history is referred to as ________. s Metagenomics Comparative genomics Paleogenomics Nutrigenomics
Comparative genomics
Genomes from several primates have been sequenced and annotated. These primates range from chimpanzee to Rhesus monkey to Neanderthal and modern humans. What is the advantage of having so many primate sequences available to researchers? Comparative genomics allows for determining evolutionary trends. Phenotypes can be determined from the genomes. The primate sequences can be compared to learn about social behavior. The primate sequences can be compared to learn about dietary trends.
Comparative genomics allows for determining evolutionary relationships.
A transgenic organism is one in which ________. a naturally occurring plasmid has been transferred through natural means DNA from a mammal is introduced to produce a more resilient bacterium DNA from a different organism is introduced to produce a biopharmaceutical its genes have transferred to new chromosomes
DNA from a different organism is introduced to produce a biopharmaceutical
It is common to use ddNTPs (dideoxyribonucleoside triphosphates) in which of the following biochemical reactions? electron transport DNA sequencing plasmolysis citric acid cycle restriction digestion
DNA sequencing
A human gene with a disease phenotype is going to be mapped by positional cloning. Which would be the most useful for this task? Whole-genome-shotgun clones of the human genome Data about the inheritance of SNP markers in families with the disease Microarray data of tissues in which the gene is expressed An EST database of the human genome Information about bacterial orthologs of the gene
Data about the inheritance of SNP markers in families with the disease
How are pseudogenes formed?
Duplication errors or through retrotransposition
What is ELISA? How would you use ELISA to screen through hybridomas to find your desired monoclonal antibody?
ELISA stands for Enzyme-Linked Immunoadsorbent Assay. This is an immunological assay used in the measurement of antibodies. The antibody or antigen, once synthesized, is adsorbed to the plate while a primary antibody conjugated with an immunofluorescent molecule is introduced. The primary antibody then binds to the antigen-antibody complex and the plate is washed. The now isolated antigen is then put into an animal where it stimulates the plasma b cells to produce the antibody, then blood is taken from the animal to produce the anti-serum
Restriction endonucleases are typically used to clone genes. What factors determine the sites at which these endonucleases will cleave DNA? What characteristics do these sites tend to have?
Each RE will cleave at a specific sequence. These sequences tend to be short and palindromic
The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the discovery of a bacterium called Thermus aquaticus in a hot spring inside Yellowstone National Park, Wyoming. This organism contains a heat-stable form of DNA polymerase known as Taq polymerase, which continues to function even after it has been heated to 95 degrees C. Why would such a heat-stable polymerase be beneficial in PCR? Each cycle includes a "hot" saturation phase (95oC), which allows the primers to anneal to the target DNA. More than one of these answers is correct. Each cycle includes a "hot" denaturation phase (95oC), which serves to sterilize the culture. Each cycle includes a "hot" denaturation phase (95oC), which activates the Taq polymerase. Each cycle includes a "hot" denaturation phase (95oC), which separates the hydrogen bonds that hold the strands of the template DNA together.
Each cycle includes a "hot" denaturation phase (95oC), which separates the hydrogen bonds that hold the strands of the template DNA together.
Archaebacteria are structurally like________ but metabolically like________
Eubacteria, eukarytoes
Describe one major difference in the organization or content of prokaryotic and eukaryotic genomes.
Eukaryotic genomes have longer genes, more introns, longer introns, and stored in the nucleus. A prokaryotic genome consists of a single DNA molecule and no membrane-bound organelles and a eukaryotic genome consists of multiple DNA molecules with membrane-bound organelles. Gene density is high in prokaryotes whereas gene density is low in eukaryotes
There are different challenges that exist for sequencing prokaryotic and eukaryotic genomes. Which challenge is correctly paired with the type of genome to which it relates? Prokaryotic: presence of plasmids Eukaryotic: circular DNA Prokaryotic: repetitive DNA Eukaryotic: repetitive DNA Eukaryotic: ESTs
Eukaryotic: repetitive DNA
Where do GMO crops come from? How are they created?
GMO crops are genetically engineered by humans.
This is the study of "genes in their entirety."
Genomics
All the microbes in and on your body.
Human Microbiota
In the polymerase chain reaction, what is the purpose of the initial high temperature? What is the purpose of cooling in the second step?
In PCR, the initial high temperature serves to denature the double stranded DNA into single stranded DNA. Cooling in the second step allows for the annealing or hybridization of the primer to the DNA strand, flanking either side of the target DNA.
Discuss an experiment that showed the microbiome can have an effect on health or immunity.
In one experiment using the microbiome gut bacteria were taken from obese mice and put into skinny mice, this caused the skinny mice to become obese. In another experiment they used three sets of baby mice. One set grew up in a germ free environment and developed a weak immune system. Another set grew up in a natural germ environment and developed a strong immune system. The last set was grown in a germ free environment where staphylococcus epidermidis was introduced and they grew to have strong immune systems.
How is the bacterial Cre recombinase used in mouse genetics?
In tissues where Cre recombinase is expressed genes that are flanked by lox P will be inactivated, also known as a conditional gene knock out.
All of the following are characteristics of the genomics revolution EXCEPT_____________ Inability to understand single genes Ability to conduct discovery-based research Enabled reverse genetics approach to genetics research Facilitated collaborative research networks Large scale acquisition of DNA sequences
Inability to understand single genes
What is Metagenomics? How is it carried out
Insert of DNA in polylinker inactivates lacZ component and allows identification of recomb plasmids under proper genetic and environmental conditions
A new gene is discovered during the sequencing of a bacterial genome. After a BLAST analysis, the new gene aligns with a known sequence from the same bacterium. The sequence identity is 95%. Which of the following statements best describes the relationship of the newly discovered gene and the known gene? It is an ortholog to the known gene and is a result of an older gene duplication. It is an ortholog to the known gene and is a result of a recent gene duplication. It is a paralog to the known gene and is a result of a recent gene duplication. It is a paralog to the known gene and is a result of an older gene duplication
It is a paralog to the known gene and is a result of a recent gene duplication.
This term refers to the work undertaken by large teams of researchers who, through a concerted effort, clone and sequence the DNA of Man.
Its an organism produced by the insertion of recombinant DNA into the genome of the organism.
What is meant by the term low gene density? Give an example of an organism with low gene density.
Low gene density is common in eukaryotes in which there may be as few as one gene in 64 kb base pairs, as is the case with a segment of human chromosome 22
What are Northern analyses used for? Describe the steps involved in performing a Northern analysis, and describe how levels of gene expression are determined.
Northern analyses are used for screening mRNA to determine expression characteristics of a gene. mRNA is extracted, isolated and then separated by electrophoresis. After electrophoresis, the sample is transferred to a nylon membrane and transferred via capillary action. Levels of gene expression can be determined using microarrays. Screens mRNA to determine expression characteristics of a gene. mRNA is extracted, isolated and then separated by electrophoresis. After electrophoresis, the sample is transferred to a nylon membrane and transferred via capillary action. Levels of gene expression can be determined using microarrays.
Eukaryotes have multiple genomes, since they can have genomes in the________ ,________ and ________ .
Nucleus, chloroplasts, mitochondria
A ddNTP, used often in DNA sequencing, lacks a(n) ________ at the ________ and ________ carbons. OH, 2', 3' methyl, 2', 3' None of these are correct. OH, 2', 5' carboxyl, 5', 3'
OH, 2', 3'
In what way are specific DNA sequences of the template amplified in the polymerase chain reaction? In other words, how does one target the target?
Oligonucleotide primers hydrogen bond to specific sections, primers are extended
A series of genes under a common promoter.
Operon
With the rise of drug-resistant bacteria in hospitals there has been an effort to develop new antibiotics as well as novel methods to combat resistant infections. The sequencing of entire communities of organisms including environmental samples has led to the discovery of millions of uncharacterized bacteria that could provide new drugs. This sequencing method is called shotgun genomics Paleogenomics Metagenomics Biome genomics
Paleogenomics
Words such as did, mom, and pop have something in common with the fundamental tool of recombinant DNA technology. In the context of recombinant DNA technology, which term would be used to describe such words? insertion prototrophic palindromic lysogenic conjugation
Palindromic
What is meant by the term pseudogene?
Pseudogenes are nonfunctional versions of genes that resemble other gene sequences but that contain significant nucleotide substitutions, deletions, and duplications that prevent their expression. Pseudogenes are designated by the prefix (psi).
Assume that you have cut λ DNA with the restriction enzyme HindIII. You separate the fragments on an agarose gel and stain the DNA with ethidium bromide. You notice that the intensity of the stain is less in the bands that have migrated closer to the "+" pole. Give an explanation for this finding.
Since the smaller fragments migrate toward the "+" pole, away from the origin, they bind less stain than the larger fragments near the origin.
What is Taq polymerase? Why is it so important in PCR?
Taq polymerase is a DNA polymerase that produces new DNA strands using existing strands as templates. It is important in PCR because high temperatures are used in PCR to denature the template DNA but Taq polymerase is able to sustain those high temperatures and continue synthesizing DNA without being denatured.
How does the Taqman approach allow researchers to carry out qPCR?
Taqman is a DNA probe with a fluorescent reagent on one end and a quencher on the other, the probe is made up of DNA complementary to the DNA of interest, therefore it will anneal to the DNA targeted for amplification. When Taq polymerase comes along and replicates the strand, it will cleave the fluorescent reagent, once dissociated from the quencher the fluorescent agent will fluoresce, a computer will then scan the molecule for the amount of fluorescence as a quantitative way of determining the amount of nucleic acid.
What is the BT toxin? How and why is it used in agriculture?
The BT toxin is an insecticidal gamma endotoxin that destroys the digestive system of insects that consume plants that contain it. It is used in agriculture to produce insect resistant plants so they need less insecticide treatment as non-transgenic plants. However, there are now some BT resistant insect pests.
What is meant by the designation EcoRI? Do not simply state the type of macromolecule designated by EcoRI, but explain why it is so named.
The Eco part of the enzyme's name originates from the species from which it was isolated, while the R represents the particular strain, in this case RY13. The last part of its name, the I, denotes that it was the first enzyme isolated from this strain. EcoRI is a restriction enzyme that cleaves DNA double helixes into fragments at specific sites.
What is the purpose of the LacZ gene in a plasmid cloning vector?
The LacZ gene is a selectable marker. Acts as a reporter gene which encodes beta-galctosidase. Expression of the lacz gene causes bacterial host cells carrying pUC18 to produce blue colonies when grown on medium containing a compound Xgal.
What is the purpose of an antibiotic resistance gene in a plasmid cloning vector?
The antibiotic resistant gene provides a selectable marker for cells.
If one wishes to clone a gene using typical restriction endonucleases, how does the restriction endonuclease identify the appropriate cut sites in the genome? The endonuclease cannot identify the cut sites. The endonuclease cuts randomly in the genome. The endonuclease recognizes the gene of interest. the endonuclease uses the Force. The endonuclease identifies its specific recognition sequence.
The endonuclease identifies its specific recognition sequence.
How do 2D gels work?
The first dimension separates the protein using isoelectric focusing, in which the protein binds to the column based on it's isoelectric point. Once isolated based on IP, the protein is then run through the second dimension which is size through SDS polyacrylamide electrophoresis. This allows us to see all the proteins in a cell simultaneously.
Explain why the genetic map distance between two genes on the same chromosome may be inconsistent with the physical map distance. E.g., for three loci A, B, and C, on the same chromosome, explain why the genetic distance might be A-[20 centimorgans]-B-[20 cM]-C, while the physical distance might be A-[200 kilobases]-B-[100 kb]-C.
The genetic map distance is measured by using the recombinant frequency. It shows the relative distance between different genes on a chromosome in the unit of centimorgan. The physical map distance is measured objectively and directly in the unit of nucleotide base.
How do you make a monoclonal antibody?
The key to making monoclonal antibodies is the production of hybridomas. Hybridomas are spleen cells fused to cancer cells, hybridoma cells lose the ability to produce HPRT but can grow on HAT medium. They are cultured on HAT medium and those that do not have the ability to produce HPRT are sampled. Each colony produces one antibody from one cell. The monoclonal antibody is then isolated using ELISA, the antibody or antigen is adsorbed to the plate while a primary antibody conjugated with an immunofluorescent molecule is introduced. The primary antibody then binds to the antigen-antibody complex and the plate is washed. The now isolated antigen is then put into an animal where it stimulates the plasma b cells to produce the antibody, then blood is taken from the animal to produce the anti-serum.
RFLPs can be used to identify point mutations through which of the following mechanisms? The mutation can be silent in the coding for protein resulting in a different amino acid being inserted. The mutation can occur outside of a restriction site causing a change in the cutting pattern for restriction enzymes. The mutation can occur causing a shortening of the mRNA that is then compared to wild type. The mutation can occur in a restriction site, causing a change in the cutting pattern for restriction enzymes.
The mutation can occur in a restriction site, causing a change in the cutting pattern for restriction enzymes.
Compare the transcriptome of an organism with the proteome. What is described by each? Which one will generally have more macromolecules, and why?
The transcriptome is the sum total of all the RNA or mRNA (depending on the experiment) of an organism. The proteome is the sum total of all the protein in an organism. Transcriptomes have more macromolecules generally because it takes 3 rna molecules to code for one amino acid so naturally they would have more.
Why are telomeres and centromeres particularly difficult to sequence?
They consist of highly repetitive DNA, and so strand slippage issues can confuse the determination of a consensus sequence
What is the function of dideoxynucleotides in Sanger DNA sequencing? They allow only the specific sequencing of the RNAs of a genome. They cut the sequenced DNA at specific sites. They act as primers for reverse transcriptase. They stop synthesis at a specific site, so the base at that site can be determined. They act as primers for DNA polymerase.
They stop synthesis at a specific site, so the base at that site can be determined.
If a restriction enzyme cuts a circular DNA into three fragments, how many restriction sites are there in the DNA? four six three two five
Three
What is the purpose of a cDNA library? To produce a library of chloroplast genes. To produce a library of all genomic DNA of an organism. To replicate the genomic DNA. To produce a library of expressed genes.
To produce a library of expressed genes.
One of the human chromosomes with the lowest gene density
Y Chromosome
To find your patrilineal ancestors you should sequence this chromosome:
Y chromosome
Is there an advantage to using a restriction enzyme that cuts only rarely? When would you want to use such an enzyme?
Yes, when sequencing the entire genome.
The following are four processes common to most cloning experiments: i) transforming bacteria ii) plating bacteria on selective medium iii) cutting DNA with restriction endonucleases iv) ligating DNA fragments Place the components of this list in the order in which they would most likely occur during a cloning experiment. ii, iii, i, iv iv, i, iii, ii ii, i, iv, iii i, ii, iii, iv iii, iv, i, ii
__2__ ligating DNA fragments __1__ cutting DNA with restriction endonucleases __4__ plating bacteria on selective medium __3__ transforming bacteria
PCR is None of the above a technique for amplifying DNA sequences in vitro one of the control elements of the cell cycle necessary for efficient replication of cell's DNA in interphase
a technique for amplifying DNA sequences in vitro
Plasmids are important in biotechnology because they are surfaces for respiratory processes in bacteria a vehicle for the insertion of foreign genes into bacteria surfaces for protein synthesis in eukaryotic recombinants recognition sites on recombinant DNA strands
a vehicle for the insertion of foreign genes into bacteria.
Probes that bind under very stringent hybridization conditions resulting in the differential binding over one nucleotide are called ________. short, variable repeats allele-specific oligonucleotides (ASOs) VNTRs generation-specific probes micrsatellites
allele-specific oligonucleotides (ASOs)
What is one cause for the 21,000 protein encoding sequences in the human genome producing between 200,000 and 1 million different proteins? restriction enzymes CRISPR-Cas systems SNPs alternative splicing CNVs
alternative splicing
Using RNA-seq generates data in situ. What does RNA-seq not provide data for? gene expression levels sequence of the genomic DNA amount of protein produced by RNA location of transcript in the genome
amount of protein produced by RNA
The genome of the domesticated dog, Canis familiaris, was sequenced in 2005. Using the dog as a model system provides insight into which of the following human disease states? multifactorial diseases aneuploidies, multifactorial diseases, and behavioral conditions aneuploidies behavioral conditions (e.g., obsessive-compulsive disorders)
aneuploidies, multifactorial diseases, and behavioral conditions
A newly sequenced gene is cloned and expressed in a bacterial cell. The bioinformatics databases suggest that this gene produces an enzyme that catalyzes the conversion of carbon dioxide to bicarbonate. After weeks of experiments, a scientist determined the enzyme has a completely different function. This is an example of incorrect ________. sequencing annotation qPCR BLAST parameters enzyme experiments
annotation
You determine that you have only three copies left of an important DNA fragment, so you decide to amplify it. Using flanking primers, how many PCR cycles would you have to run to generate over one billion (10^9) copies of the fragment?
anywhere from 28 to 30 cycles
For a physical map of a chromosome, distances are measured in units of contigs. centiMorgans. RFLPs. base pairs. percent recombination.
base pairs.
Name the two strategic methods that scientists are using to sequence genomes.
clone-by-clone method and shotgun cloning
A bacterial polycistronic transcription unit is one that is void of start (AUG) and termination (UAA, UGA, UAG) triplets. is capped at the 5'end and carries a poly-A tail at the 3'end. none of these answers contains information for one protein product. contains information for more than one protein product.
contains information for more than one protein product.
A set of overlapping DNA fragments that form a contiguous stretch of DNA is called a _________. contig sequence map chromosome clone
contig
Human chromosomes have regions of low gene density that on karyotypes appear as __________.Flow gene
dark spots (gene deserts)
Fluorescent Sanger dideoxy sequencing methods uses what method to discriminate between the 4 different nucleotides? Fluoresently labeled dATP. Centrifugation sedimentation gradient. Fluorescently labeled dNTPs Different fluorochromes attached to the four different ddNTPs.
different fluorochromes attached to the four different ddNTPs
Selective breeding has been used for centuries to ________. train crops to grow in more favorable environments remove favorable traits from plants and animals ensure purity of genetic lines enhance growth and yield from domesticated plants and animals
enhance growth and yield from domesticated plants and animals
Of the DNA sequences below, which would probably be the harder to determine? CGATATATATATATATACGAT GGCATCACGAGCTGCATTCGCA
first one because of the repetative ATAT
High throughput sequencing takes advantage of automated reading of sequencing data. Which of the following assists in automating the sequencing readout? fluorescently tagged ddNTPs fluorescently tagged dNTPs radioactive dNTPs radioactive ddNTPs
fluorescently tagged ddNTPs
Recombinant insulin was originally made as ___________ proteins.
fusion
The first recombinant protein
human insulin
How can a virus be used to transfer a gene into a cell?
lambda phage vector
Typically, bacterial DNA contains_____ (more or less?) repetitive DNA than eukaryotic DNA.
less
Another word for a "DNA chip" (microscopic spots of oligonucleotides bound to glass that can be fluorescently labelled to identify levels of expression).
microarray
Some vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. What term is given to this advantageous arrangement of restriction sites? β-galactosidase consensus sequence complementation multiple cloning site palindrome
multiple cloning site
A map of the order, overlap, and orientation of physically isolated pieces of the genome.
physical map
Proteomics is the "-omics" study of proteins, investigating the complete set of proteins in a cell. What does proteomics provide data on? amount of protein in a cell the similarity between genes coding for a protein the gene sequence for the protein posttranslational modification to proteins
posttranslational modification to proteins Structure Interaction between proteins
The use of ASOs in the process of in vitro fertilization to determine the genetic risk factors present is called ________. genome scanning RFLP analysis preimplantation genetic diagnosis next-generation sequencing
preimplantation genetic diagnosis
What is the function of a ddNTP in DNA sequencing? enhancing the processivity of the polymerase methylation of guanine provide a 3′ hydroxyl for continued elongation termination of DNA synthesis
provide a 3′ hydroxyl for continued elongation
What is the name of the process by which bacterial colonies (cells) are transferred from one agar plate to another, maintaining the same spatial pattern?
replica plating
Compared with eukaryotic chromosomes, bacterial chromosomes are small, with high gene density. large, mainly organized in monocistronic transcription units without introns. large, triple-helix, Z-DNA, organized in monocistronic units with introns. large, mainly organized in polycistronic transcription units without introns. small, mainly organized in monocistronic transcription units with introns.
small, with high gene density.
One major difference between prokaryotic and eukaryotic genes is that eukaryotic genes can contain internal sequences, called ________, which get removed in the mature message. exons introns inteins exteins splice-outs
splice-outs
DNA microarray analysis is excellent for ________. studying one gene's expression very closely studying all of a sample's genes simultaneously studying all of a sample's unexpressed genes simultaneously studying all of a sample's expressed genes simultaneously
studying all of a sample's expressed genes simultaneously
What is a concise definition of proteomics? the harvesting of proteins from a cell to determine their economic value the manipulation of amino acid sequences in proteins to alter their function changing the terminal sequences of proteins to alter their function the rational design of drugs based on protein structure the process of defining the complete set of proteins encoded by a genome
the process of defining the complete set of proteins encoded by a genome
Transcriptomics is ________. determining phenotype measuring how much DNA is in the genome determining epigenetic markers the quantification of gene expression
the quantification of gene expression
Nutrigenomics is the study of ________. the vitamins and minerals in the genome the effect of genomics on dietary desires the relationship between diet and the genome the effect of the genome on bodily mocroflora
the relationship between diet and the genome
When two proteins show a 50 to 70 percent match in amino acid sequence, it is likely that the two proteins have identical tertiary structures. the two proteins share a common ancestry. the primary structures may differ, but the secondary structures are identical. the two proteins have identical functions. the two proteins have no common origin.
the two proteins share a common ancestry
With the multitudes of genetic tests and bioinformatic databases available to clinicians and researchers, diagnosis via genetic information is becoming more common. Which of the following is a major concern with regard to genetic testing? Parents and clinicians will use prenatal genome sequencing in a responsible manner. There are genetic tests for diseases that currently have no treatment. Genetic discrimination is easy to define and prevent. A negative result in a genetic test means a person will never get the disease.
there are genetic tests for diseases that currently have no treatment
What is the enzymatic function of restriction enzymes? to repair breaks in sugar-phosphate backbones to join nucleotides during transcription. to cleave nucleic acids at specific sites to add new nucleotides to the growing strand of DNA
to cleave nucleic acids at specific sites
Reserchers created a Mycoplama mycoides genome in the lab and transferred it into Mycoplasma capricolum in a discipline called _________________-.
transgenic
Farm animals that produce important pharmaceuticals.
transgenic livestock
A plasmid contains a multiple cloning site inside the coding region of the lacZ gene and also contains an ampicillin resistance gene at a separate locus. When cells are transformed with a successfully recombinant plasmid containing a piece of DNA cloned into the multiple cloning site, what color will the colonies be when grown on an agar plate containing ampicillin and X-gal? blue colonies won't grow white red green
white
The human insulin gene has several introns that cannot be spliced out by bacteria. How could this gene be expressed in bacteria?
(Slide 2, PPT 3-2)
How do you carry out a chromosome walking experiment?
(i) select a clone of interest from the genomic library (identified by a probe) and subclone a small fragment from one end of the clone (ii) the subcloned fragment of the selected clone may be hybridized with other clones in the library and a second clone hybridizing with the subclone of the first clone is identified due to presence of overlapping region (iii) the end of the second clone is then subcloned and used for hybridization with other clones (iv) third clone identified as above is also subcloned and hybridized with clones in the same manner (v) restriction map of each selected clone may be prepared and compared to know the regions of overlapping
List four applications of PCR technology. Do not describe what PCR *does* (well, you can if you want, but you won't get points for it). Instead, list activities or fields in which PCR is useful.
1. forensics 2. paleobiology 3. screening for genetic disorders 4. diagnosis screening for infectious organisms
A restriction enzyme that uses a six (6) base recognition sequence will cut DNA, on average, every ________ bases, if all four nucleotides are present in equal proportions. 500 4096 256 5000 1296
4096
Which of the following best describes a cloning vector? The direction in which DNA is cloned. A DNA molecule that accepts DNA fragments and replicates the fragment in a host. A DNA molecule that accepts DNA fragments and degrades them in a host. The fragment of DNA encoding a gene of interest.
A DNA molecule that accepts DNA fragments and replicates the fragment in a host.
Which of the following best describes the term edible vaccine? Part of a recombinant organism that the vaccine can be purified from. A recombinant organism that expresses the vaccine in a consumable portion of the organism. A DNA that a human can eat and relies on the human cells to generate the vaccine. A vaccine that can be eaten by a human and alter the genome.
A recombinant organism that expresses the vaccine in a consumable portion of the organism.
Describe the three basic components of a typical plasmid cloning vector and the reason/use for those plasmid vector components.
A typical plasmid vector will have the following components: -Polylinker: First, there will be a multiple cloning site OR polylinker that is "cut" with specific restriction enzymes. The same restriction enzyme can then be used to "cut" templated DNA. When the cut vector and template are mixed together the complementary single stranded regions will anneal to one another and this complementarity is covalently linked using DNA ligase. Once in the vector, the vector is transferred into a bacterial host, where is multiplied. -Antibiotic resistance marker: The vector also contains antibiotic resistance genes so that when growing in the presence of antibiotic, only those bacteria with the vector will be able to grow. -Selectable marker: Lastly, the vector will contain a selectable marker, eg. the lacZ gene. The polylinker is located within this gene, when a template is ligated within the lacZ gene it is made nonfunctional. In the presence of a colorimetric indicator, such as X-gal, which is broken down into a blue byproduct by lacZ, the presence of a template fragment in the plasmid vector is visualized by white bacterial colonies. These colonies can then be chosen for further analysis.
ddATP, ddTTP, ddCTP, and ddGTP are labeled with red, green, yellow, and blue fluorescent dyes, respectively. A five-base read from a sequencing reaction produced the following color sequence, read by the computer: red, yellow, yellow, green, green. What is the sequence of the template DNA? TTCCA AAGGT ACCTT TGGAA
ACCTT
How are archaebacteria similar to eubacteria? How are they different?
Archaebacteria and eubacteria are similar because they are both prokaryotic, but they are different because they live in different habitats in the environment.
Uses computer-based approaches to organize, share, and analyze genomic data.
Bioinformatics
The lungfish Protopterus aethiopicus has a genome 38 times larger than that of humans. Most of the DNA in this species is noncoding repetitive DNA. How could you create a library of clones that would let you compare just the genes in the lungfish to the genes in humans?
Creating a cDNA library of each organism would allow this. This can be done by using reverse transcriptase to create dna transcripts of mRNA with small hairpin loops at the end. DNA polyermase will then synthesize a complement strand. This method gives a library of all expressed genes.
Whats the difference between indirect and direct immunofluorescence?
Direct Immunoflourescence Test - Unknown test antigen fixed to a slide and exposed to fluorescent antibody solution of known composition. If Ab are complementary to Ag they will bind. Fluorescing cells or particles indicate presence of Ab-Ag complexes - a Positive Result. Indicates: Syphillis, gonorrhea, chlamydia, whooping cough or legionnaires disease. Indirect Immunofluorescence - Fluorescent antibodies are antibodies made to react with Fc Region of antibody. Antigen of known charcter is combined with the test serum of unknown antibody.
The sequencing of the human genome lead to the realization that some chromosomes contains many genes while others contain relatively few. This finding implies what about the density of genes in a genome? Genes are not uniformly distributed and appear in clusters separated by large noncoding regions. Genes are uniformly distributed throughout the genome. Genes have no organization and randomly appear throughout the genome and chromosomes Genes are uniformly distributed on chromosomes but not through the entire genome.
Genes are not uniformly distributed and appear in clusters separated by large noncoding regions.
The_________________ is an international effort to construct a physical map sequence of the 3.3 billion base pairs in the haploid human genome.
Human Genome Project
Which of the below are not steps in the production of genome sequence maps: Identify molecular markers on specific chromosomes. Read the sequence of individual piece of the genome. All of these are steps you would use. When sequences are obtained, assemble and organize the sequences in order. Isolate whole chromosomes.
Isolate whole chromosomes.
The study of ancient DNA from fossilized samples.
Paleogenomics
Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the fragments contains the DNA piece of interest. This problem is solved by Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest Knowing the isoelectric points of the piece in question. Identifying the molecular weights of the fragments in question None of the above Measuring the sizes of the bands on the gel
Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest
Which of the following enzymes is used to make complementary DNA (cDNA) from RNA? DNAse gene cloning reverse transcriptase hydrogen sulfide isolation of stem cells from a lamb embryo and production of a zygotic equivalent
Reverse transcriptase
What is the difference between clone by clone genome sequencing and shotgun sequencing.
Shotgun sequencing is much faster and less expensive
When generating a cDNA library, one may get different sequences returned if samples are taken at different times. Why is this the case?
The cDNA library uses reverse transcriptase to copy mRNA present in the cell to DNA. If cellular conditions change over time, the genes being expressed could change as well resulting in a different cDNA library being generated.
Intron frequency varies considerably among eukaryotes. Provide a general comparison of intron frequencies in yeast and humans. What about intron size?
The entire yeast genome has only about 240 introns, whereas some single genes in humans contain over 100 introns. In general, smaller genomes have smaller intron size in addition to lower intron number.
Explain why the greatest diversity of human SNPs is found among African people.
The greatest diversity of human SNPs is found in African people because studies suggest that humans first evolved in Africa. Since Africans have been around the longest they have had the greatest amount of time to create SNPs.
Linkage analysis performed on thousands of people to find genomic markers that map near disease genes
The human genome project
Restriction mapping is used to characterize cloned DNA. What does a restriction map tell the researcher about the cloned DNA? The distances between restriction sites for the specific restriction enzyme. The number of sites and distance between them for the specific restriction enzyme. The number of restriction sites for the specific restriction enzyme. The size of the genome the cloned DNA was isolated from. The restricted conditions under which the organism can grow
The number of sites and distance between them for the specific restriction enzyme.
What two factors contribute significantly to the wide ranges of genome size among eukaryotes?
The presence of introns and repetitive sequences is a major contributor, as are the differences in the number of genes.
Crossing over is often reduced around centromeric regions of chromosomes. If you were trying to construct a genetic map of two linked marker loci in this region, what result might you obtain and why? How would the genetic map correspond to the physical map?
The recombination frequencies would be low, and you would deduce that the markers were very close to one another.
You have cut DNA from source A with restriction enzyme #1 and you have cut DNA from source B with restriction enzyme #2. Both of these restriction enzymes leave a 4 base single stranded overhang. You want to ligate these restricted fragments together. What must be true for this to be successful?
The single stranded overhangs must be complementary to one another and DNA ligase must be present to seal the fragments together.
When choosing a restriction enzyme for use in recombinant DNA technologies, it is often preferred that the enzyme generate cohesive, or "sticky," ends. Why is this preferred? The sticky ends have hydrogen bonds that help re-anneal the cut DNA. The sticky ends make the DNA bind tighter to any cut DNA. The sticky ends prevent the DNA from re-annealing to any DNA. The sticky ends stick to the purification medium making the fragments easier to purify. The sticky ends do not have hydrogen bonds to help in re-annealing the cut DNA.
The sticky ends have hydrogen bonds that help re-anneal the cut DNA
Conditional knock-out organisms provide which advantage over full knock-out organisms? They allow scientists to render the organism unconscious at any time. They allow scientists to turn on the gene at any time during the organism's development. They allow scientists to turn the gene off at any time during the organism's development. They allow scientists to study genome size.
They allow scientists to turn the gene off at any time during the organism's development.
What might be a reasonable function of restriction endonucleases in a bacterium, distinct from their use by molecular biologists?
They protect the bacteria's DNA by being able to recognize viral DNA and then digesting it.
What term is used to refer to the process in which DNA can be introduced into host bacterial cells?
Transformation
There are multiple cloning vector types in modern recombinant DNA technology ranging from plasmids to viral vectors. Which vector type is most useful when cloning an insert of approximately 500kb? bacterial artificial chromosome yeast artificial chromosome phage lambda puc plasmid
Yeast artificial chromosome
What is codon bias?
all of the synonymous codons for a particular amino acid are not used with equal frequency
Massive study of noncoding DNA
encyclopedia of DNA elements (ENCODE)
A way to analyze peptic fragments for their charge vs. mass ratio (m/z)
mass spectrometer
The one successful example of transgenic livestock.
mice
Which of the following is a major contributor to variation in gene density in eukaryotes? repetitive sequences restriction sites SNPs heterochromatin
repetitive sequences
During gel electrophoresis, __ will migrate more rapidly than __. a. cloning vectors b. ethidium bromide c. large DNA fragments d. DNA size markers e. small DNA fragments
small DNA fragments large DNA fragments
Over the years, sophisticated plasmid vectors have been developed for use in recombinant DNA technology. Describe the useful features that have been introduced in these vectors.
small size to allow large inserts high copy number large numbers of unique restriction sites (polylinkers) variety of selection schemes (pigmented colonies, antibiotic resistance)
What advantages does pUC18 have in terms of recombinant DNA technology? List 3 such advantages.
small size, high copy number, polylinker in lacz gene
What is the ultimate goal of the Human Genome Project? to better understand the genes and regulatory elements of the genome to understand all of the proteins generated in a cell to map all the genes in the genome so they can be edited with CRISPR-cas to rid the human population of genetic disease
to better understand the genes and regulatory elements of the genome
When a 5-kb circular plasmid is digested with a restriction enzyme that has three recognition sites on the plasmid, how many bands can be visualized on an agarose gel? 1. A) 1 4 2 1 3
3
Assume that a plasmid (circular) is 3200 base pairs in length and has restriction sites at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion. 300, 700, 2200 300, 700, 1000, 1200 400, 1200, 1600 400, 800, 1000 (2 of these) 700, 400, 1400, 2600
300, 700, 1000, 1200
When performing a sequencing reaction using Sanger sequencing, which ddNTPs must be included in the reaction? 1.A) ddATP 2.B) ddTTP 3.C) ddCTP 4.D) ddGTP 5. E) all four ddNTPs must be present all four ddNTPs must be present ddATP ddTTP ddGTP ddATP
5. E) all four ddNTPs must be present
A section of a genome is cut with three enzymes: A, B, and C. Cutting with A and B yields a 10-kb fragment. Cutting with B and C yields a 2-kb fragment. What is the expected result from a digest with A and C, if the C site lies in between the A and B sites? A 12-kb fragment An 8-kb and a 2-kb fragment An 8-kb fragment A 10-kb and a 2-kb fragment A 10-kb, an 8-kb, and a 2-kb fragment
An 8-kb fragment
Write the letter all of the following statements that are NOT true. a. Coding sequences for gene products can be isolated from cDNA libraries. b. Antibodies are used for Northern blot analysis. c. VNTRs are highly conserved in human populations. d. PCR amplification generates large numbers of linear DNA fragments. e. RNA molecules can be used as hybridization probes in Southern blot analysis.
Antibodies are used for Northern blot analysis. VNTRs are highly conserved in human populations.
Next-generation sequencing takes advantage of the concept of sequencing-by-synthesis. What is sequence-by-synthesis? 1. A) The use of PCR to incorporate ddNTPs, followed by electrophoresis. 2. B) The use of a multiwell system and microfluidics to detect incorporated nucleotides at each base. 3. C) The use of a single polymerase in a nanopore that reports on a single molecule of synthesized DNA. 4. D) The use of firefly luciferase and pyrophosphate to report on nucleotide incorporation. The use of PCR to incorporate ddNTPs, followed by electrophoresis. The use of a multiwell system and microfluidics to detect incorporated nucleotides at each base. The use of firefly luciferase and pyrophosphate to report on nucleotide incorporation. The use of a single polymerase in a nanopore that reports on a single molecule of synthesized DNA.
B) The use of a multiwell system and microfluidics to detect incorporated nucleotides at each base.
Sanger sequencing is based on the order in which ddNTPs are added to a growing polynucleotide. Why are ddNTPs integral to the Sanger sequencing method? They do not have a 3′ hydroxyl, which does not allow the extension of the polynucleotide. They do not have a 2′ hydroxyl, which does not allow the extension of the polynucleotide. They have a 3′ hydroxyl that allows for extension of the polynucleotide. They have a 2′ hydroxyl that allows for extension of the polynucleotide.
They do not have a 3 hydroxyl, which does not allow the extension of the polynucleotide.
Mastitis in cows results in infected mammary glands. The use of biotechnologies to introduce the antibiotic gene lysostaphin from Stpahylococcus simulans is an example of generating what type of animal? a conditional knock-out animal a synthetic animal a transgenic animal a knock-out animal
a transgenic animal
The human genome contains approximately 20,000 protein-coding genes, yet has the capacity to produce several hundred thousand gene products. What can account for the vast difference in gene number and product number? There are more introns than exons. There are more exons than introns. Every gene can be read in both directions, and each gene can have inversions and translocations. It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing. Much of the DNA is in the form of trinucleotide repeats, thus allowing multiple start sites for different genes.
alternative splicing occurs
What is a dideoxynucleotide? How are they used in DNA sequencing?
are chain-elongating inhibitors of DNA polymerase, used in the Sanger method for DNA sequencing.
In the context of molecular genetics, reverse translation refers to transcribing first, then translating. assembling an RNA sequence from a DNA sequence. translating in the 3' to 5' direction. making an amino acid sequence from a DNA sequence. assembling a DNA sequence from an amino acid sequence.
assembling a DNA sequence from an amino acid sequence
A principal problem with inserting an unmodified mammalian gene into a bacterial plasmid, and then getting that gene expressed in bacteria, is that bacterial RNA polymerase cannot make RNA complementary to mammalian DNA bacterial DNA is not found in a membrane-bounded nucleus and is therefore incompatible with mammalian DNA bacteria cannot remove eukaryotic introns. prokaryotes use a different genetic code from that of eukaryotes
bacteria cannot remove eukaryotic introns.
The CRISPR-Cas system of gene editing is based on what naturally occurring biological process? viral defense against bacterial defenses eukaryotic defense against viral infection viral defense against eukaryotic defenses bacterial defense against viral infection
bacterial defense against viral infection
One procedure that has greatly enhanced prenatal screening is ________. RNA-seq chorionic villus sampling fetal blood sampling GWAS
chorionic villus sampling
Restriction endonucleases... are human enzymes. cut DNA at specific sequences. are used to randomly digest DNA molecules. are all genetically engineered.
cut DNA at specific sequences.
The Human Genome Project, which got under way in 1990, is an international effort to ________. collect plant seeds in order to reduce the impact of human activity on plant extinction clone deleterious genes from humans and study their mode of action clone beneficial genes from humans for eventual use in gene therapy determine the base sequence of the human genome and to identify all the genes within collect samples of cells from all parts of the world in order to preserve human genetic diversity
determine the base sequence of the human genome and to identify all the genes within
One of the primary reasons for generating a large number of clones in a eukaryotic genomic library is that each ligation product is sequence specific. lysogenic phages continue to integrate their DNA into the host chromosome, thus reducing the number of desired recombinant clones. each cosmid replicates nonautomously. each vector can take up only a relatively small fraction of the eukaryotic DNA. the host range of the vector is limited.
each vector can take up only a relatively small fraction of the eukaryotic DNA
There is a fear that preconception genetic testing may lead to "designer babies." What historical practice comes to mind regarding the production of such babies? gene editing gene driving inbreeding eugenics
eugenics
A BLAST search is done to find the chromosomal location of a sequence. predict the three-dimensional structure of a protein from its amino acid sequence. find restriction sites and SNPs in a sequence. determine the conditions under which a gene is expressed. find similar gene or protein sequences.
find similar gene or protein sequences.
List two especially useful characteristics of cloning vectors. reverse transcriptase and ligase activities high copy number and antibiotic resistance gene(s) nonautonomous replication and transposition ability to integrate into the host chromosome and then cause a lytic cycle virulence and lysogenicity
high copy number and antibiotic resistance gene(s)
Archaebacteria have_______ proteins associated with the DNA allowing them to form________ similar to Metazoans.
histones, chromatin
Nucleic acid blotting is widely used in recombinant DNA technology. In a Southern blot one generally hybridizes filter-bound RNA with a DNA probe. examines amino acid substitutions with radioactive probes. hybridizes filter-bound DNA with a DNA probe. cleaves RNA with restriction endonucleases. ligates DNA with DNA ligase.
hybridizes filter-bound DNA with a DNA probe.
What is the main purpose of a DNA probe? extend the growing polynucleotide hybridizes to a target sequence cuts DNA targets binds to proteins
hybridizes to a target sequence
Of what advantage is it to have a polylinker region (multiple unique restriction sites) embedded in the lacZ component in the pUC series of plasmids?
insert of DNA in polylinker inactivates lacZ component and allows identification of recomb plasmids under proper genetic and environmental conditions
Compared with prokaryotic chromosomes, eukaryotic chromosomes are large, mainly organized in polycistronic transcription units without introns. small, mainly organized in monocistronic transcription units with introns. large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns. small, mainly organized in polycistronic transcription units without introns. large, mainly organized in monocistronic transcription units without introns.
large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns.
Recombinant DNA technologies are methods used to do which of the following? join together DNA molecules from the same source combine chromosomes to make them easier to study manipulate DNA for the study of specific sequences induce homologous recombination inside a cell integrate DNA in computers to make them faster
manipulate DNA for the study of specific sequences
A PCR was designed to clone a DNA sequence of 1.5 kb. When the products were run on an agarose gel, there was a smear of bands ranging from 1.5 kb to 6 kb. Which of the following is a reason for this result? the polymerase overran the reverse primer the thermocycler malfunctioned the polymerase denatured one of the primers did not bind completely
one of the primers did not bind
In general, the organization of genes in bacteria is different from that in eukaryotes. In E. coli, approximately 27 percent of all genes are organized into contiguous, functionally related units containing multiple genes under coordinated control that are transcribed as a single unit. Such contiguous gene families are called ________. contigs transcriptomes pseudogenes operons proteomes
operons
What's the difference between an ortholog and a paralog?
ortholog is passed from a common ancestor and serves the exact same function, paralog is still passed along but is not necessarily used for the original use by ancestors.
The set of all proteins encoded by the genome is called the _______ . transcriptome genome metabolome pharmacogenome proteome glycome
proteome
Using single-cell RNA sequencing a clinician can now determine ________ in one experiment instead of two? gene expression and protein levels associated with those genes whether the organism is transgenic or not heterozygosity ratio of genes present to the expression levels of those genes
ratio of genes present to the expression levels of those genes
DNA ligase ________. reconnects the bases together between the DNA strands removes bases from a DNA molecule cuts the DNA to produce sticky or blunt ends adds bases into a growing DNA molecule reconnects the phosphodiester linkage between bases on the same strand of DNA
reconnects the phosphodiester linkage between bases on the same strand of DNA
Transcriptomics requires the isolation of RNA to generate sequence data. If a scientist wants to use next-generation sequencing to perform their experiment which of the following is necessary? protein quantification heterochromatin reverse transcriptase euchromatin
reverse transcriptase
Restriction endonucleases are especially useful if they generate "sticky" ends. What makes an end sticky? blunt ends single-stranded complementary tails poly-A sequences 5' cap interference
single-stranded complementary tails
SNPs are characterized by being ________. homogeneous with various nucleotides transcribed repeatedly highly heterogeneous with variable amino acid substitutions lethal genes with small noteworthy transcribed regions highly uniform in the population with variable numbers of tandem repeats variable in the population with variable base sequences
variable in the population with variable base sequences
The difference between a genetic screening experiment and a selection experiment is that a screening experiment involves ________, whereas a selection experiment creates conditions that ________ irrelevant organisms. complementation analysis, enhance visual examination, eliminate temperature extremes, enhance chemical removal, activate epistasis analysis, enhance
visual examination, eliminate