Molecular Biology Final Exam
Which one of the following is an exception to the rules of the genetic code?
A selenocysteine amino acid is incorporated into proteins in response to a UGA codon
Which one of the following most accurately describes the structure of the lac repressor in E. coli?
A tetramer
Which one of the following statements about single-base substitutions is true?
A transition mutation in the third position of a codon rarely results in an amino acid change
Which of the following is a characteristic of the set of genes in an operon that is NOT true of a regulon?
All of the genes in the set are controlled by a single promoter
Which one of the following is constitutively expressed?
All of the proteins are constitutively expressed.
What is the function of eukaryotic initiation factors?
All of these are functions of eukaryotic initiation factors
Which one of the following copolymeric peptides can be generated in vitro with the synthetic RNA polymer consisting of the repeating dinucleotide (AU)n?
(Ile-Tyr)n
Which of the following statements is consistent with the observation that the genetic code is nearly universal for all currently known life?
All organisms have a common ancestor
______________ is a true inducer of the lactose operon.
Allolactose
Certain amino acid changes in the C-terminal domain (CTD) of RNA polymerase II dramatically reduce the success of transcriptional intitiation. Changing the amino acids at which CTD sites would have this effect?
Amino acids that are targets for phosphorylation
Which of the following is NOT a common nucleosomal protein covalent modification that affects gene expression?
Glycosylation
Which of structural motifs found in transcriptional regulatory proteins is thought to interact with DNA only through the minor groove?
Homeodomain
What is the function of IF-1?
IF-1 prevents aminoacyl-tRNAs from binding to the A site of the preinitiation 30S subunit.
Which molecule is needed to bind to the initiator tRNA before it can bind to small subunit of the ribosome.
IF-2
Which molecule is needed to bind to the initiator tRNA before it can bind to the P site of the ribosome?
IF-2
A function or characteristic of the tRNA used for the first amino acid unique to either prokaryotes or eukaryotes
In prokaryotes, the methionine to the tRNA is formylated
True or False: Due to the physical separation of the nucleus from the cytoplasm in eukaryotes, the formation of polysomes is only possible in prokaryotes.
False
True or False; An additional level of error prevention occurs during protein synthesis when ribosomes discriminate between correctly and incorrectly charged tRNA molecules.
False
tRNA wobble is primarily a result of ______ codon-anticodon base pairing.
G U
Which one of the following base pairs is a Wobble base pair?
G-U
The correct conformation for IF-2 binding to charged tRNAs occurs when
GTP binds IF-2
Which of the following sequences contains is a direct repeat of three or more nucleotides?
GTTACATGTTAA
What are the conserved bases at the 5' and 3' ends of nuclear introns?
GU....AG
Which of these processes are least likely to expand the coding capacity of the genome by creating mRNAs that are not directly encoded by the DNA?
RNA capping
_______________ permits a cell to recode genetic information in a systematic and regulated fashion
RNA editing
The sequence of a promoter constitutes the most basic mechanism of transcription regulation because
RNA polymerase has differential affinities for different sequences that correlate with the efficiency of transcription.
Which of the following is NOT true of the regulation of the trp operon?
RNA polymerase is recruited to the promoter when tryptophan levels are high.
Which one of the following is NOT a step in the elongation stage of translation?
Recognition of a stop codon and release of the nascent polypeptide from the ribosome
Which of the following is NOT an example of a regulatory DNA site?
Repressor
Which of the following is NOT true of the regulation of translation initiation in eukaryotes?
Repressors bind to translational release factors
Which one of the following statements is FALSE?
Ribosomal RNAs are translated into proteins
Which of the following possesses peptidyl transferase activity?
Ribosome
Which one of the following experimental results does NOT support the hypothesis that the ribosome is a ribozyme?
Ribosomes from thermophilic organisms are more stable than from Escherichia coli.
If you constructed a mutant whereby the start codon of the leader peptide of the Trp operon were mutated, this would result in:
The attenuator stem-loop would form causing transcription termination leading to a lower level production of tryptophan
Which one of the following is not true of tRNA molecules?
The anticodon arm of tRNA contains a three nucleotide sequence that is identical to a specific mRNA codon
Promoters are cis-acting. The promoter is considered a cis-acting site because:
it exclusively influences the expression of a gene to which the promoter is proximal.
Which of the following genes is not a structural gene of the lac operon?
lacI
Which of the following is the regulator gene specific for the Lac operon?
lacI
Which one of the following genes or sequences is not physically part of the lactose (lac) operon of E. coli?
lacI
The lac repressor binds to what site within the lac operon?
lacO
The E. coli __________ gene codes for b-galactosidase.
lacZ
Which of the following is not part of the lac operon?
lacl
The peptidyl transferase reaction occurs in the
large subunit of ribosomes
Splicing of pre-mRNA is characterized by the formation of a
lariat structure.
Two splicing intermediates resemble _____________
lariats
Eukaryotic messenger RNA molecules have _______________ at their 5' ends.
m7 G caps
The first amino acid added to a polypeptide is _________________
methionine
The ______________ pathway blocks mRNA translation or causes mRNA degradation
miRNA
Amino acid-coding regions within eukaryotic genes may be interrupted by ___________ regions.
noncoding
The rate of peptide bond formation in a ribosome is enhanced because
of close positioning of the 3' ends of tRNAs in the A and P sites.
Eukaryotic ribosomes, as compared to bacterial ribosomes, have
one additional rRNA and many additional proteins
During translation, stop codons are recognized by
one or more "release factors"
The genetic code is degenerate because:
one particular amino acid can be encoded by more than one codon
Which of the following is not a way in which a DNA sequence can code for more than one polypeptide?
tRNAs with the same anticodon that carry different amino acids
The antibiotic puromycin inhibits protein synthesis by
temporarily binding to the A site and taking the polypeptide from the ribosome
Tryptophan is called the _____ because its presence turns off the trp operon.
corepressor
A branched ("lariat") structure is formed during:
splicing of group II introns.
Which of the following would you expect to find in an inducible system?
A repressor protein, which is bound to DNA in absence of any other factor.
When the coding region of a prokaryotic gene is cloned into the lacZ gene downstream from the translational initiator, the chance of an in-frame protein fusion is
1/6
All of the following are matched correctly except ____
16S rRNA: located in large subunit of ribosome
The nucleophile of the first step of spliceosome-mediated pre-mRNA splicing is the:
2' hydroxyl of the branch point adenosine.
If transcription proceeds without pausing, what stem loop structures are formed in the trpL mRNA?
2-3
Ras mRNA (mRNA transcribed from the Ras gene) is found at a concentration of 100 molecules per nerve cell at time zero. Then at time zero you irradiate the cells with UV light such that transcription is turned off. After 40 minutes you determine that the concentration of Ras mRNA is now 25 molecules per cell. What is the half life of mRNA-X in these cells?
20 minutes
A large ribosomal subunit in E. coli possesses ___ rRNA molecules and has a sedimentation coefficient of ___
2;50
Which ribosomal subunit contains the decoding center where aminoacylated tRNAs "read" the genetic code by base pairing with each triplet codon in the mRNA?
30S
Which of the following best describes the composition of the bacterial translation initiation complex?
30S and 50S subunits, mRNA start codon paired with the anticodon of fmet-tRNAfmet, fmet-tRNAfmet bound in the P site, A site is open
Ribosomes move on the mRNA in what direction?
5' to 3'
How many codons of the genetic code are used for coding amino acids?
61
The chemical structure of the 5' mRNA cap includes _______________ covalently linked to the 5' terminal residue of the mRNA through a ________________ linkage.
7-methylguanosine; 5' to 5' triphosphate
What is the approximate length of an mRNA molecule that encodes for a protein with a molecular weight of 30,000? (The average molecular weight of an amino acid is 110.)
825 nucleotides
Which one of the following is part of the complex of molecules that enters the open A site of a bacterial ribosome during each repeated round of elongation?
A charged tRNA
Which one of the following statements about the genetic code is true?
A new codon begins every three nucleotides
The most convincing evidence that lacI is a diffusible protein is:
A partial diploid with only one functional lacI gene is able to regulate both copies of the lac operon.
Which of the following is true regarding conserved sequences in pre-mRNA splice sites
AG at the 3' end of the intron
Which of the following is incorrect with respect to translation and the genetic code?
AUG is the start codon and encodes for a methionine (or derivative of methionine) at the Genetic Code 15.23 carboxyl end of the protein
Which one of the following mRNA sequences could encode for the peptide Met-Ala-His-Ser?
AUGGCUCACAGC
Which one of the following is a function of the lambda repressor protein?
Activating additional expression of its own gene
The enzyme adenosine deaminase acting on RNA (ADAR) catalyzes which of the following nucleotide conversions?
Adenosine to inosine
Which of the following proteins is NOT associated with the C-terminal domain of RNA Polymerase II?
Aminoacyl-tRNA synthetase
Which of the following evidence supports the RNA world hypothesis?
An RNA component of ribosomes catalyzes the synthesis of proteins.
Which of the following does NOT reflect the action of an effector molecule on the transcription of a gene?
An effector binds to a polymerase to increase the level of transcription
One form of severe thalassemia is known to be the result of a mutation that causes abnormal RNA splicing because of a five nucleotide deletion that disrupts the first splice donor signal of the beta globin pre-mRNA. All thalassemias result in a reduced rate of synthesis of one of the globin chains (either alpha or beta globin) that make up hemoglobin. Which of the following techniques would best show the presence of the abnormal splicing in a suspected carrier of the disease?
Analysis to detect altered size of beta globin mRNA
Which of the following is most responsible for the specificity of interaction between the aminoacyl-tRNA and the complementary mRNA codon?
Anticodon
Genes within an operon:
Are generally involved in the same biochemical pathway
Table 17-1 lists the number of codons that encode for each amino acid. One of the four relationships proposed by Francis Crick related to the wobble hypothesis is that when an amino acid is specified by different codons, codons that differ in either of the first two bases require different tRNAs. Which one of the following amino acids must have at least two different tRNAs?
Arg
Which of the following is NOT a function of the release factors of bacterial translation termination?
Assisting in the initial folding of the nascent polypeptide chain
Using purified RNA polymerase (and sigma) one can set up an in vitro (purified enzyme) transcription reaction. If you transcribe the trp operon in vitro, you find that virtually all the transcripts are terminated at the attenuator. Even in the presence or absence of the amino acid Trp, termination always occurs. Which of the following is the best explanation for the observation that the attenuator not be regulated in an in vitro transcription system?
Attenuation requires ribosome binding and ribosomes were not added to the in vitro transcription reaction.
A function or characteristic of mRNA structure/sequence common to prokaryotes and eukaryotes.
Coding sequence flanked by 5' and 3' UTR sequences
What is the key component of the catalytic site of the spliceosome?.
RNA
The correct location of fMet-tRNAfMet in the P site in the initiation complex is ensured by at least three points of recognition and attachment. Two of the points of recognition and attachment are: (1) the codon-anticodon interaction involving the initiation 5'-AUG fixed in the small subunit portion of the P site, (2) interaction between the Shine-Dalgarno sequence in the mRNA and the 16S rRNA of the small subunit. What is the third point of recognition and attachment?
Binding interactions between the large-subunit portion of the P site and the fMet-tRNAfMet
Which of the following is NOT a mechanism for regulating gene expression after the mature RNA transcript is produced?
Blockage of the promoter by a repressor protein
You want to clone an insert containing a gene-of-interest into a plasmid vector. Which of the following is TRUE?
Both the insert and plasmid must be cut with the same restriction enzyme
A function or characteristic of initiator factors common to prokaryotes and eukaryotes
Bring initiator tRNA to the P site on the small subunit (this one is correct)
A nonsense mutation resulted in the RNA shown below. A tRNA anticodon sequence mutated from ________ to 5'-CUA will result in translation to the peptide Met-Leu-Ala-Leu-Arg-Ser-Pro. 5'- AUGCUUGCUUAGAGAAGUCCU
CAA
What is the sequence of the last three nucleotides of all mature tRNA molecules?
CCA
Which statement about the genetic code is TRUE?
CCU, CCC, CCA, and CCG all code for the same amino acid.
The activator for the lac operon is:
CRP
Which of the following is an expected anticodon sequence in the tRNA that delivers a glutamic acid amino acid during translation of the transposase mRNA?
CUC
The two codons for glutamine are CAA and CAG. Which one of the following is likely to be the anticodon of a tRNA that is specific for glutamine?
CUG
Which one of the following most likely represents a difference between Class I and Class II aminoacyl-tRNA synthetases?
Class I enzymes typically have only tertiary structure; Class II enzymes often have quaternary structure
A mRNA that is polycistronic
Codes for multiple different proteins.
A function or characteristic of mRNA structure/sequence common to prokaryotes and eukaryotes
Coding sequence flanked by 5' and 3' UTR sequences
You synthesize polyribonucleotides using a molar ratio of 3 Uracil : 1 Guanine. The resulting polyribonucleotide sequences are random but each polyribonucleotide follows the 3:1 ratio. When this mixture of polyribonucleotides is used as template for translation, proteins with different amino acid sequences are obtained. When you determine the amino acids present in the proteins, you obtain the frequencies for each amino reported in Table 2. The frequency of phenylalanine was normalized to 1 and all other amino acids are reported as a frequency of occurrence compared to phenylalanine. As an example of understanding the data, the amino acid glycine frequency is 0.12 meaning that glycine was present in the mixture of polypeptides at a ratio of 12 glycine residues (amino acids) for every 100 phenylalanine residues (amino acids). Which one of the following statements about the experiment or data is true?
Codons consisting of one guanine and two uracils, in any order, are likely to encode for either valine, leucine, or cysteine
All of the following statements regarding translation in bacteria are true except _____.
Completion of the initiation phase of translation requires only the attachment of the small ribosomal subunit to the mRNA
During initial lambda infection, lysis is favored over lysogeny when:
Cro binds to OR3, blocking expression of lambda repressor.
In the RNAi response
DICER produces siRNAs from dsRNA. These become part of a RISC complex. The RISC complex contains SLICER and a siRNA. It is this complex that cuts up the mRNA.
Ribosomes consist of certain macromolecules. During protein synthesis, ribosomes temporarily interact with a number of macromolecules. Of the following, which macromolecule is not part of a ribosome and does not temporarily interact with ribosomes? :
DNA
Which of the following is NOT an enzymatic function of the editosome?
Deaminase
Which of the following eukaryotic RNA processing events does NOT occur in the nucleus?
Degradation of mRNA
After phage ë initially enters a bacterial cell, activation of the early promoters:
Directs synthesis of an antiterminator protein
Formation of double-stranded RNA regions is important for many examples of regulation by RNA. Which of the following is a mechanism by which double-stranded RNA can affect regulation?
Double-stranded RNA may create a site for degradation by specific ribonucleases.
After transferring its peptide, a tRNA exits the bacterial ribosome complex via the _______
E site
The site in a ribosome from which an uncharged tRNA is released is referred to as the:
E site
Bacterial translation initiation does not require
EF-Tu
Which of the following is NOT true of the first step of translational elongation in bacteria?
EF-Tu hydrolyzes GTP after dissociation from the aminoacyl-tRNA bound in the A site.
Sidney Brenner found bacteriophage T4 point mutants in which a protein was prematurely terminated. The premature termination point of the protein was different in different mutants. When he determined where the protein synthesis terminated for each mutant, in every case, the next amino acid of the protein would have been a glutamine, lysine, glutamic acid, tyrosine, or serine. What is the unique similarity of these amino acids or their codons that would play a role in the premature termination of translation in the mutant protein gene?
Each of the codons for these amino acids could be changed to UAG with a single nucleotide mutation
A function or characteristic of initiator factors unique to either prokaryotes or eukaryotes
Eukaryotic IF's involved in cap binding (this one is correct)
A function or characteristic of mRNA structure/sequence unique to either prokaryotes or eukaryotes.
Eukaryotic mRNAs have a 5' cap
A function or characteristic of ribosome structure/sequence unique to either prokaryotes or eukaryotes
Eukaryotic ribosomes are larger
The human á-tropomyosin gene contains 13 exons and is alternatively spliced. Exons 2 and 3 are alternative exons used in different cell types. (Some cell types use exon 2 but not 3, some use exon 3 but not 2. The rest of the protein is translated in the same frame regardless of which exon is used.) Which of the following statements about exons 2 and 3 is the most accurate?
Exons 2 and 3 must contain a number of nucleotides that when divided by 3 leaves the same remainder.
True or False. Eukaryotes use a variety of pathways to form 5'-m7 G caps.
False
A function or characteristic of finding the AUG start codon unique to either prokaryotes or eukaryotes.
In prokaryotic mRNA, the Shine-Dalgarno sequence just upstream of the AUG base pairs with a sequence in the 16S rRNA
Functions of the lambda repressor protein include all of the following except:
Inhibition of the PR promoter for the cII gene, preventing activation of the PRE promoter.
IF1, IF2, and IF3 are involved in translation
Initiation
Which of the following is NOT usually involved in the processing of primary mRNA transcripts?
Insertion of intron sequences
Which of the following is NOT a typical example of mRNA editing?
Insertion of one or more A residues
Which of the following is NOT true of introns?
Introns are commonly found in bacteria.
An operator:
Is is a binding site for a regulatory protein which overlaps or is very near the promoter for a given gene or operon.
Which of the following is NOT true of the lambda repressor protein, cI?
It binds DNA as a monomeric protein.
Which of the following is NOT true of the lacI region of the lac operon?
It is bound by the Lac repressor when lactose is unavailable.
Which of the following is true of the leucine-zipper structural motif?
It is often used to mediate protein-protein interactions
Which of the following is NOT true of signal integration by more than one transcription factor?
It is used to control the expression of genes in opposite orientations that are controlled by the same promoter
Which of the following is NOT true of the lacO region of the lac operon?
It produces a diffusable product that can regulate the expression of the operon.
What lambda phage protein is responsible for maintaining the lysogenic state.
Lambda repressor (cI)
Which of the following scenarios leads to the highest level of lac operon expression?
Low glucose levels, lactose present
A function or characteristic of ribosome structure/sequence common to prokaryotes and eukaryotes
Made up of two subunits
Which of the following is an experiment whose data is most likely to tell you whether a new protein, called BYU, that appears when cells are infected by a virus is encoded by host the host cell genome or the virus genome.
Make a DNA probe based on the BYU protein sequence and use the probe in a southern blot of virus DNA in one lane and host cell genomic DNA in another lane.
The experiments demonstrating that ribosomes check the anticodon of the tRNA, but not the amino acid attached to it, were carried out well before the entire genetic code was defined. The research team, led by Seymour Benzer, chose tRNACys for their demonstration, for several reasons—including the ability to reduce Cys to Ala in a simple chemical reaction using Raney nickel. For their experiment showing that Ala could be incorporated into polypeptide in place of Cys if present in the translation reaction mix as Ala-tRNACys, the researchers first used polynucleotide phosphorylase to synthesize an RNA polymer consisting of only U and G residues. They knew from previous reports that this polymer would yield polypeptides with the amino acid composition they required. Which one of the following amino acids would NOT be incorporated into a polypeptide specified by a random sequence of U's and G's?
Met
The experiments demonstrating that ribosomes check the anticodon of the tRNA, but not the amino acid attached to it, were carried out well before the entire genetic code was defined. The research team, led by Seymour Benzer, chose tRNACys for their demonstration, for several reasons—including the ability to reduce Cys to Ala in a simple chemical reaction using Raney nickel. For their experiment showing that Ala could be incorporated into polypeptide in place of Cys if present in the translation reaction mix as Ala-tRNACys, the researchers first used polynucleotide phosphorylase to synthesize an RNA polymer consisting of only U and G residues. They knew from previous reports that this polymer would yield polypeptides with the amino acid composition they required. Which one of the following amino acids would NOT be incorporated into a polypeptide specified by a random sequence of U's and G's?
Met
Which one of the following polypeptide sequences will be made from the RNA sequence shown, translating from the first start codon to the stop codon? 5'- CGACAUGCCUAAAAUCAUGCCAUGGAGGGGGUAACCUUUU
Met-Pro-Lys-Ile-Met-Pro-Trp-Arg-Gly
Sidney Brenner and Francis Crick recombined the rII genes from two mutant T4 phage containing insertion or deletion mutations and created phage with a rII gene containing two mutations instead of one. They repeated this experiment with many mutant T4 phage. In some cases, the recombined gene restored normal function of the rII gene (ability to infect multiple hosts). Brenner and Crick interpreted this result as evidence that the reading frame in the recombined rII gene, disrupted by an insertion or deletion in one mutant rII gene was restored by an insertion or deletion mutation in the other mutant rII gene. Below is a hypothetical wild type gene sequence and four mutant gene sequences. Which pair of mutant gene sequences when recombined would restore the reading frame of the wild type gene? Of course, in between the mutations, the amino acids encoded by the recombined gene will be different than the wild type.
Mutant I and Mutant III
Which of the following describes the function of the lacO region of the lac operon?
Mutation of this region leads to constitutive expression of the operon.
The energy required to carry out the nucleophilic attack by the amino group of an incoming amino acid on the terminal carbonyl group of the growing polypeptide comes from:
None of the above accurately describes the source of energy required.
What would be the most likely effect of a mutation in the eukaryotic gene for poly(A) polymerase?
Nonfunctional poly(A) polymerase is likely to destabilize all mRNAs by decreasing the polyA tail formation
Your goal is to identify the E. coli genes that significantly change in expression within the first 10 minutes of lambda infection. You believe that only a small group of genes will fall into this category. With this goal in mind, which one of the following techniques would be best?
Northern blot
in lambda phage, expression of cI from PRM is repressed when
OR3 is occupied
Attenuation of the trp operon:
Occurs in the presence of high levels of tryptophan.
Consider a mutation in which the codon CUU is changed to AUU. Which of the following statements is true with respect to this codon change?
One hydrophobic amino acid is replaced with another hydrophobic amino acid
Poly U (UUUUUUUUUUUUU) encodes poly Phenylalanine. What does UUC encode?
Phenylalanine
Which one of the following sets of homopolymeric peptides is generated in vitro with the synthetic RNA polymer consisting of the repeating trinucleotide (GUC)n?
Poly(Arg), Poly(Ser), and Poly(Val)
Which of the following events are NOT true of the polyadenylation of mRNA?
Polyadenylate polymerase uses a poly(U) RNA template to synthesize the poly(A) tail.
Sucrose density gradients can be used to separate molecules on the basis of density. A cellular extract is layered on top of a sucrose density gradient and centrifuged. Which one of the following will travel the farthest into the sucrose density gradient?
Polysome
The codons UCU, UCC, UCA, and UCG all code for the same amino acid, serine. In which position of the codon are mutations most likely to found when comparing the same gene of two closely related species?
Position 3
Which of the following is NOT a mechanism for regulating gene expression before the mature RNA transcript is produced?
Protein degradation
Which of the following characteristics of protein degradation in eukaryotic cells is NOT true of protein degradation in bacterial cells?
Protein degradation is directed by the covalent attachment of ubiquitin
Which one of the following bacterial translational proteins is NOT a GTP-binding protein?
RF-1
Which one of the following describes a tRNA molecule that specifically recognizes the amino acid histidine but is charged with the amino acid serine?
Ser-tRNAHis
In bacteria, the rRNA of the 30S ribosomal subunit base pairs with the _____________ of the mRNA
Shine Dalgarno
________________ molecules can silence gene expression.
Short RNA
An important enzymatic protein isolated from Drosophila melanogaster was shown to have the following initial sequence of amino acids: Lys - Ser - Pro - Trp - His - . . . . . . Following exposure to x-rays, a series of mutant flies developed, each of which lacked normal activity for this enzyme. The mutant enzymes were isolated and displayed the following initial sequences: Mutant 1: Lys - Arg - Pro - Trp - His - . . . . . . Mutant 2: Lys - Ser - Pro Mutant 3: Lys - Ser - Leu - Gly - Met - . . . . . . What is the likely mutation which lead to the observed amino acid sequence for Mutant 1? What is the likely mutation which lead to the observed amino acid sequence for Mutant 2.
Substitution of the third base in the second codon. Nonsense mutation.
Fragile X syndrome is clinically recognized by intellectual disability, distinct facial features (e.g., enlarged face, large ears), repetitive movements (e.g., hand flapping) and anxiety. Humans with Fragile X syndrome have mutations in the FMR1 gene that encodes the fragile X mental retardation protein (FMRP), a protein essential for normal brain development. The most common mutation is an increase in the number CGG repeats in the gene. The CGG sequence is repeated 10-40 times in normal genes, but is found increased to over 200 repeats in persons with Fragile X syndrome. Huntington's disease (loss muscle coordination, cognitive decline) is caused by mutations in the huntingin protein gene increasing the number of CAG repeats from 6-30 (normal) to over 36 CAG repeats. These are two examples of dozens of human diseases that result from expansion of trinucleotide repeats. In these trinucleotide repeat disorders, the affected protein is translated but because folding and quaternary/tertiary structure of the protein is altered due to the extra repeated amino acids, the protein does not correctly function. Which of the following is the LEAST likely trinucleotide that will be involved in trinucleotide repeat disorders?
TAG
Which of the following events is least likely a result of protein phosphorylation?
Targeting of the protein for degradation by RNase
Which of the following elements, when nonfunctional, would lead to a reduction in the total amount of functional lacZ produced by a bacterial cell?
The CAP site.
How do eukaryotic transcription factors exert their effects on transcription when their binding sites can be thousands of base pairs away from the promoter?
The DNA between the bound site and the polymerase-promoter complex loops out, increasing proximity
Which site on the ribosome is never occupied by a tRNA linked to a nascent polypeptide chain?
The E site
Which of the following statements about regulation of the lac operon is true?
The Lac repressor can dissociate from the operator in the presence of glucose
Which of the following best describes the tRNA binding sites of the ribosome?
The P site contains the tRNA molecule covalently bound to the growing chain of amino acids.
Decreasing levels of tryptophan in an E. coli cell would lead to increasing expression of the trp operon by which one of the following mechanisms?
The Trp repressor protein adopts a conformation in which it is unable to bind to the trp operator sequence, allowing RNA polymerase to initiate transcription.
Which one of the following acts in trans?
The U1 snRNA
Which of the following types of the information CANNOT be determined using a Northern blot?
The amino acid sequence of the protein coded by a mRNA
What change in the control of trp operon expression is most likely to occur in E. coli cells containing the mutant trp leader peptide coding sequence compared to wild type?
The amount of attenuation will be reduced in the mutant.
The "adaptor" molecule that was hypothesized by Francis Crick to link amino acids to mRNA is actually which type of biomolecule?
tRNA
The nucleotide positions of the codon and the anticodon are numbered 1, 2, and 3 in the 5' to 3' direction. What fundamental principle of nucleic acid interactions is manifest by the observation that anticodon nucleotide 3 base pairs with codon nucleotide 1?
The base pairing of nucleic acids is anti-parallel
Which of the following is not a feature of ribosomes?
The cytoplasmic and organellar ribosomes of eukaryotes are identical
Which of the following describes an accurate order of events in translation?
The first aminoacyl-tRNA molecule binds to the small subunit before the large subunit binds
Which of the following characteristics of Group I intron splicing is NOT true of Group II intron splicing?
The first nucleophile is a 3' hydroxyl.
A function or characteristic of the tRNA used for the first amino acid common to prokaryotes and eukaryotes
The first tRNA binds to the P site
If you used radioactively labeled mRNA produced from the galactose operon (encodes for the galE, galT, and galK genes) as a probe in a southern blot experiment, the mRNA probe would NOT hybridize to which one of following DNA sequences?
The galactose operon P1 or P2 promoters.
If you used radioactively labeled mRNA produced from the galactose operon as a probe in a southern blot experiment, the mRNA probe would NOT hybridize to which one of following DNA sequences?
The galactose operon P1 or P2 promoters.
Which statement about prokaryotic ribosomes is TRUE?
The greatest mass of a ribosome is due to RNA
Which one of the following experimental results provides evidence that the genetic code is read in triplets?
The insertion of three consecutive nucleotides results in a relatively normal protein sequence
Which of the following is NOT a similarity between nuclear introns (involving spliceosomes) and Group II introns?
The intron lengths are conserved to sizes of 10-100 nucleotides in length
Which of the following is NOT true of the lac operon?
The lacI gene is controlled from the same promoter as the lacZ gene
A chromatography column in which oligo-T is linked to an inert substance is useful in separating eukaryotic mRNA from other RNA molecules. Which of the following is an accurate description of the principle by which this separation occurs?
The oligo-T binds to the polyA tail on mRNA.
Which of the following is NOT true of gene regulation by DNA looping?
The precise distance between the regulatory sequence and the promoter is important.
In 1961, Christian Anfinsen performed an experiment using bovine pancreatic RNase. He treated it with urea and beta-mercaptoethanol, and then measured the recovery of enzymatic activity after the protein gradually renatured. This experiment led to which of the following conclusions?
The primary structure of a protein contains all the information that is necessary for correct folding
You have a cloned copy of the wild-type (functional) GCA coding sequence. As a first task, select a promoter that, when joined to the GCA gene, is most likely to ensure proper expression of the GCA gene in liver cells:
The promoter from the gene that encodes the CK-19 protein, which is normally transcribed only in the liver
Induction of the E. coli SOS response in a lysogen would most likely lead to:
a switch from lysogenic growth to lytic growth.
During translation elongation, the growing polypeptide is transferred from
a tRNA in the P site to a tRNA in the A site
Gaucher's disease is genetic disorder with a higher incidence among the Ashkenazi Jewish population. Affected individuals cannot metabolize certain lipids, primarily because of a deficiency in the enzyme glucocerebrosidase (GCA), causing glucocerebrosides to accumulate in the blood and other tissues. The deficiency is caused by a mutation in the gene encoding GCA. In an effort to develop a gene therapy for this disorder, you have set out upon an ambitious strategy: • You intend to produce a copy of the GCA gene that is specifically expressed in liver cells; • You will introduce this gene into human liver cells by using the specialized, non-disease causing virus called HEP-RC, which can infect liver cells; • You will then transplant the resulting cells into the liver of a patient, hopefully establishing a cluster of cells in the liver that allows the patient to metabolize glucocerebrosides. You have a cloned copy of the wild-type (functional) GCA coding sequence. As a first task, select a promoter that, when joined to the GCA gene, is most likely to ensure proper expression of the GCA gene in liver cells:
The promoter from the gene that encodes the CK-19 protein, which is normally transcribed only in the liver
Which of the following is least likely to be the result of a mutation in the promoter of a gene?
The protein sequence of the gene product is altered.
Which one of the following statements most likely describes the consequence of having reduced function in eIF5 in a eukaryotic cell?
The rate at which the 60S subunit associates with the 40S subunit would be reduced
Which of the following is NOT true of the reactions that methylate the 5' end of the primary mRNA transcripts?
The reaction occurs after the entire transcript is synthesized.
Which of the following is the least likely mechanism for reducing the rate of gene transcription by a repressor?
The repressor induces a conformational change in the polymerase that accelerates the closed-to-open transition
Which of the following statements about translation is not true?
The ribosome is degraded after dissociating from the STOP codon
What is the best explanation for the stem loop arrangement seen in the absence of translation of the trpL gene?
The ribosome prevents region 1 from binding to any other region.
Which of the following is NOT true of zinc finger motifs?
The role of the Zn+2 ion is to interact with the negatively charged DNA backbone
A function or characteristic of finding the AUG start codon common to prokaryotes and eukaryotes
The smaller of the ribosomal subunits is involved in finding the AUG start codon
Which of the following is true of the mechanism of transcription attenuation of the trp operon?
The stalling of the ribosome at region 1 of the leader sequence inhibits the formation of the terminator structure.
What mechanism is used to generate the 3' ends of transcripts made by RNA polymerase II?
The transcript is cleaved at a specific polyadenylation site, and then the poly(A) tail is added.
Which of the following is true of the protein ubiquitination pathway?
The ubiquitin carboxyl terminus is covalently linked to the protein targeted for degradation
tRNAs contain unusual nucleotides such as dihydrouridine, ribothymine, inosine, and pseudouridine. What is the most likely explanation for how these unusual nucleotides become part of a tRNA?
The unusual nucleotides are the products of enzymes that post-transcriptionally modify normal nucleotides.
tRNAs contain unusual nucleotides such as dihydrouridine, ribothymine, inosine, and pseudouridine. What is the most likely explanation for how these unusual nucleotides become part of a tRNA?
The unusual nucleotides are the products of enzymes that post-transcriptionally modify normal nucleotides
In 1979, a group at Cambridge discovered that in human mitochondria, UGA is not a stop codon but instead during translation results in the delivery of the amino acid tryptophan. This was extremely unexpected since one organism could have two different genetic codes, and, the genetic code was not universal - it is mostly or nearly universal. The evolutionary history of the genetic code is an area of robust debate. Which of the following statements about the evolution of the genetic code is most likely true.
There is no chemical correspondence between codons and amino acids - the code is arbitrary in its origin
Which of the following is NOT true of the transcription-activation domains of transcriptional activators?
These domains interact with other proteins
Which of the following is true of the structure of typical transcriptional activators?
They contain a regulatory domain that is functional when removed from the DNA-binding domain
Which one of the following proteins is NOT required at low, basal levels for the regulation of the expression of the lac operon?
Thiogalactoside transacetylase
Which one of the following most likely describes the regulation of lactose metabolism of an E. coli merodiploid with a lacZ mutation in one copy of the operon and a mutation in the promoter sequence of the other copy of the operon?
This merodiploid would be unable to produce functional â-galactosidase
After determining that the genetic code is triplet codons, the question arose as to whether the code was overlapping or nonoverlapping. If the code was overlapping, a change in one nucleotide could result in a change in how many amino acids?
Three
The function of bacterial EF-Ts is to
convert EF-Tu•GDP to an active form
Why does the ribosome stall on region 1 of the attenuation region?
Translation of this region requires trp -tRNAtrp.
The anticodon of a tRNA is 5' - CCA - 3'. This tRNA most likely is charged by which amino acid?
Trp
True or False. Exons tend to be conserved during evolution, whereas introns usually are not as tightly conserved.
True
True or False. Splicing begins as a cotranscriptional process and continues as a posttranscriptional process.
True
True or False; A simplified peptidyl transferase reaction involves the addition of methionine to an amino acid mimic and antibiotic, puromycin. If the methionine was radioactive, you could detect radioactive puromycin if peptidyl transferase activity is present.
True
True or False; Every bacterial tRNA with a 3'-UAC-5' anticodon gets charged with the amino acid methionine, but not every one of these charged tRNAs remains charged with an unmodified methionine.
True
True or False; The first AUG is a eukaryotic mRNA is almost always recognized as the start site for translation initiation.
True
Which of the following amino acids is a target for phosphorylation by a protein kinase?
Tyr
Which snRNA binds to the intron branch point, causing an adenine to bulge out?
U2
In spliceosome-mediated pre-mRNA splicing:
U2 and U6 snRNAs base-pair during the two transesterification reactions.
Which of the following events do NOT occur during spliceosome assembly on pre-mRNAs?
U6 snRNP binds to the 3' splice site.
Which one of the following statements is a feature of the wobble hypothesis?
When inosine (I) is the first nucleotide of an anticodon, at least three different codons for the same amino acid can be recognized
A strain of E. coli cells possessing a mutation in the lacZ gene would have which one of the following phenotypes when induced with IPTG and plated on solid media?
White colonies when grown on media that contain X-gal
Which of the following structural motifs found in transcriptional regulators is the least likely to require an inverted repeat for binding to DNA?
Zinc finger
The bacterial Shine-Dalgarno mRNA sequence is:
a cis-acting ribosomal binding site
The Shine-Dalgarno sequence of a bacterial mRNA is recognized by
a complementary sequence in the 16S rRNA
The binding of tryptophan to the Trp repressor protein results in:
a conformational change in the repressor that allows the repressor to bind the operator
The reading frame of RNA is:
a continuous, non-overlapping set of three-nucleotide codons
Which of the following mutations in the function of the lac operon can be corrected by introducing a plasmid containing the wild-type sequence?
a defective lac repressor gene
A merodiploid is:
a haploid organism that contains a second copy of a part of its genome.
A ribonucleoprotein is:
a non-coding RNA complexed with protein.
The result obtained in Jacob and Monod's merodiploid analysis that suggested the lacI region acts in trans to regulate the lac operon was:
a non-functional lacI mutant is rescued by a wild-type lacI allele
The result obtained in Jacob and Monod's merodiploid analysis that suggested the lacO region acts in cis to regulate the lac operon was:
a non-functional lacO mutant cannot be rescued by a wild-type lacO allele.
An experiment designed to knock out peptide bond formation in a ribosome would most likely include:
a nuclease specific for RNA
The correct splicing of nuclear mRNA introns requires:
a protein complex and specific nucleotide sequences at the ends of the intron.
A transcription factor that enhances gene expression is called a(n):
activator
In positive regulation, a(n) ______________ activates a promoter.
activator
The effector for the Lac repressor protein is:
allolactose
The inducer for the lac operon is:
allolactose
The inducer of the lactose (lac) operon in E. coli is most specifically defined as:
allolactose
The lac repressor is inactivated by binding to which of the following?
allolactose
An RNA processing event that frequently leads to different protein products encoded by a single gene is:
alternative splicing.
A tRNA carrying an amino acid interacts with the codon in the ____________ site of a ribosome
aminoacyl A
A ribozyme is:
an RNA molecule with enzymatic activity.
The enzymes that "charge" tRNAs
are called aminoacyl tRNA synthetases
Negative _____________ occurs because the gene product regulates its own synthesis
autoregulation
Pre-mRNA splice sites are recognized by the spliceosome through:
base pairing with snRNAs.
the lac operon codes for
beta galactosidase
Which of the following structural motifs are NOT commonly found in the DNA-binding motifs of proteins that act as transcriptional regulators?
beta-barrel
The enzyme that catalyzes the formation of allolactose from lactose is:
beta-galactosidase
Class I aminoacyl-tRNA synthetases
bind a tRNA at the acceptor stem and the anticodon loop
Identification of the correct initiator codon in eukaryotes is accomplished via:
binding of accessory proteins to a modified guanine followed by recruitment of the 40S subunit and scanning for a nearby initiator codon
The most frequent source of error in protein synthesis is
binding of the incorrect charged tRNA to the codon
A cell does not compensate for a nonsense or frameshift mutation
by producing enzymes that detect and repair frameshift mutations
The effector molecule that binds to the activator of the lac operon is:
cAMP
Catabolite repression is a result of the interaction between:
cAMP and CRP
How does cAMP affect the expression of the lac operon?
cAMP binds to the CRP, increasing its affinity for a DNA site near the promoter.
Why isn't â-galactosidase induced early in the experiment even though lactose is abundant?
cAMP levels are low, so abundance of the CAP/cAMP complex is too low to induce the lac operon
The _________ complex binds to an activator site upstream from the lac promoter and activates lac operon transcription.
cAMP-CRP
Your goal is to identify the protein-coding genes that significantly change in expression within the first 10 minutes of yeast exposure to a particular antifungal drug. You believe that only a small group of genes will fall into this category. With this goal in mind, which one of the following techniques would be appropriate?
cDNA microarray
Poly(A) site choice:
can generate multiple protein products from a single gene.
Modification of tRNA bases
can occur in all four bases.
The first step catalyzed by an aminoacyl-tRNA synthetase is
cleavage of ATP to form an amino acid-AMP complex
Proteins that act by bridging activators and RNA polymerase are called:
coactivators
The bacterial transposons Tn5 and Tn10 each codes for a transposase. Transposition takes place through a cut-and-paste mechanism. The Tn5 and Tn10 transposases belong to the DDE family of transposases. The family name derives from the fact that the active enzyme has two aspartic acid (D) residues and one glutamic acid (E) residue at its catalytic site. Tn5 preferentially transposes into sites that have a AGNTYWRANCT sequence (where R = purine, Y = pyrimidine, W = adenine or thymine, and N = any nucleotide) or a slight variation of this sequence. The Tn5 transposase inserts the free Tn5 DNA into the target DNA, generating a 9-bp direct repeat on either side of the Tn5 insert. The AGNTYWRANCT sequence is an example of a(n) ________ sequence.
consensus
The continued functioning of a gene that does not respond to regulation is called:
constitutive gene expression.
an electrophoretic mobility shift assay is used to
determine if a protein binds to a DNA sequence.
Different aminoacyl-tRNA synthetases
do not appear to recognize the same features of tRNAs
The trigger for RNA interference (RNAi) is
double stranded RNA.
RNA editing by nucleotide insertion and deletion is catalyzed by the:
editosome.
Peptidyl transferase acts during _____
elongation of translation
Puromycin is a drug which resembles the end of a charged tRNA and can bind to the A site of a ribosome and be incorporated into a peptide by peptidyl transferase. Puromycin blocks _______
elongation of translation
Which of the above involves moving peptidyl-tRNA from the A site to the P site?
elongation of translation
Which of the above involves the hydrolysis of aminoacyl-tRNA bonds?
elongation of translation
Which of the above involves translocation of the ribosome?
elongation of translation
Which of the above involves the hydrolysis of peptidyl-tRNA bonds?
elongation of translation termination of translation
The structural genes of the trp operon produce _____.
enzymes for the synthesis of tryptophan
True or False. Bacterial mRNA usually has a long lifespan compared to other kinds of bacterial RNA.
false
True or False. The tryptophan operon is regulated at the levels of transcription initiation, elongation, and termination
false
true or false; A gene which is usually turned down but can be activated is under negative control.
false
true or false; If regions 1 and 2, and 3 and 4, of the trpL mRNA form stem loops, the trpE gene will be transcribed.
false
true or false; In the tryptophan (trp) operon of E. coli, binding of the small-molecule effector to the repressor protein causes a conformational change in the repressor, releasing it from the operator and making the promoter available for RNA polymerase binding.
false
true or false; all of the genes involved in control and functioning of the lac operon are inducible.
false
Mutations of the _________ of the anticodon are least likely to change the meaning of a codon
first base
Mutations of the _________ of the anticodon are least likely to change the meaning of a codon.
first base
The cap structure is:
formed by a 5' to 5' linkage of a G to the 5' end of mRNA
Which of the following is NOT true of small guide RNAs (gRNA) of the editosome complex?
gRNAs typically contain a 3'- oligo(U) extension not complementary to the target sequence.
The products of the hydrolysis of lactose by beta-galactosidase are:
galactose and glucose.
Catabolite-sensitive operons cannot be induced if _________ is present.
glucose
E. coli uses _______ in preference to lactose.
glucose
Cro protein binds to DNA via a:
helix-turn-helix.
lambda repressor protein is a _____ ; Cro is a _____ .
homodimer; homodimer
Chemical proofreading of an aminoacyl-tRNA synthetase
hydrolyzes an incorrect aminoacyl-adenylate after it binds
Which of the above involves a promoter region?
initiation of transcription
Which of the above can involve a Shine-Dalgarno sequence?
initiation of translation
beta mercaptoethanol
is a reducing agent.
A housekeeping gene is one that codes for a product that:
is expressed at a constitutive level.
The P site of the ribosome
is the site that is occupied by peptidyl-tRNA, the tRNA carrying the nascent polypeptide chain.
Translation in prokaryotes differs from translation in eukaryotes in that
it can begin before transcription is completed
Promoters are cis-acting. The promoter is considered a cis-acting site because:
it exclusively influences the expression of a gene to which the promoter is proximal.
Because the genetic code is non-overlapping, a missense mutation (from a single nucleotide change) results in the alteration of ___________, and the resulting protein has __________________
only one codon; a single amino acid change
The segment of mRNA that codes for a polypeptide chain is called a(n) _______________________
open reading frame
The Lac repressor protein binds to the:
operator in the absence of allolactose
The enzyme responsible for peptide bond formation is
peptidyl transferase
The protein product of the lacY gene is:
permease
The general name for an enzyme that dephosphorylates proteins is:
phosphatase
The splicing reactions require the breaking and re-making of
phosphodiester bonds.
The carboxy terminal domain of the largest subunit of RNA polymerase II must be _______________ on Ser-5 to target a transcript for capping.
phosphorylated
In genetics, genes or gene products that operate "in cis" are those that must be
physically linked.
Ribosomal proteins
play a stabilizing or regulatory role in translation
Transcription termination takes place closest to which one of the following?
poly(A) site
Transcription termination takes place downstream from the ______________
poly(A) site
Eukaryotic messenger RNA and hnRNA both have ___________ at their 3'-ends.
poly(A) tails
Eukaryotic messenger RNA has ___________ at their 3'-ends.
poly(A) tails
RNA interference (RNAi) is regulatory mechanism at the
post-transcriptional level.
A single _____________ can be processed to produce two or more different mRNA molecules.
pre-mRNA
A lambda particle that has incorporated its genome into the chromosome of an E. coli cell would most accurately be referred to as a:
prophage
Which of the following occurs if tryptophan levels are high?
regions 3 and 4 form a stem loop structure
The proteins that bind to codons and induce peptidyl transferase to transfer a growing polypeptide to a water molecule instead of an amino acid are called
release factors
A transcription factor that reduces gene expression is called a(n):
repressor
in negative regulation, a(n) _____________ turns off the transcription of one or more genes
repressor
The eukaryotic _____________ is made of a small and large ribonucleoprotein subunit
ribosome
In transcription, the nontemplate DNA strand, also known as the _____________ strand, has the same base sequence as the RNA molecule (except U replaces T)
sense
Which one of the following describes a tRNA molecule that specifically recognizes the amino acid "histidine" but is covalently bound (charged with) to the amino acid "serine"?
seryl-tRNAHis
Consider a individual with a mutation in the PKU gene caused by a point mutation at the 5' splice site of intron 3 that prevents the intron from being spliced out. The polypeptide made from the mutant gene is probably:
shorter than it should be, preventing it from functioning properly
A frameshift of an entire coding region of an mRNA is most likely to be caused by a
single nucleotide deletion
_________________ assemble to form a spliceosome, the splicing machine that excises introns.
snRNPs
__________________ assemble to form a spliceosome, the splicing machine that excises introns.
snRNPs
Pre-mRNA requires specific sequences for precise __________ to occur.
splicing
Amino-acyl tRNA synthetases catalyze:
the covalent attachment of amino acids to the corresponding tRNA.
Transcriptional attenuation is most accurately defined as:
the disruption of transcription following initiation, but prior to elongation through the genes of an operon.
Allolactose is formed by the action of
the lacZ gene product
Differential RNA processing may result in:
the production of two distinct proteins from a single gene.
The major determinant of ribosome structure is
the ribosomal RNAs
The wobble in pairing between the first base of the anticodon and the third base of the codon results from
the structure of the anti-codon loop
Transcription factors generally "read" DNA sequences through amino acid-nucleotide contacts in the major groove because:
there are more hydrogen bond donors and acceptors in the major groove
The main reason that mRNA transcripts are modified at the 5' and 3' ends is:
to protect the RNA from nucleolytic degradation.
Transposase acts as a ____________ acting factor
trans
RNA processing that leads to mRNAs in which exon sequences are derived from different primary transcripts is called:
trans-splicing.
Which of the above involves translocation of RNA polymerase?
transcription elongation
The peptidyl transferase activity of the 50S subunit
transfers the nascent polypeptide chain from the peptidyl-tRNA in the P site to the aminoacyl- tRNA in the A site
The movement of the ribosome from one mRNA codon to the next is called ____________
translocation
True or False. Bacterial mRNA may be monocistronic or polycistronic.
true
true or false; A polycistronic mRNA is transcribed from the lac operon when lactose is present and glucose is absent in the E. coli cell.
true
true or false; Catabolite repression requires an inducer and an activator protein.
true
true or false; If regulation of a gene involves a repressor protein, it is an inducible gene.
true
true or false; The cro protein and ë repressor proteins bind to the same sites within OR.
true
true or false; The lac repressor protein is active in the absence of lactose within the cell.
true
true or false; The lysogenic pathway results in a copy of the virus being produced each time the host cell divides.
true
true or false; The process of attenuation in the trp operon turns off the operon when it is not needed by the cell.
true
The effector molecule for the Trp repressor of the trp operon is:
tryptophan.
The ribosome must bind simultaneously to at least __________ during each cycle of amino acid addition to the C-terminus of a growing peptide chain
two tRNAs
A missense suppressor tRNA sharply increases the background mutation rate because the missense suppression
will insert incorrect amino acids when reading wild-type mRNAs.
Aminoacyl-tRNA synthetases form critical contacts
with a limited number of residues concentrated at the extremities of the tRNA
The ______________ states that codon--anticodon base pairing follows the rules of A-U or C-G at the first position, but not always at the third position.
wobble hypothesis
