RPA 9 Viruses and PCR
A drug that inhibits integrase would be effective against
A retroviral positive sense RNA virus
A drug that inhibits reverse transcriptase would provide selective toxicity against
A retroviral positive sense RNA virus
The following is picture of a PCR reaction, which well(s) contain bands of an unexpected size for a positive result?
B &D
The following is picture of a PCR reaction, which well(s) contain bands of the correct size for a positive result?
C
You take a virally infected cell culture and look under the microscope for changes in cell morphology as a result of infection. This is an example of a(n) _________________ assay.
Cytopathic Effect
In differential centrifugation virus is first centrifuged at a very rapid speed, the supernatant is removed and re-centrifuged at a slow speed. (T/F)
False
In differential centrifugation, virus is layered on a solution of sucrose that ranges in concentration from the top to the bottom of the tube. (T/F)
False
In gradient centrifugation, virus is first centrifuged at a slow speed, the supernatant is removed and re-centrifuged at a very fast speed. (T/F)
False
In gradient centrifugation, virus is first centrifuged at a very rapid speed, the supernatant is removed and re-centrifuged at a slow speed (T/F)
False
Negative sense RNA viruses will require Integrase to replicate (T/F)
False
Negative sense RNA viruses will require cellular DNA polymerase to replicate (T/F)
False
Negative sense RNA viruses will require reverse transcriptase and integrase to replicate (T/F)
False
Negative sense RNA viruses will require reverse transcriptase to replicate (T/F)
False
Non-enveloped viruses can enter the cell by membrane fusion (T/F)
False
Non-enveloped viruses can leave the cell by budding (T/F)
False
Virus stocks prepared by differential centrifugation and gradient centrifugation are equally clean. (T/F)
False
In a PCR reaction when the reaction is set to 72 oC
Taq polymerase is polymerizing
DNA viruses will require cellular DNA polymerase to replicate (T/F)
True
DNA viruses will require cellular RNA polymerase to replicate (T/F)
True
Enveloped viruses can enter the cell by endocytosis or membrane fusion (T/F)
True
Enveloped viruses can enter the cell by endocytosis or membrane fusion. (T/F)
True
Enveloped viruses can enter the cell by membrane fusion (T/F)
True
In differential centrifugation, virus is first centrifuged at a slow speed, the supernatant is removed and re-centrifuged at a very fast speed. (T/F)
True
In gradient centrifugation, virus is layered on a solution of sucrose that ranges in concentration from the top to the bottom of the tube. (T/F)
True
Negative sense RNA viruses will require both transcriptase and replicase activity to replicate (T/F)
True
Non-enveloped viruses can enter the cell by endocytosis (T/F)
True
Non-enveloped viruses usually leave the cell by lysis (T/F)
True
Virus stocks prepared by gradient centrifugation are cleaner than viral stocks prepared by differential centrifugation. (T/F)
True
Who provides the lipids in a viral envelope?
the cell
A drug that inhibits transcriptase activity of RNA dependent RNA polymerase would provide selective toxicity against
1. A negative sense RNA virus
A drug that inhibits replicase would provide selective toxicity against
1. A negative sense RNA virus 2. A non-retroviral positive sense RNA virus
Viral envelopes are made up of
1. Viral enzymes 2. Cellular Lipids
A positive sense RNA retrovirus has to package and carry in the virion which of the following enzymes?
3. Integrase 4. Reverse transcriptase
You have a negative sense RNA virus with the following genome sequence. What will the sequence of the mRNA be? Note you can ignore the promoter and transcription terminations signals. 3' UGUGUACUAUGUACUGCUAAACAUGCAUGUAGCAACCG 5'
5' ACACAUGAUACAUGACGAUUUGUACGUACAUCGUUGGC 3'
You have a retrovirus with the following genome sequence. What will the sequence of the mRNA be? Note you can ignore the promoter and transcription terminations signals. 5' UGUGUACUAUGUACUGCUAAACAUGCAUGUAGCAACCG 3'
5' UGUGUACUAUGUACUGCUAAACAUGCAUGUAGCAACCG 3'
You have a negative sense RNA virus with the following genome sequence. What will the sequence of the mRNA be? Note you can ignore the promoter and transcription terminations signals. 3' AAAGUACGUUAGUGCAUAAACAUGCAUGUACAAGGG 5'
5' UUUCAUGCAAUACGUAUUGUAGUACAUCGUUACCC 3'
A DNA virus has to package and carry in the virion which of the following enzymes?
9. No enzymes need to be packaged and carried in
Use this picture of a PCR reaction to determine which well(s) contain bands of an unexpected size for a positive result. (1115-150)
C & D
What is the next step after penetration and uncoating in a DNA virus?
Entrance into the nucleus
A non-retrovirus positive sense RNA viruses will require cellular RNA polymerase to replicate (T/F)
False
A non-retrovirus positive sense RNA viruses will require reverse transcriptase and integrase to replicate (T/F)
False
A non-retrovirus positive sense RNA viruses will require transcriptase to replicate (T/F)
False
A retrovirus will require replicase activity to replicate (T/F)
False
A retrovirus will require transcriptase activity to replicate (T/F)
False
All viruses have RNA genomes (T/F)
False
All viruses have segmented genomes (T/F)
False
Both enveloped and non-enveloped viruses can leave a cell by budding (T/F)
False
Both enveloped and non-enveloped viruses usually leave a cell by lysis (T/F)
False
DNA viruses will require reverse transcriptase to replicate (T/F)
False
DNA viruses will require transcriptase activity to replicate (T/F)
False
Enveloped viruses are equally likely to leave the cell by either lysis or budding (T/F)
False
Enveloped viruses usually leave the cell by lysis (T/F)
False
You take a virally infected cell culture, remove some of the growth medium, mix it with red blood cells, and look for the ability of the virus to bind to red blood cells causing them to clump. This is an example of a(n) _________________ assay.
Hemagglutination
You take a virally infected cell culture, add antibodies, and look for antibody binding. This is an example of a(n) _________________ assay.
Immunofluorescence
You have a negative sense RNA virus with the following genome sequence. 3' GGUACGGGCUACAUGCAUAGGUAUGCAUGUACAUACG 5' What will be the sequence of the first 2 amino acids of the protein that this genome produces?
MP
You have a negative sense RNA virus with the following genome sequence. 3' GGGGUACUCACCUACUGCAUAAACAUGCAUGUACAAAAA 5' What will be the sequence of the first 2 amino acids of the protein that this genome produces?
MS
You have a negative sense RNA virus with the following genome sequence. 3' AAAGUACUGCACUACUGCAUAAACAUGCAUGUACAAGGG 5' What will be the sequence of the first 2 amino acids of the protein that this genome produces?
MT
A non-retrovirus positive sense RNA virus has to package and carry in the virion which of the following enzymes?
No enzymes need to be packaged and carried in
In a DNA virus, what step follows production of viral proteins?
Packaging of viral genome into capsids
In a positive sense RNA retrovirus, what step follows production of viral proteins?
Packaging of viral genomes into capsids
What is the next step after penetration and uncoating in a retroviral positive sense RNA virus?
Production of DNA from viral RNA
What is the next step after penetration and uncoating in a negative sense RNA virus?
Production of viral mRNA
In a negative sense RNA virus, what step follows production of viral proteins?
Production of viral replicative form
In a non-retroviral positive sense RNA virus, what step follows production of viral proteins?
Production of viral replicative form
In the following image of an IFA assay of virally infected tissue culture, is this virus more likely to be an RNA virus or a DNA virus? (green center with brown surrounding)
RNA
In the given image of an IFA assay of virally infected tissue culture, is this virus more likely to be an RNA virus or a DNA virus? (entirely green image)
RNA
This is an image of an IFA assay of virally infected tissue culture, is this virus more likely to be an RNA virus or a DNA virus? (Mostly red colored image)
RNA
A negative sense RNA virus has to package and carry in the virion which of the following enzymes?
RNA dependant RNA polymerase
In a PCR reaction when the reaction is set to 50 oC
The primers are annealing
In a PCR reaction when the reaction is set to 52 oC
The primers are annealing
What is the next step after penetration and uncoating in a non-retroviral positive sense RNA virus?
Translation of viral proteins
A non-retrovirus positive sense RNA viruses will require replicase to replicate (T/F)
True
A retrovirus will require Reverse transcriptase to replicate (T/F)
True
A retrovirus will require both transcriptase and replicase activity to replicate (T/F)
True
A retrovirus will require integrase to replicate (T/F)
True
A retrovirus will require reverse transcriptase and integrase to replicate (T/F)
True
All viruses have a protein coat (T/F)
True
All viruses have nucleic acids (T/F)
True
Both enveloped and non-enveloped viruses can enter a cell by endocytosis (T/F)
True
You are performing an ELISA test to determine if a cow has Bovine Parvo virus infection. You realize at the end that you forgot to add the cow's serum to the ELISA before adding the fluorescently labeled goat anti bovine antibody antibodies. Other than you performed all the other steps correctly, which of the following do you think most accurately describes the outcome of forgetting this step?
You may get a false negative because the fluorescently labeled goat anti bovine antibody antibodies will have nothing to bind to
Who provides the envelope proteins in a viral envelope?
the virus
Enveloped viruses can enter the cell by endocytosis (T/F)
true
