Sapling Ch. 15 HW

Each amino acid in a protein is encoded by a group of three nucleotides known as a codon. Use the codon table to match mRNA codons and the resulting amino acid sequence.

AUG = met CCA = pro UGC = cys UUC = phe UUG = leu

What is the reason scientists think DNA was selected over RNA as the most common genetic material?

DNA is more stable than RNA

Using the partial sequence of chimpanzee DNA below, identify the total number of ORFs. 5' ACATGTTGGGGATGCCTAGTTAAAT 3' 3' TGTACAACCCCTACGGATCAATTTA 5'

1

Identify the general features of an amino acid.

Orange ball = R group Gray ball below orange ball = alpha-carbon atom Blue ball with 3 H attached = amino group Gray ball with 2 O attached = carboxyl group

Match each definition and example to the level of protein structure.

Primary = polypeptide chain, N-terminal to C-terminal sequence Secondary = local hydrogen-bond pattern, alpha-helices Tertiary = three-dimensional structure, zinc finger domain Quaternary structure = multiple-polypeptide interactions, microtubule complex

Which part is responsible for the unique properties of each amino acid?

R group

The phrases or terms below describe different fundamental processes of nuclei acids. Sort each phrase or term as relating to replication, transcription, or translation.

Replication: both DNA strands are duplicated, described as semi-conservative, DNA polymerase Transcription: single DNA strand is used to produce mRNA Translation: amino acids added to peptide chain, requires RNA, ribosome

What evidence supports the hypothesis that RNA was the genetic material early in evolutionary history?

Some viruses have RNA genomes and RNA can catalyze enzymatic reactions

Imagine that you discover three different bacterial species on a meteorite. Each species contains genetic material that is not DNA, but the genetic material of each species contains four bases. Each species has a different number of amino acids. Use the total number of amino acids per species to determine the minimum codon length for each species.

Species A: 2 amino acids, codon length = 1 Species B: 7 amino acids, codon length = 2 Species C: 83 amino acids, codon length = 4

Using the codon table below, what conclusions can be drawn about the genetic code?

Three codons do not code for amino acids and many amino acids are encoded by multiple codons.

The codon table identifies the amino acid sequence that can be translated from a human mRNA sequence. This chart can also be used to identify amino acid sequences for other organisms. Select the organisms that use the codon assignments shown in the codon table.

Staphylococcus aureus, poison ivy, sea bass, turtle, cat

Place the events that take place during translation and protein synthesis in the correct order.

1. The mRNA strand binds with the smaller subunit of the ribosome, which moves along the mRNA. 2. The anticodon of a tRNA molecule carrying an amino acid matches with the complementary codon on the mRNA strand. 3. New amino acids are added to the polypeptide chain by the ribosome. 4. The tRNA molecules that have contributed amino acids to the protein chain leave the ribosome.

Protein synthesis is a complicated process involving DNA being transcribed to RNA, which is then translated into amino acids. Complete the DNA-to-amino acid table for three consecutive codons with the appropriate nucleotides and amino acids using a codon table. Nucleotide and amino acid options can be used multiple times or not at all.

5'-3' DNA strand: TTA 3'-5' DNA strand: AAT Transcribed mRNA: UUA tRNA antiocodon: AAU Amino acid: leucine 5'-3' DNA strand: GAG 3'-5' DNA strand: CTC Transcribed mRNA: GAG tRNA antiocodon: CUC Amino acid: glutamic acid 5'-3' DNA strand: CGC 3'-5' DNA strand: GCG Transcribed mRNA: CGC tRNA antiocodon: GCG Amino acid: arginine

Basepair the codons to the anticodon, taking the wobble hypothesis into account. There may be more than one answer choice per anticodon. Not all answer choices will be used.

Anticodon: 3' GCG 5' Codons: 5' CGC 3' and 5' CGU 3' Anticodon: 3' CAC 5' Codon: 5' GUG 3' Anticodon: 3' AGG 5' Codons: 5' UCU 3' and 5' UCC 3'

Use the depicted biochemical pathway to complete the predicted growth table for each mutant on minimal media plus the specified added supplement, where + indicates growth and 0 indicates no growth. Arginine ---(enzyme A)---> ornithine ---(enzyme B)---> glutamate semialdehyde ---(enzyme C)---> glutamate

Mutant strain A: 0, +, +, + Mutant strain B: 0, 0, +, + Mutant strain C: 0, 0, 0, +

Cells produce a variety of different RNA molecules. Transfer RNAs (tRNAs), messenger RNAs (mRNAs), and ribosomal RNAs (rRNAs) are some of the most common RNA molecules found in a cell. Classify the following statements as describing eukaryotic tRNAs, mRNAs, or rRNAs.

tRNAs: have a distinct cloverleaf-like structure, are attached to specific amino acids mRNAs: protected by a poly-A tail, carry instructions required to generate a protein rRNAs: transcribed in the nucleolus and associates with proteins, catalyze the formation of peptide bonds