AGRY 320 Exam 1

Please find the three basic steps of using recombinant DNA for protein expression, then place them in the correct order, 1,2,3. A. Construct recombinant DNA (rDNA) plasmid. B. Introduce rDNA into bacteria. C. Design a centrifugation-based protein filter to isolate the target protein. D. Use bacteria to express human protein. E. Remove the 5' cap and 3' Poly A tail from the mRNA.

1. A. Construct recombinant DNA (rDNA) plasmid. 2. B. Introduce rDNA into bacteria. 3. D. Use bacteria to express human protein.

We examine quantitative real time PCR experiment for the comparison of transcript levels of gene A in two tissue types: muscle and heart. We observe that PCR products of mRNA in muscle took 24 cycles to get to our targeted abundance level. To get to the same abundance level, it took 30 PCR cycles for the heart sample. Please use this information to answer the following questions. 1. Before we started the amplification process, which sample had more copies of mRNA, muscle or heart? A. muscle B. heart 2. Can we use the results stated above to determine the exact copy number of the resulting transcripts in both samples? A. yes B. no 3. Can we use the results of this to experiment determine the relative copy number of transcripts between these two samples? A. yes B. no

1. A. muscle 2. B. no 3. A. yes

Untranslated regions (UTR) are located at (1) of the (2) of genes. They are (3) but not (4). 1. A. only the 5' end B. both the 5' and 3' end C. only the 3' end D. neither the 5' or 3' end 2. A. promotors B. non- coding sequences C. coding sequences 3. A. translated B. transcribed 4. A. translated B. transcribed

1. B. both the 5' and 3' end 2. C. coding sequences 3. B. transcribed 4. A. translated

Can you put the following steps back in the correct order?, so we can get working on creating the sequence map 1,2,3,4? A. make a library of cloned fragments B. overlap sequence reads C. Cut many genome copies into random fragments D. Sequence each clone

1. C. cut many genome copies into random fragments 2. A. make a library of cloned fragments 3. D. sequence each clone 4. B. overlap sequence reads

What are the two main sources of mutations?

1. DNA polymerase errors spontaneous mutations 2. Mutagens- agents that enter the cell and cause changes

So, please indicate the correct PCR steps in the correct order below 1,2,3,4. A. Centrifugation B. Repeat the previous step(s) 25-30 times. C. Translation D. Replication E. Ligation F. Dimerization G. Elongation H. Transcription I. Denaturation J. Annealing

1. I. Denaturation 2. J. Annealing 3. G. Elongation 4. B. Repeat the previous step(s) 25-30 times

Fill in the following sentences according to molecular genetics principles you learned: Nucleotide A pairs with ____1____via ____2____ ____3___bonds. Nucleotide C pairs with ___4___via ____5____ ____6___bonds.

1. T 2. 2 3. hydrogen 4. G 5. 3 6. hydrogen

What are the three stages of transcription found in both eukaryotes and prokaryotes?

1. initiation 2. elongation 3. termination

What are the three types of point mutations?

1. substitution- alteration of the identity of a single base pair 2. insertion- the addition of one base pair 3. deletion- the removal of a single base pair

What is: Genes from one cell are carried to another cell within the genome of a virus. When the virus infects the second cell, the genes from the first cell are incorporated into the second cell's DNA? 1. Conjunction 2. Transduction 3. Disjunction 4. Signal transduction 5. Conjugation 6. Translocation 7. Non-disjunction 8.Transformation

2. Transduction

We start out with 10 DNA molecules. After 9 PCR cycles, how many DNA molecules do we have?

5,120 2^9 x 10= 5,120

What is: the transfer of DNA between bacterial cells by direct contact or a bridge-like connection between two cells? 1. Conjunction 2. Transduction 3. Disjunction 4. Signal transduction 5. Conjugation 6. Translocation 7. Non-disjunction 8.Transformation

5. Conjugation

What is: the partial genome transfer by DNA uptake? 1. Conjunction 2. Transduction 3. Disjunction 4. Signal transduction 5. Conjugation 6. Translocation 7. Non-disjunction 8.Transformation

8.Transformation

Which statement(s) is(are) false? A. DNA polymerase can mistakenly insert or delete bases B. Frameshifts are neutral changes in the coding sequence C. Frameshifts are non-neutral changes in the coding sequence D. DNA polymerase can only mistakenly substitute bases

B. Frameshifts are neutral changes in the coding sequence D. DNA polymerase can only mistakenly substitute bases

Which of the following is an example of a cis-acting element? A. B-galactosidase B. Operator site C. LacI repressor protein D. Lactose E. Permease

B. Operator site

In RT-PCR, we use a particular enzyme. What is that enzyme? A. cDNAse B. Reverse transcriptase C. DNAse D. RNAse

B. reverse transcriptase

In ______ genetics approach we identify the responsible ______ through evaluation of genotypes in a population of variants. A. Forward - gene B. Reverse - trait C. Forward - trait D. Reverse - gene

D. Reverse - gene genotypes- phenotypes

A bacteriophage is a _______ that infects _______ by _______ and then _______. A. Bacterium - another bacterium - conjugation - injecting the genetic materials B. Bacterium - another bacterium - transformation - injecting shredded DNA C. Bacterium - another bacterium - binding to the membrane - injecting the genetic materials D. Virus - the bacterium - binding to the membrane - injecting the genetic materials E. Bacterium - another bacterium - endocytosis - bursting open the cell F. Virus - another virus - binding to the membrane - injecting thegenetic materials

D. Virus - the bacterium - binding to the membrane - injecting the genetic materials

DNA is an example of what level of hierarchical structure? A. primary B. secondary C. quaternary D. tertiary

D. tertiary

Please indicate which of the following elements of the regulatory system of the lac operon is a cis-acting element. A. Lactose. B. LacI repressor protein. C. Beta-galactosidase. D. Permease. E. Operator site.

E. Operator site.

The genome of Arabidopsis contains over 25 000 genes. It is possible to use PCR to make many copies of just one very small region of this genome (for example, 500 bp). What component of a PCR reaction gives it specificity? a. probes b. nucleotides c. thermostable DNA polymerase d. oligonucleotide primers e. MgCl2

d. oligonucleotide primers In a PCR reaction, primers can match to the target sequence allowing the synthesis of the target region.

What is a missense/non-synonymous mutation?

missense/non-synonymous mutation- a substitution which results in a change in the amino acid sequence conservative- change to an aa with a similar R group non-conservative- change to an aa with a different R group

What type of genetics is this: a field of study that focuses on DNA and gene action within and between cells

molecular genetics

RNA interference (RNAi) is a natural process by which cells suppress the activity of specific genes by targeting and degrading mRNA. One way RNAi has been harnessed by agricultural scientists is to protect plants from pest attacks on the roots of corn plants. Choose the answer below that correctly describes the steps in the RNAi process that eventually result in degradation of the target mRNA. A. 1. The protein Dicer recognizes double-stranded RNA (dsRNA) 2. Dicer cuts up the dsRNA into small segments (still double-stranded). 3. RNA-Induced silencing complex (RISC) separates the two strands of the small segments. 4. RISC carries one strand of the small segment. 5. RISC uses that one strand to bind a complementary mRNA transcript. 6. Once the anti-sense strand is bound, RISC degrades the target mRNA. B. 1. The protein Dicer recognizes double-stranded RNA (dsRNA). 2. Dicer cuts up the dsRNA into small segments (still double-stranded). 3. RNAi polymerase (RNAi poly) separates the two strands of the small segments. 4. RNAi poly carries one strand of the small segment. 5. RNAi poly uses that one strand to bind to a complementary mRNA transcript. 6. Once the anti-sense strand is bound, RNAi poly degrades the target mRNA.

A. 1. The protein Dicer recognizes double-stranded RNA (dsRNA) 2. Dicer cuts up the dsRNA into small segments (still double-stranded). 3. RNA-Induced silencing complex (RISC) separates the two strands of the small segments. 4. RISC carries one strand of the small segment. 5. RISC uses that one strand to bind a complementary mRNA transcript. 6. Once the anti-sense strand is bound, RISC degrades the target mRNA.

How large (in bp) is the entire human genome? A. 3 billion bp. B. Scientists really have no clue how large the human genome is. C. 2 billion bp. D. 1 billion bp. E. 5 billion bp. F. 4 billion bp.

A. 3 billion bp

What type of transcriptional regulation happens in the Lac Operon? A. Both negative and positive regulation. B. Factorial regulation. C. Allosteric regulation. D. Negative regulation. E. Positive regulation. F. DNA methylation.

A. Both negative and positive regulation.

What was the contribution of the Hershey and Chase experiment to genetics? A. By radioactively labeling DNA and protein molecules in phage and bacteria, then observing the results, they proved that DNA and not the protein carries the genetic information. B. By studying genetic mutations in the mold species Neurospora crassa, they proved that each gene makes one and only one protein product, or enzyme. C. By studying diseases in mice, they concluded that non-disease causing bacteria can become disease causing when its DNA is transformed by DNA from disease-causing bacteria. D. By inducing mutations in Drosophila melanogaster (fruit flies) and observing the proportions of progeny, they proved that genes are carried on chromosomes and are the basis of inheritance

A. By radioactively labeling DNA and protein molecules in phage and bacteria, then observing the results, they proved that DNA and not the protein carries the genetic information.

Regulation of gene expression in eukaryotes can occur at which of the following stages or levels? A. Chromatin Structure B. Post- transcription C. Translation D. Post- translation E. Epigenetic F. Transcription G. Post- degradation

A. Chromatin Structure B. Post- transcription C. Translation D. Post- translation E. Epigenetic F. Transcription

Bacterial cells have: (check all that apply) A. Circular Genome B. Diploid DNA C. Extra DNA (plasmids) D. Nucleus E. Haploid DNA F. No organelles G. Linear genome H. No extra DNA outside of the nuclear DNA I. No nucleus J. Organelles

A. Circular genome C. Extra DNA (plasmids) E. Haploid DNA F. No organelles I. No nucleus

In ______ genetics approach we identify the responsible ______ through evaluation of phenotypes in a population of variants. A. Forward - gene B. Reverse - trait C. Forward - trait D. Reverse - gene

A. Forward - gene phenotypes - genotypes

You are a graduate student in a Purdue genetics lab. Your assignment is to identify genes responsible for resistance to soybean stem and root rot. You cross a resistant soybean line with a susceptible line; the progeny constitutes a mapping population. You then evaluate the resistance of each individual in the population and analyze the genotypic data. The result is you are able to successfully map the gene to a very small region of the soybean genome. What genetic strategy did you use? A. Forward genetics B. Reverse genetics C. Both forward and reverse genetics D. Neither forward nor reverse genetics

A. Forward genetics You started from evaluating the resistance of the mapping population and end up with finding the responsible gene, this is forward genetics

We analyzed mutations in the genes that produce GAL80 and GAL3. What did we discover about the action of GAL80 and GAL3 on GAL gene expression? A. GAL80 inhibits expression of the GAL gene, and GAL3 promotes the expression of the GAL gene. B. GAL80 promotes expression of the GAL gene, and GAL3 inhibits the expression of the GAL gene. C. Both GAL80 and GAL3 promote the expression of the GAL gene. D. Neither GAL80 nor GAL3 affect the expression of the GAL gene. E. Both GAL80 and GAL3 inhibit the expression of the GAL gene.

A. GAL80 inhibits expression of the GAL gene, and GAL3 promotes the expression of the GAL gene.

The tails on the histones that make up the chromatin can be altered to help activate or deactivate genes. Please indicate below specifically which histone tail modification leads to: activation of genes? A. Histone acetylation. B. None of these answers are correct. C. Histone phosphorylation. D. Histone deacetylation. E. Histone dephosphorylation.

A. Histone acetylation. Activated genes= Acetylated histones Acetylation, or addition of an acetyl group to the end of a Lysine amino acid that protrudes from a histone, is a reversible reaction. If acetyl groups are found on histone residues, they neutralize the positive charge of lysine residues and reduce the interaction of the histone tails with the negatively charged DNA backbone. This results in more open chromatin. Acetylation also makes it easier for regulatory proteins to bind to the DNA.

What type of point mutation occurred in the following sequence? Original sequence: AATGCCAATT Mutated sequence: AATGCC<C>AATT A. Insertion B. Chuck Norris C. Transversion substitution D. Transition substitution E. Missing-pair mutation F. Deletion G. Translocation

A. Insertion - the addition of one base pair

Please indicate which of the following elements of the regulatory system of the lac operon is a trans-acting element. A. LacI repressor protein. B. Permease. C. Operator site. D. Beta-galactosidase. E. Lactose.

A. LacI repressor protein.

In which plant species were transposable elements first discovered? A. Maize B. Rice C. Barley D. Sorghum

A. Maize

What is: vector? A. Non-essential "accessory" chromosomes, such as plasmids or modified bacterial viruses. B. A process used to create copies of recombinant DNA. C. A sample of DNA molecules containing a gene of interest. D. DNA molecules formed by fusion of donor DNA fragment and vectors.

A. Non-essential "accessory" chromosomes, such as plasmids or modified bacterial viruses.

Why did Rosalind Franklin not share the stage with Crick and Watson for the Nobel Prize? A. She was not alive at the time of the award. B. Although her X-Ray image did inspire Watson and Crick and guided them towards their discovery, she was not recognized as a primary contributor to their publication, and thus was not eligible for consideration for the prize. C. She woke up deathly ill on the day that the Prize was awarded. D. The committee's rules did not allow them to award the same prize to multiple researchers from different institutions.

A. She was not alive at the time of the award.

You have the following sequence reads from a whole genome shotgun (WGS) sequencing project: Read1: TTCAGATGCG Read2: ATGCGATCTGTG Read3: TCTGTGACTG Which of the following sequence contig can be generated from the above alignment? A. TTCAGATGCGATCTGTGACTG B. TTCAGATGCGATGCGATCTGTGTCTGTGACTG C. Phe-Arg-Cys-Asp-Leu-stop

A. TTCAGATGCGATCTGTGACTG For this question, we read the bases from left to right, and the overlap bases are read only once.

Which of the following are ingredients for PCR of a cancer gene? A. Thermostable DNA polymerase B. Uracil (U) C. Buffer (Mg++, etc.) D. Template/target DNA E. dNTP (dATP, dCTP, dGTP, dTTP) F. Oligonucleotide primers G. Cyclic AMP

A. Thermostable DNA polymerase C. Buffer (Mg++, etc.) D. Template/target DNA E. dNTP (dATP, dCTP, dGTP, dTTP) F. Oligonucleotide primers

In a PCR reaction, if we use a primer shorter than 18-20 bp, it causes: A. lack of specificity. B. the PCR reaction to cease. PCR will not work at all if the primer is shorter or longer than 18-20 bp C. an increase in the overall rate of the reaction. D. reduced annealing efficiency. E. increased annealing efficiency

A. lack of specificity.

An autonomous transposable element: A. requires no other elements for its mobility. B. requires one additional element(s) for its mobility. C. is only found in corn (maize). D. is found only in plants. E. None of the answer options are correct.

A. requires no other elements for its mobility. Autonomous elements encode transposase necessary for their own movement, so it does not require other elements for its mobility.

The Guanine (G) content of an organism's DNA is 0.30. Following Chargaff's rule, what is the content of the other bases within this organism? G= .30 A= ? C= ? T= ?

A= .20 C= .30 T= .20 A+G = C+T A=T C=G

Which of the following statements is/are TRUE? A. Post-transcriptional modification of the 3' ends of eukaryotic mRNA occurs prior to splicing and outside the nucleus. B. The molecule Poly-A polymerase is responsible for addition of the Poly-A sequence to the end of an mRNA molecule. C. Post-transcriptional modification of the 3' ends of eukaryotic mRNA is known as polyadenylation. D. RNA polymerase does not require primer to initiate the process of assembly of nucleotide triphosphates. This is in contrast to DNA replication, where primer is required at initiation. E. The addition of a Poly-A tail on the end of a transcript happens because of the transcription of the Poly-T signal from the corresponding gene. F. Post-transcriptional modification of the 3' ends of eukaryotic mRNA occurs prior to splicing and inside the nucleus. G. RNA polymerase requires a primer to initiate the assembly of nucleotide triphosphates. This is identical to the requirement for DNA replication.

B,C,D,F B. The molecule Poly-A polymerase is responsible for addition of the Poly-A sequence to the end of an mRNA molecule. C. Post-transcriptional modification of the 3' ends of eukaryotic mRNA is known as polyadenylation. D. RNA polymerase does not require primer to initiate the process of assembly of nucleotide triphosphates. This is in contrast to DNA replication, where primer is required at initiation. F. Post-transcriptional modification of the 3' ends of eukaryotic mRNA occurs prior to splicing and inside the nucleus.

A sample of normal double-stranded DNA was found to have an adenine content of 24%. What is the expected proportion of cytosine? A. 24% B. 26% C. 48% D. 52% E. 76%

B. 26% A+G= C+T

What is: a repressor? A. A region of nucleotide sequences that includes all bases from start codon to stop codon. B. A DNA-binding protein that regulates the expression of one or more genes by binding to the operator and blocking the movement of RNA polymerase, thus preventing transcription of the genes. C. A region of DNA to which RNA polymerase binds to initiate the transcription of a particular gene. Typically located upstream (towards the 5' region of the sense strand) of the gene. D. A DNA-binding protein that regulates one or more genes by permitting and/or increasing the rate of transcription. E. A protein that alters the supercoiled form of a DNA molecule. F. The binding sites of a repressor. G. A protein that separates double-stranded DNA into single strands, allowing each strand to be copied.

B. A DNA-binding protein that regulates the expression of one or more genes by binding to the operator and blocking the movement of RNA polymerase, thus preventing transcription of the genes.

What is: DNA Cloning? A. Non-essential "accessory" chromosomes, such as plasmids or modified bacterial viruses. B. A process used to create copies of recombinant DNA. C. A sample of DNA molecules containing a gene of interest. D. DNA molecules formed by fusion of donor DNA fragment and vectors.

B. A process used to create copies of recombinant DNA.

In the context of DNA sequencing, what is a reference genome? A. A series of locations of anchor genes, notated in centi-Morgans. The sequence reads are then randomly placed between these anchor genes, and the likelihood of the random placement being the actual order is calculated. B. A representative example of a species' set of genes, to which segment reads are aligned by bioinformatics software. C. A database of all the known possible types and locations of mutations along an entire genome. It is very useful when you are doing sequencing, as you can compare it to what is already discovered, and thus determine if you have found a yet-undiscovered variant. D. Much like a reference encyclopedia, a reference genome is a book on a library shelf, but instead of words it contains the entire sequence of a genome. It also has one-page descriptions of genes. So when you are doing a sequence project, you use this as a reference to check if your sequence fragment is contained within a gene.

B. A representative example of a species' set of genes, to which segment reads are aligned by bioinformatics software.

A mutation does not affect the length of a gene but results in an abnormally short protein. The mutation is most likely of a type called: A. Silent. B. Nonsense. C. Missense. D. Frameshift. E. Deletion.

B. Nonsense.

The bacterial Lac operon is an example of________? A. Monocistronic mRNA B. Polycistronic mRNA C. Alternative splicing D. None of the above answers is correct

B. Polycistronic mRNA

Consider the products of both DNA replication and transcription. Choose which of the following statements below is TRUE. A. Both replication and transcription produce double-stranded molecules, dsDNA from replication and dsRNA from transcription. B. Replication produces double-stranded DNA (dsDNA) while transcription produces single stranded RNA (ssRNA). C. Both replication and transcription produce single-stranded molecules, ssDNA from replication and ssRNA from transcription.

B. Replication produces double-stranded DNA (dsDNA) while transcription produces single stranded RNA (ssRNA).

The authors of a paper report that the WRINKLE gene in the plant Arabidopsis is an important transcriptional factor in the biosynthesis of fatty acid in Arabidopsis. High expression of this gene results in high fatty acid accumulation in Arabidopsis seeds. You want to know if a soybean gene with similar DNA and protein sequence (i.e. a homolog) has the same function or not. So you knock out the soybean homolog gene using interfering RNA (RNAi). You discover that the fatty acid content in RNAi mutant soybean seeds is significantly lower than the wild type soybean seeds. What genetic strategy did you use to identify and examine the soybean? A. Forward genetics B. Reverse Genetics C. Both forward and reverse genetics

B. Reverse Genetics You start from a homolog gene and find that this gene have effect on fatty acid accumulation in soybean seeds, this is reverse genetics

In lecture on Friday, Dr. Anderson shared a publication of his research that gave the first report of a multiplex Reverse Transcriptase Polymerase Chain Reaction (RT-PCR)-based assay, in context of detecting viruses in wheat. Which of the following is the correct description of RT-PCR? A. Starting with double-stranded RNA, we can create complementary DNA (cDNA). B. Starting with mRNA, we can create complementary DNA (cDNA). C. Starting with tRNA, we can create complementary DNA (cDNA). D. None of the answer choices correctly describe RT-PCR. E. Starting with protein, we can create complementary DNA (cDNA).

B. Starting with mRNA, we can create complementary DNA (cDNA).

Transcription occurs on __________. A. At the beginning of the organism's life--the first cell division in embryotic stage--the transcription mechanism randomly chooses one of the DNA strands. For the remainder of the organism's life, transcription only occurs on that same strand of every cell. B. both strands of the DNA. C. only the 3' to 5' strand of DNA. D. only the 5' to 3' strand of DNA. E. one strand only, but which one specifically is different for every organism.

B. both strands of the DNA.

A key characteristic of bacterial RNAs that is not observed with eukaryotic RNAs is that: A. transcription generates RNAs that contain both introns and exons. B. transcription can occur in the same cellular region as translation. C. a prerequisite for translation initiation is RNA processing. D. the genetic code used by bacteria is different from other organisms. E. bacterial RNAs are generated as double stranded.

B. transcription can occur in the same cellular region as translation.

What is: a promoter? A. A region of nucleotide sequences that includes all bases from start codon to stop codon. B. A DNA-binding protein that regulates the expression of one or more genes by binding to the operator and blocking the movement of RNA polymerase, thus preventing transcription of the genes. C. A region of DNA to which RNA polymerase binds to initiate the transcription of a particular gene. Typically located upstream (towards the 5' region of the sense strand) of the gene. D. A DNA-binding protein that regulates one or more genes by permitting and/or increasing the rate of transcription. E. A protein that alters the supercoiled form of a DNA molecule. F. The binding sites of a repressor. G. A protein that separates double-stranded DNA into single strands, allowing each strand to be copied.

C. A region of DNA to which RNA polymerase binds to initiate the transcription of a particular gene. Typically located upstream (towards the 5' region of the sense strand) of the gene.

What is: Donor DNA? A. Non-essential "accessory" chromosomes, such as plasmids or modified bacterial viruses. B. A process used to create copies of recombinant DNA. C. A sample of DNA molecules containing a gene of interest. D. DNA molecules formed by fusion of donor DNA fragment and vectors.

C. A sample of DNA molecules containing a gene of interest.

Which of the following scientists discovered the Ac-Ds transposable elements in maize? A. Marcus Rhoades B. Rollins Emerson C. Barbara McClintock D. George Beadle E. Chuck Norris

C. Barbara McClintock

What was the contribution of Rosalind Franklin to the discovery of the double-helix structure of DNA? A. Franklin worked with Watson and Crick as part of an official collaboration within the same laboratory system. They openly shared resources and ideas, and she had asked Watson and Crick to take a look at her photographs, after which all three came up with the double-helix model. B. She managed the lab in which Watson and Crick made their discovery, and helped them by offering suggestions when their investigation had stalled. C. Her X-ray image helped Watson and Crick to understand the structure better and guided them towards determining the correct physical and chemical structure. D. Franklin was the mentoring professor for Watson, and an unofficial mentor for Crick. She provided them the funding for their research and oversight of their work.

C. Her X-ray image helped Watson and Crick to understand the structure better and guided them towards determining the correct physical and chemical structure.

The lac repressor protein controls expression of the lac operon by binding to the: A. Lac structural genes to repress expression. B. LacZ and lacY genes only to repress expression. C. Lac operator site to repress expression. D. Lac promoter site to repress expression. E. All of the answer options are correct.

C. Lac operator site to repress expression.

Which of the following is an example of a trans-acting element? A. B-galactosidase B. Operator site C. LacI repressor protein D. Lactose E. Permease

C. LacI repressor protein

If the DNA sequence below were transcribed and translated from left to right (bottom strand is the template strand), what would the amino acid sequence be? 5` ATGTTGCAAAAG 3` 3` TACAACGTTTTC 5` A. Tyr-Asn-Val-Phe B. Met-Leu-Gln-Lys C. Met-Leu-Glu-His D. Leu-Val-His-Met E. Glu-Asn-Val-Val

C. Met-Leu-Glu-His

Which three elements make up DNA nucleotides? A.Phosphate group, nitrogenous base, and oxygenated purine. B. Nitrogenous base, sugar group, and phosphodiester. C. Phosphate group, sugar group, and nitrogenous base. D. Nucleoside, sugar group, and base group.

C. Phosphate group, sugar group, and nitrogenous base.

In Eukaryotic genes, which of the following is the regulatory region? A. Poly A tail B. 5' Cap C. Promoter D. Introns E. Transcription factors F. Exons

C. Promoter

The Meselson-Stahl experiments proved that DNA replication follows a ____________ replication model. A. Repetitive B. Duplicative C. Semi-conservative D. Conservative E. Dispersive

C. Semi-conservative 1 new strand and 1 parent strand

As you learned in previous lectures, the physiologically regulated step in the bacterial lac operon is when the transcriptional regulator binds the DNA. The eukaryotic system is different, and can be understood using the model of GAL. What is the physiologically regulated step in eukaryotic transcription, specifically the GAL model? A. The inducer molecule is imported to the active site on the relevant strand. B. None of these answers are correct. C. The actions of the transcriptional regulator, specifically the activation-domain. D. When the transcriptional regulator binds DNA. E. The end product affects an earlier step in the pathway (i.e. product feedback).

C. The actions of the transcriptional regulator, specifically the activation-domain.

Which of the following is/are responsible for the differences in genome size in grasses, such as barley, rice, maize and sorghum? A. The size of the plant B. The number of the chromosomes C. The percentage of the transposable elements in the genome D. The length of the life cycle

C. The percentage of the transposable elements in the genome

In RT-PCR, a particular primer is used. What is that primer, and why is it used? A. RT-PCR does not need primers. B. The primer is oligoA (AAAAA). It is used because it binds to the oligo T sequence of mRNA. C. The primer is oligoT (TTTTT). It is used because it binds to the oligo A sequence of mRNA. D. We can use any primer we want. The result will be equal efficiency no matter the primer.

C. The primer is oligoT (TTTTT). It is used because it binds to the oligo A sequence of mRNA.

What type of point mutation occurred in the following sequence? Original sequence: AATGCC<A>ATT Mutated sequence: AATGCC<C>ATT A. Insertion B. Chuck Norris C. Transversion substitution D. Transition substitution E. Missing-pair mutation F. Deletion G. Translocation

C. Transversion substitution -the replacement of a base by a base of the opposite chemical category (A-C or G-T)

The complexity of lagging strand DNA replication is necessary because: A. there is room for only a single DNA polymerase III enzyme in the replisome. B. the helicase can only unwind double-helical DNA slowly. C. as polymerization occurs only in the 5' to 3' direction, the lagging strand must be synthesized in consecutive small fragments. D. the RNA primase works better on the leading strand DNA. E. DNA polymerase I is more often associated with the lagging strand

C. as polymerization occurs only in the 5' to 3' direction, the lagging strand must be synthesized in consecutive small fragments.

What was the contribution of Griffith's experiment to genetics? A. by inducing mutations in Drosophila melanogaster (fruit flies) and observing the proportions of progeny, they proved that genes are carried on chromosomes and are the basis of inheritance B. by radioactively labeling DNA and protein molecules in phage and bacteria, they proved that DNA and not the protein carries the genetic information. C. by studying diseases in mice, they concluded that non-disease causing bacteria can become disease causing when its DNA is transformed by DNA from disease-causing bacteria. D. by studying genetic mutations in the mold species Neurospora crassa, they proved that each gene makes one and only one protein product, or enzyme.

C. by studying diseases in mice, they concluded that non-disease causing bacteria can become disease causing when its DNA is transformed by DNA from disease-causing bacteria.

In what cellular compartment are introns removed from pre-mRNA to make mature mRNA? A. cytoplasm B. endoplasmic reticulum C. nucleus D. mitochondria E. Golgi apparatus

C. nucleus

The -10 and the -35 boxes found in bacterial gene promoters function to: A. recruit DNA polymerase activity for DNA replication before cell division. B. activate transcription at the -35 region of a gene. C. orient RNA polymerase at a gene's transcription start site. D. identify the boundaries between introns and exons. E. identify the boundaries for DNA unwinding during transcription.

C. orient RNA polymerase at a gene's transcription start site

Some genes in __________ are polycistronic (multiple proteins are translated from one RNA transcript). A. eukaryotes only B. prokaryotes, eukaryotes, and fungi. C. prokaryotes only D. both prokaryotes and eukaryotes

C. prokaryotes only

The spliceosome functions to: A. insert introns into mRNA sequences before translation. B. create noncoding sequences in genes to enhance gene stability. C. remove noncoding introns from transcribed RNAs. D. control transcription, ensuring that only exons are transcribed. E. inhibit transcription of noncoding DNA regions.

C. remove noncoding introns from transcribed RNAs.

What is: an activator? A. A region of nucleotide sequences that includes all bases from start codon to stop codon. B. A DNA-binding protein that regulates the expression of one or more genes by binding to the operator and blocking the movement of RNA polymerase, thus preventing transcription of the genes. C. A region of DNA to which RNA polymerase binds to initiate the transcription of a particular gene. Typically located upstream (towards the 5' region of the sense strand) of the gene. D. A DNA-binding protein that regulates one or more genes by permitting and/or increasing the rate of transcription. E. A protein that alters the supercoiled form of a DNA molecule. F. The binding sites of a repressor. G. A protein that separates double-stranded DNA into single strands, allowing each strand to be copied.

D. A DNA-binding protein that regulates one or more genes by permitting and/or increasing the rate of transcription.

Chargaff's experiment showed that no matter what the organism or species is, the __________ content always equals __________ content and __________ content always equals __________ content. A. Adenine - Guanine - Cytosine - Thymine B. Adenine - Guanine - Thymine - Cytosine C. Cytosine - Thymine- Adenine - Guanine D. Adenine - Thymine - Guanine - Cytosine

D. Adenine - Thymine - Guanine - Cytosine

You are doing a PCR experiment. But you are really tired today as you just got a new puppy and it kept waking you up during the night. You misread the amount of DNA polymerase enzyme called for in the protocol, and you mistakenly put in 2x the necessary amount. How does this affect your experiment? A. During the experiment, you observe that the DNA polymerase denatures faster. B. After the amplification is complete, you discover that the reaction has failed to amplify any DNA. C. After the amplification is complete, you discover that you have more copies of one specific product. D. After the amplification is complete, you discover that you have non-specific products.

D. After the amplification is complete, you discover that you have non-specific products.

Autonomous elements can turn into nonautonomous elements by: A. Mutation B. Change in the repeat structure C. Deletion of the transpose gene D. All of the above E. None of the above

D. All of the above All A, B and C can change autonomous elements into nonautonomous elements, because without a functional transpose gene and conserved repeat structure, the elements cannot cut themselves and insert to other places.

What is: recombinant DNA? A. Non-essential "accessory" chromosomes, such as plasmids or modified bacterial viruses. B. A process used to create copies of recombinant DNA. C. A sample of DNA molecules containing a gene of interest. D. DNA molecules formed by fusion of donor DNA fragment and vectors.

D. DNA molecules formed by fusion of donor DNA fragment and vectors.

Mutant variant screening is considered a ______ genetics approach, while ______ is considered a _______ genetics approach. A. forward - knock-out association mapping - reverse B. reverse - knock-out association mapping - forward C. Reverse - knock-out gene silencing - forward D. Forward - knock-out gene silencing - reverse

D. Forward - knock-out gene silencing - reverse

The tails on the histones that make up the chromatin can be altered to help activate or deactivate genes. Please indicate below specifically which histone tail modification leads to: deactivation of genes? A. Histone acetylation. B. None of these answers are correct. C. Histone phosphorylation. D. Histone deacetylation. E. Histone dephosphorylation.

D. Histone deacetylation. Deactivated genes= Deacetylated histones

What type of transcriptional regulation occurs when there is a repressor in the operator? A. Both negative and positive regulation. B. Factorial regulation. C. Allosteric regulation. D. Negative regulation. E. Positive regulation. F. DNA methylation.

D. Negative regulation.

Please choose the answer that best describes eukaryotic and prokaryotic DNA: A. Both eukaryotic and prokaryotic DNA is linear. Thus, both types of DNA need telomerase to protect against degradation at the end of the chromosomes (the telomeres). B. Eukaryotic DNA is circular, while prokaryotic DNA is linear. Thus, prokaryotic DNA needs telomerase to protect against degradation at the end of the chromosomes (the telomeres). C. Both eukaryotic and prokaryotic DNA is circular. D. Prokaryotic DNA is circular, while eukaryotic DNA is linear. Thus, eukaryotic DNA needs telomerase to protect against degradation at the end of the chromosomes (the telomeres).

D. Prokaryotic DNA is circular, while eukaryotic DNA is linear. Thus, eukaryotic DNA needs telomerase to protect against degradation at the end of the chromosomes (the telomeres).

Restriction enzymes work because they cut at specific palindromic sequences of DNA. Most (but not all) restriction enzymes create "sticky ends" after cutting the DNA. What are these "sticky ends", and what purpose do they fulfill in gene characterization and cloning? A. Sticky ends are when there are no unpaired bases at the end of a cut site, caused by a restriction enzyme that cuts in the middle of the restriction sequence. This makes it easier for the resulting fragment to anneal to a sticky end of another fragment and re-establish a continuous DNA strand, thus enabling scientists to efficiently remove and re-insert portions of DNA. B. Sticky ends are what result when you eat a peanut butter and jelly sandwich and forget to wash your hands before you go back to work in the lab. Any DNA samples you touch become sticky. And that is the end of your experiment. So it is a sticky end. C. Sticky ends are what is left when DNA is not replicated completely. They serve as an indication for the scientist that the gene cloning cycle is not yet fully complete. D. Sticky ends are unpaired bases at the end of a cut site, caused by a restriction enzyme that does not cut in the middle of the restriction sequence. This makes it easier for the resulting fragment to anneal to a sticky end of another fragment and re-establish a continuous DNA strand, thus enabling scientists to efficiently remove and re-insert portions of DNA.

D. Sticky ends are unpaired bases at the end of a cut site, caused by a restriction enzyme that does not cut in the middle of the restriction sequence. This makes it easier for the resulting fragment to anneal to a sticky end of another fragment and re-establish a continuous DNA strand, thus enabling scientists to efficiently remove and re-insert portions of DNA.

What type of point mutation occurred in the following sequence? Original sequence: AA<T>GCCAATT Mutated sequence: AA<C>GCCAATT A. Insertion B. Chuck Norris C. Transversion substitution D. Transition substitution E. Missing-pair mutation F. Deletion G. Translocation

D. Transition substitution - the replacement of a base by the other base of the same chemical category (A-G or C-T)

Given that the DNA sequence for the antisense strand (a.k.a. template strand or non-coding strand) of a gene is 5'- ACTGGACCTGAAG -3', please choose the correct mRNA sequence out of the answers provided below. A. UGACCUGGUCUUC B. ACTGGACCUGAAG C. ACUGGACCUGAAG D. UGACCUGGACUUC

D. UGACCUGGACUUC

The "wobble" base is less important than the other two nucleotides in a codon/anticodon binding, and is found: A. at the 5' end of the RNA codon. B. at the 3' end of the DNA codon. C. at the 3' end of the tRNA anticodon. D. at the 5' end of the tRNA anticodon. E. within a tRNA hairpin loop structure.

D. at the 5' end of the tRNA anticodon.

In a PCR reaction, if we use a primer longer than 18-20 bp, it causes: A. lack of specificity. B. the PCR reaction to cease. PCR will not work at all if the primer is shorter or longer than 18-20 bp C. an increase in the overall rate of the reaction. D. reduced annealing efficiency. E. increased annealing efficiency

D. reduced annealing efficiency.

In eukaryotic cells, which of the following types of gene regulation can be found? A. Transcriptional gene regulation B. Post-transcriptional gene regulation C. Translational gene regulation D. Post-translational gene regulation. E. All of the above options are correct

E. All of the above options are correct

Which of the following is/are TRUE for RNA compared to DNA? A. RNA has ribose sugar in its nucleotides, rather than the deoxyribose found in DNA. B. RNA is usually single-stranded and can make more complex three-dimensional molecular shapes than double-stranded DNA. C. RNA contains the bases A, G, C, and U, whereas DNA contains the bases A, G, C, and T. D. RNA can catalyse biological reactions, but DNA cannot. E. All of the answer options are correct.

E. All of the answer options are correct.

What are the two types of transposition in prokaryotes? A. Non-conservative insertion by crossovers B. Conservative transposition C. Replicative transposition D. A and C E. B and C

E. B and C (conservative and replicative transposition)

Which of the following is/are the major process responsible for genetic variation? A. Mutation B. Transcription C. Recombination D. Translation E. Both A and C

E. Both A and C (mutation and recombination)

A small (one base pair) insertion in the middle of the coding region of a gene will cause a: A. Synonymous mutation. B. Silent mutation. C. Nonsense mutation. D. Missense mutation. E. Frameshift mutation.

E. Frameshift mutation.

which of the following statements is completely correct: A. In both prokaryotes and eukaryotes, these conserved sequences include a TATA box between -25 to -30 and a CAAT box at -75 to -80. The only difference is that prokaryotes have a Shine-Delgarno sequence that recruits the ribosome to the mRNA and eukaryotes lack that sequence. B. In prokaryotes, these conserved sequences include a TTGACAT at -35 and TATAAT at -10. In eukaryotes, these conserved sequences include a TATA box between -25 to -30 and a CAAT box at -75 to -80. Both prokaryotes and eukaryotes have a Shine-Delgarno sequence that recruits the ribosome to the mRNA. C. In eukaryotes, these conserved sequences include a TTGACAT at -35 and TATAAT at -10 and a Shine-Delgarno sequence that recruits the ribosome to the mRNA. In prokaryotes, these conserved sequences include a TATA box between -25 to -30 and a CAAT box at -75 to -80. D. In eukaryotes, these conserved sequences include a TTGACAT at -35 and TATAAT at -10. In prokaryotes, these conserved sequences include a TATA box between -25 to -30 and a CAAT box at -75 to -80 and a Shine-Delgarno sequence that recruits the ribosome to the mRNA. E. In prokaryotes, these conserved sequences include a TTGACAT at -35 and TATAAT at -10 and a Shine-Delgarno sequence that recruits the ribosome to the mRNA. In eukaryotes, these conserved sequences include a TATA box between -25 to -30 and a CAAT box at -75 to -80. F. In prokaryotes, these conserved sequences include a TTGACAT at -35 and TATAAT at -10. In eukaryotes, these conserved sequences include a TATA box between -25 to -30 and a CAAT box at -75 to -80 and a Shine-Delgarno sequence that recruits the ribosome to the mRNA.

E. In prokaryotes, these conserved sequences include a TTGACAT at -35 and TATAAT at -10 and a Shine-Delgarno sequence that recruits the ribosome to the mRNA. In eukaryotes, these conserved sequences include a TATA box between -25 to -30 and a CAAT box at -75 to -80.

What type of transcriptional regulation occurs when there is an activator in the activator bind site? A. Both negative and positive regulation. B. Factorial regulation. C. Allosteric regulation. D. Negative regulation. E. Positive regulation. F. DNA methylation.

E. Positive regulation

Retrotransposons move via an intermediate that is: A. a double-stranded lollipop. B. a retrovirus. C. an RNA/protein complex. D. single-stranded DNA. E. single-stranded RNA

E. single-stranded RNA Retrotransposons can be transcribed into single strand RNA, then the single strand RNA can be reverse-transcribed into a DNA copy, which is then inserted to another place. Single strand RNA is a intermediate in this process.

Bacteria can exchange genetic material by several different processes. Please shortly review these processes, then choose the answer below that is TRUE. (There is only one correct answer.) A. transformation, conjugation, transduction, and disjunction B. transformation, conjugation, transduction, and disjunction C. transformation, translocation, and signal transduction D. conjugation, transduction, and non-disjunction E. transformation, conjugation, and transduction

E. transformation, conjugation, and transduction

What type of point mutation occurred in the following sequence? Original sequence: AATGCCA<A>TT Mutated sequence: AATGCCATT A. Insertion B. Chuck Norris C. Transversion substitution D. Transition substitution E. Missing-pair mutation F. Deletion G. Translocation

F. Deletion - the removal of a single base pair

In our experiment, we discover that the nucleotide sequence on a particular strand of DNA, read left to right, is AGACTCG. We'd like to determine the order of nucleotides on the complementary strand. One lab partner says that to determine the complementary strand, we have to search through all the denatured DNA fragments in the test tube, then use a computer to give us the complementary strand sequence after running a complicated maximum-likelihood algorithm. A second lab partner tells us it is fairly easy to determine the complementary strand--no computers required. Which lab partner do you think is right? Whatever your method of determining the answer, please select below the correct order of nucleotides on the complementary strand, read left to right. A. AGACUCG B. CGAGUCU C. UCUGAGC D. GCUCAGA E. CGAGTCT F. TCTGAGC G. AGACTCG H. GCTCAGA

F. TCTGAGC

What is: an operator? A. A region of nucleotide sequences that includes all bases from start codon to stop codon. B. A DNA-binding protein that regulates the expression of one or more genes by binding to the operator and blocking the movement of RNA polymerase, thus preventing transcription of the genes. C. A region of DNA to which RNA polymerase binds to initiate the transcription of a particular gene. Typically located upstream (towards the 5' region of the sense strand) of the gene. D. A DNA-binding protein that regulates one or more genes by permitting and/or increasing the rate of transcription. E. A protein that alters the supercoiled form of a DNA molecule. F. The binding sites of a repressor. G. A protein that separates double-stranded DNA into single strands, allowing each strand to be copied.

F. The binding sites of a repressor.

What is a frameshift mutation?

Frameshift mutation- changes in the DNA sequence that result in an altered translation reading frame (insertions and deletions)

What is a nonsense mutation?

Nonsense mutation- a substitution that generates a stop codon

Recombinant DNA techniques typically require the action of a. DNA polymerase and phosphatase b. Restriction enzymes and DNA ligase c. RNA polymerase and RNA primase d. Reverse transcrip

b. Restriction enzymes and DNA ligase Recombinant DNA techniques usually require two steps: First, use restriction enzymes to cut the donor DNA and the plasmid, which can produce sticky ends Second, DNA ligase is used to facilitate the joining of the DNA strands together by catalyzing the formation of a phosphodiester bond

In the Sanger method of DNA sequencing, what causes the termination of chain elongation? a. The incorporation of a regular DNA nucleotide b. The incorporation of a dideoxynucleotide c. Denaturation of the double-stranded test fragments d. When the DNA polymerase encounters a stop codon e. When denaturation causes the primers to disassociate from the strands

b. The incorporation of a dideoxynucleotide In the Sanger method of DNA sequencing, dideoxynucleotide triphosphates are used to block the continued DNA synthesis, because they cannot form a phosphodiester bond with next incoming dNTP

Plasmid vector, pUC18, allows for simple screening for recombinant plasmids. Insertion into pUC18 is detected by inactivation of the β-galactosidase function of lacZ'. What kind of colonies growing on the medium with artificial galactose substrate X-Gal have the DNA insertion? a. Blue colonies b. White colonies

b. White colonies White Colonies- no cleavage of Xgal, DNA insert is present, recombinant vector, LacZ gene NOT expressed Blue Colonies- cleavage of Xgal, no DNA present, non-recombinant vector, LacZ gene is expressed

A linear DNA molecule has 3 target sites for restriction enzyme EcoRI. How many fragments will be produced after complete digestion? a. 2 b. 3 c. 4 d. 5 e. 6

c. 4 Three cut sites can produce 4 DNA fragments after digestion of a linear DNA

HFr refers to a. A cell with an F plasmid b. A cell that has combined with the other cells by sexual reproduction c. A cell in which the F plasmid has been integrated into the cell chromosome d. A cell that has given away its F plasmid

c. A cell in which the F plasmid has been integrated into the cell chromosome Integration of the F plasmid creates an Hfr strain.

What is an auxotroph? a. A mutant strain that has novel antibiotic resistance b. A mutant strain that transfers DNA to recipient cells with high efficiency c. A mutant strain that lacks the ability to synthesize a molecule that is essential for viability d. A wild type strain that can survive on minimal media

c. A mutant strain that lacks the ability to synthesize a molecule that is essential for viability Auxotroph: a mutant strain that grows only when the medium is supplemented with specific substance because auxotroph are NOT capable of utilizing certain nutrients or synthesizing certain compounds.

In the study of genetics, a "library" denotes: a. the information carried in a digital database, such as GenBank. b. a complex collection of restriction enzymes gathered for the purpose of restriction enzyme mapping c. a collection of DNA fragments isolated from a particular group of cells (or tissue) representing the genetic content of those cells d. all the proteins present in a particular cell type, collected by protein extraction e. a collection of books that explore the topic of genetics

c. a collection of DNA fragments isolated from a particular group of cells (or tissue) representing the genetic content of those cells

In general, the role of an antibiotic resistance gene in a cloning vector or plasmid is to: a. prevent the vector from catching a bacterial infection b. allow for differentiation between competent bacterial cells that have taken up a recombinant vector and those that have taken up non-recombinant vector c. allow for differentiation between competent bacterial cells that have taken up a vector (recombinant or non-recombinant) and those that have not taken up any vector d. allow for production of large amounts of the antibiotic in order to harvest it for human use e. prevent competent bacterial cells from taking up more than one recombinant vector

c. allow for differentiation between competent bacterial cells that have taken up a vector (recombinant or non-recombinant) and those that have not taken up any vector The follow figure shows the key functional components of a plasmid vector, the antibiotic resistance gene is a selectable marker. On the bacterial cells that have taken up a vector can grow on the medium with the antibiotics (no matter the plasmid has insertion or not), and the bacterial cells without vectors cannot grow.

What is a point mutation?

point mutation- a single base pair change in the DNA sequence

What type of genetics is this: a field of study that focuses on genetic changes over time within a group of individuals that interbreed

population genetics

What type of genetics is: a field of study that focuses on traits that vary along a continuous scale and the transmission of these traits to offspring.

quantitative genetics

What is a silent/same-sense/synonymous mutation?

silent/same-sense/Synonymous mutation- a change in the DNA sequence that does not affect the gene (no AA sequence change)