Bio 1 Questions
When the substrate is bound to the enzyme, the shape of the enzyme may change slightly, leading to A.a better induced fit. B.a great range of possible catalytic activities. C.a greater supply of activation energy. D.more possible products of the reaction.
A.a better induced fit.
Normally, only female cats have the tortoiseshell phenotype because _____. A.a male inherits only one allele of the X-linked gene controlling hair color B.the Y chromosome has a gene blocking orange coloration C.only males can have Barr bodies D.multiple crossovers on the Y chromosome prevent orange pigment production
A.a male inherits only one allele of the X-linked gene controlling hair color
The bacterial genome exist as A.a single, circular, double stranded DNA molecule. B.a single, circular, double stranded RNA molecule. C.a single, linear, double stranded DNA molecule. D.many, circular, double stranded DNA molecules.
A.a single, circular, double stranded DNA molecule.
A man who carries an allele of an X-linked gene will pass it on to _____. A.all of his daughters B.half of his daughters C.all of his sons D.all of his children
A.all of his daughters
A new antibiotic has been developed that will use competitive inhibitor enzyme inhibition. This means that the A.antibiotic will compete for substrate binding sites on the enzyme B.antibiotic will compete for binding sites on the substrate C.antibiotic will compete for binding sites on the enzyme-substrate complex D.antibiotic will compete for binding sites on the product that is being produced
A.antibiotic will compete for substrate binding sites on the enzyme
A cross between two pea plants results in 732 purple and 268 white plants. What is (are) the genotype(s) and phenotype(s) of the parents that produced these offspring? A.both parents are heterozygous purple B.one parent is homozygous purple, second parent is homozygous white C.one parent is heterozygous purple, second parent is heterozygous white D.one parent heterozygous purple, second parent homozygous white
A.both parents are heterozygous purple
Which statement best explains the way that an abnormal p53 causes normal cells to become cancer cells? The abnormal p53 protein A.fails to carry out DNA repair. B.triggers too many cells to grow. C.damages the normal DNA. D.stimulates the death of normal cells. E.enhances tumor-suppressor genes.
A.fails to carry out DNA repair.
When ATP levels are high, oxidative pathways are inhibited, so acetyl-CoA is channeled into A.fatty acid synthesis. B.pyruvate formation. C.the Krebs cycle. D.the electron transport system. E.NAD production.
A.fatty acid synthesis.
If you exposed a C4 plant to 14CO2 in the light, which of the following would be the first organic molecule labeled with 14C? A.oxaloacetate B.malate C.pyruvate D.phosphoenolpyruvate (PEP)
A.oxaloacetate
True breeding plants A.produce the same offspring when crossed for many generations B.result from a monohybrid cross C.result from a dihybrid cross D.result from crossing over during prophase I of meiosis
A.produce the same offspring when crossed for many generations
The oxidation of the carbon in glucose to CO2 during respiration occurs primarily during A.the Citric Acid Cycle B.glycolysis C.pyruvate oxidation D.substrate-level phosphorylation E.the respiratory chain
A.the Citric Acid Cycle
The component of aerobic respiration that produces the most ATP per mole of glucose is A.the electron transport chain. B.the citric acid cycle. C.glycolysis. D.lactic acid fermentation.
A.the electron transport chain.
During translation elongation, the existing polypeptide chain is transferred to A.the tRNA occupying the A site B.the tRNA occupying the P site C.the ribosomal rRNA D.a signal recognition particle
A.the tRNA occupying the A site
How are inducible and repressible systems similar? A.They both control catabolic pathways B.They both control biosynthetic pathways C.In both systems the regulatory molecules function by binding to the operator D.They both block transcription by default
C.In both systems the regulatory molecules function by binding to the operator
Which of the following is incorrect? A.Homo sapiens are humans B.Humans are in in the order Omnivores C.Humans are still evolving D.Humans are eukaryotes E.Through evolutionary time there have been several different species of humans
B.Humans are in in the order Omnivores
What stage is represented by this figure? A.Prophase I B.Metaphase I C.Anaphase I D.Metaphase II E.Anaphase II
C.Anaphase I
Which of the following is not a component of a nucleotide? A.Pentose sugar B.Phosphate group C.Carboxyl group D.Nitrogenous base
C.Carboxyl group
What is occurring during S phase? A.Nothing, the cell is resting B.Cytokinesis C.DNA synthesis D.Nuclear division
C.DNA synthesis
A promoter is the region of A.a plasmid that binds the enzymes for replication. B.the mRNA that binds to a ribosome. C.DNA that binds RNA polymerase. D.the mRNA that binds tRNAs.
C.DNA that binds RNA polymerase.
mRNA is made by a(n) A.RNA-dependent DNA polymerase B.RNA-dependent RNA polymerase C.DNA-dependent RNA polymerase D.form of RNA
C.DNA-dependent RNA polymerase
RNA polymerase by itself cannot bind to the chromosome and initiate transcription. It can bind and act only after regulatory proteins called _______ factors have been assembled. A.translation B.post-translation C.initiation D.transcription
D.transcription
Unifying Themes of Biology
•Cells as basic unit of life •Energy transfer and transformation •Feedback and regulation •DNA as common genetic material •Common evolutionary history explains both similarities and diversity •Structure and function relationships •Emergent properties
Evolution is a A. Fact B. Theory C. Hypothesis D. Conjecture
A. Fact
Hemophilia is caused by a A. recessive allele on the X chromosome. B.dominant allele on the X chromosome. C.codominant allele on the X chromosome. D.recessive allele on an autosome.
A. recessive allele on the X chromosome.
In Mendel's experiments, if the allele for tall (T) plants was incompletely dominant over the allele for short (t) plants, what offspring would have resulted from crossing two Tt plants? A.1/4 tall; 1/2 intermediate height; 1/4 short B.1/2 tall; 1/4 intermediate height; 1/4 short C.All the offspring would have been tall D.All the offspring would have been of intermediate height
A.1/4 tall; 1/2 intermediate height; 1/4 short
Unattached earlobes are a dominant trait. Finn and Maggie both have unattached earlobes but their daughter, Celia, does not. If Finn and Maggie have a second child, what is the probability that it will have attached earlobes? A.1⁄4 B.1⁄2 C.3⁄4 D.1⁄8
A.1⁄4
In white tigers, the absence of fur pigmentation is caused by a recessive allele. This allele also causes the tigers to be cross-eyed. If two tigers heterozygous for this allele mate and produce offspring, what percentage can be expected to be white and/or cross-eyed A.25% will be white and the same 25% will be cross-eyed B.25% will be white and 25% will be cross-eyed, but not necessarily the same 25% due to independent assortment C.50% will be both white and cross-eyed D.Because it is a recessive allele, none of the offspring in the F1 generation will be white or cross-eyed
A.25% will be white and the same 25% will be cross-eyed
A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon for the mRNA transcribed is _____. A.3' UCA 5' B.3' UGA 5' C.5' TCA 3' D.3' ACU 5'
A.3' UCA 5'How does termination of translation take place?
A bacterium has been discovered which can produce one extra ATP from the conversion of two pyruvate molecules to butyrate and CO2, after glycolysis. How many total molecules of ATP can this organism produce when fermenting 10 molecules of glucose completely to butyrate and CO2? A.30 B.20 C.10 D.40
A.30
In a two-point cross to map genes A and B, you obtained 98 recombinant types and 902 parental types among the offspring. How far apart are these genes? A.9.8 cM B. 0.98 cM C. 90.2 cM D. 9.02 cM
A.9.8 cM
Which of the following DNA sequences, if hydrogen bonded to its complementary strand, will be easiest to denature into two strands? A.ATTTA B.ATCGA C.CCCCC D.AATCC E.CCTGG
A.ATTTA
Why is the absorption spectrum of chlorophyll a not identical to the action spectrum of photosynthesis? A.Accessory pigments contribute energy to drive photosynthesis B.Chlorophyll a absorbs both red and blue light C.Chlorophyll a reflects green light D.Different wavelengths of light have different energies
A.Accessory pigments contribute energy to drive photosynthesis
Mitotic cyclins, which persist in the cell for only a few minutes, have one of the shortest life spans of all intracellular proteins. After a CDK-cyclin complex has performed its function, the associated cyclin is polyubiquitinated and destroyed by the proteasome, which provides directionality for the cell cycle. Which of the following is not a time point where you would expect to see an increase in cyclin degradation by proteasomes? A.After cytokinesis checkpoint B.After G2/M checkpoint C.After spindle checkpoint D.After G1/S checkpoint
A.After cytokinesis checkpoint
Which of the following is not part of the cell theory? A.All cells contain a nucleus B.Cells are the fundamental units of life C.All organisms are composed of cells D.All cells come from preexisting cells
A.All cells contain a nucleus
Mature nerve cells are incapable of cell division. These cells are probably in A.G1 B.the S phase C.G2 D.Mitosis E.G0
A.G1 E.G0
If you were an anaerobic bacterium and needed to harvest energy, which of the following would be your best option? A.Glycolysis and fermentation B.Fermentation and cellular respiration C.Krebs cycle and fermentation D.Fermentation only
A.Glycolysis and fermentation
The following change occurs when cells possess plentiful amounts of ATP: A.Glycolysis is slowed. B.The Krebs cycle speeds up. C.The amount of NADH increases. D.ADP usage goes up.
A.Glycolysis is slowed.
Secondary structure of proteins is directly maintained by A.H-bonds B.Peptide bonds C.Disulfide linkages D.Hydrophobic interactions
A.H-bonds
3o and 4o structure of proteins is maintained by A.H-bonds B.Peptide bonds C.Disulfide linkages D.Hydrophobic interactions
A.H-bonds B.Peptide bonds C.Disulfide linkages D.Hydrophobic interactions
Where do cells spend most of their time? A.Interphase B.Mitosis C.Cytokinesis D.Meiosis
A.Interphase
Which of the following statements in true? A.Many active genes are found in euchromatin, because proteins involved in transcription can easily access these regions of DNA. B.Euchromatin, found in interphase cells, is readily visible and easily viewed. C.A region of DNA is either heterochromatin or euchromatin, it cannot go back and forth between the two forms. D.When DNA is being replicated, the chromosomes are composed chiefly of heterochromatin.
A.Many active genes are found in euchromatin, because proteins involved in transcription can easily access these regions of DNA.
Which of the following statements about DNA is false? A.One chromosome is made up of many DNA molecules. B.A eukaryotic genome is made up of many DNA molecules. C.A DNA double helix contains both covalent bonds and hydrogen bonds. D.A strand of DNA is made up of many nucleotides.
A.One chromosome is made up of many DNA molecules.
Which of the following statements regarding photorespiration is false? A.Photorespiration generates ATP through electron transport and chemiosmosis B.Photorespiration is a metabolically expensive pathway C.Photorespiration is avoided when CO2 is abundant D.Photorespiration reduces the overall CO2 that is converted to sugar
A.Photorespiration generates ATP through electron transport and chemiosmosis
Which of the following statements is true of linkage? A.The closer two genes are on a chromosome, the lower the probability that a crossover will occur between them. B.The observed frequency of recombination of two genes that are far apart from each other has a maximum value of 50%. C.All of the traits that Mendel studied—seed color, pod shape, flower color, and others—are due to genes linked on the same chromosome. D.Linked genes are found on different chromosomes.
A.The closer two genes are on a chromosome, the lower the probability that a crossover will occur between them.
Which of the following features summarizes the molecular architecture of DNA? A.The two strands run in opposite directions B.The molecule twists in the same direction as the threads of most screws C.The molecule is a double-stranded helix D.It has a uniform diameter
A.The two strands run in opposite directions B.The molecule twists in the same direction as the threads of most screws C.The molecule is a double-stranded helix D.It has a uniform diameter
What is the reason that closely linked genes are typically inherited together? A.They are located close together on the same chromosome. B.The number of genes in a cell is greater than the number of chromosomes. C.Alleles are paired together during meiosis. D.Genes align that way during metaphase I of meiosis.
A.They are located close together on the same chromosome.
Which of the following is not true of homologous chromosome pairs? A.They come from only one of the individual's parents B.They usually contain slightly different versions of the same genetic information C.They segregate from each other during meiosis I D.They synapse during meiosis I E.Each contains two sister chromatids at the beginning of meiosis I
A.They come from only one of the individual's parents
Which of the following are mutagens, and thus potential causes of human cancer? A.UV light B.Certain industrial chemicals like formaldehyde C."Tar" in tobacco D.X-rays E.Hydrazines in mushrooms F.Estragole in basil G.Alcohol in beer
A.UV light B.Certain industrial chemicals like formaldehyde C."Tar" in tobacco D.X-rays E.Hydrazines in mushrooms F.Estragole in basil G.Alcohol in beer
Extranuclear inheritance was first described by Carl Correns based on his observations of Mirabilis jalapa (the four o'clock plant). M. jalapa can have either white, variegated (white and green) or green leaves. Pollen from a variegated M. jalapa plant is used to fertilize a white M. jalapa flower. Which of the following phenotypes would you expect to see in the offspring of this cross? A.White B.Green C.Variegated D.White and variegated E.White, green, & variegated
A.White
In pea plants, the gene for yellow seeds, Y, is dominant to the allele for green seeds, y. A plant with green seeds must have the genotype
A.YY B.Yy C.yy D.XY
Are humans still evolving? A.Yes B.No C.Difficult to determine
A.Yes
In the fruit fly Drosophila, there is a dominant gene for normal wings and its recessive allele for vestigial wings. At another gene locus on the same chromosome, there is a dominant gene for red eyes and its recessive allele for purple eyes. A male that was heterozygous at both gene loci was mated with a female that was homozygous for both recessive alleles and the following results were observed among the offspring:Normal wings and red eyes = 420 Vestigial wings and red eyes = 80Normal wings and purple eyes = 70 Vestigial wings and purple eyes = 430What is the distance between these 2 gene loci? A. 7.5 cM B. 15 cM C. 50 cM D. 85cM
B. 15 cM
In fruit flies (Drosophila melanogaster) there is a dominant allele for red eyes and a recessive allele for white eyes. These alleles are located on the X chromosome. If a heterozygous red-eyed female is mated with a white-eyed male, what percentage of the offspring are expected to be white-eyed females? A. 0% B. 25% C. 50% D. 100%
B. 25%
Cytosine makes up 32% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be thymine? A.16% B.18% C.32% D.50%
B.18%
It has been found that at a certain locus of the human genome, 200 different alleles exist in the population. Each person has at most _______ alleles at this locus A.1 B.2 C.100 D.200 E.400
B.2
The cytosine content of DNA from a mouse cell was estimated to be 40 percent of the total pyrimidine content. The percentage of total nucleotides in the DNA represented by guanine is A.10 percent. B.20 percent. C.30 percent. D.40 percent.
B.20 percent.
A DNA molecule containing 18% thymine would contain how much cytosine? A.18 percent. B.32 percent. C.36 percent. D.64 percent.
B.32 percent.
The cytosine content of DNA from a mouse cell was estimated to be 30 percent of the total pyrimidine content. The percentage of total nucleotides in the DNA represented by adenine is A.70 percent. B.35 percent. C.30 percent. D.15 percent.
B.35 percent.
The chemical 2,4 dinitrophenol (DNP) is used in the manufacturing of wood preservatives and explosives. Products containing DNP are toxic because DNP uncouples oxidative phosphorylation.In a cell exposed to DNP, how many net ATP molecules would be generated per molecule of glucose? A.2 B.4 C.36 D.38
B.4
A male is heterozygous for the trait that produces freckles on the skin, and he has freckles. If he marries a female who is also heterozygous for freckles, ______ percent of their children are predicted to be freckled. Also, of all their children, ______ percent are predicted to be heterozygous A.100%, 100% B.75%, 50% C.75%, 25% D.50%, 50%
B.75%, 50%
How does termination of translation take place? A.The end of the mRNA molecule is reached. B.A stop codon is reached. C.The 5' cap is reached. D.The poly-A tail is reached.
B.A stop codon is reached.
What is fed into the citric acid cycle? A.Pyruvate B.Acetyl-CoA C.CO2 D.Reducing equivalents
B.Acetyl-CoA
The lower cell in this figure is characterized by a _______ carbon fixation pathway, a _______ CO2/O2 ratio in the cell, and the major carbon fixation enzyme is _______ A.C3; Low; Rubisco B.C3; High; Rubisco C.C3 and C4; High; Rubisco D.C3 and C4; High; PEP Carboxylase E.C4; Low; PEP Carboxylase
B.C3; High; Rubisco
The formula for glucose is C6H12O6. What is the formula for a polymer made by linking ten glucose molecules together by dehydration synthesis? A.C60H120O60 B.C60H102O51 C.C60H100O50 D.C60H111O51
B.C60H102O51
Which of the following occurs during the Calvin cycle? A.Water is converted into hydrogen and oxygen B.CO2 is converted into sugars C.Chlorophyll acts as an enzyme D.Nothing occurs; the plant rests in the dark
B.CO2 is converted into sugars
All of the following are critical factors for DNA replication on the leading strand except? A.primer. B.DNA ligase. C.DNA polymerase. D.DNA primase. E.deoxynucleoside triphosphates.
B.DNA ligase.
DNA contains the template needed to copy itself, but it has no catalytic activity in cells. What catalyzes the formation of phosphodiester bonds between adjacent nucleotides in the DNA polymer being formed? A.Ribozymes B.DNA polymerase C.ATP D.deoxyribonucleotide triphosphates
B.DNA polymerase
Why does replication proceed in opposite directions on the leading and lagging strands? A.The polymerase enzyme needs a primer B.DNA polymerase III can only add to the 3´ end of a strand C.The Okazaki fragments are only on the leading strands D.The parent strands are oriented in the same directions E.Helicase only allows for replication of one strand at a time
B.DNA polymerase III can only add to the 3´ end of a strand
In order to lose weight and reduce body fat, a friend of yours decided to eliminate all fat from their diet, while consuming unrestricted amounts of carbohydrates. Aside from being an unhealthy way to try to lose weight, why would this approach be unsuccessful at reducing body fat? A.Excess acetyl-CoA from glycolysis will be channeled into production of body fat. B.Excess acetyl-CoA will diverted from the Krebs cycle into the production of body fat. C.Excess acetyl-CoA will undergo beta-oxidation to produce body fat. D.Excess acetyl-CoA will undergo deamination to produce body fat.
B.Excess acetyl-CoA will diverted from the Krebs cycle into the production of body fat.
Multiple functional groups are able to attach to macromolecules. What is the most useful characteristic that enables the attachment of multiple functional groups? A.One hydrogen ionic bond. B.Four carbon covalent bonds. C.Two oxygen covalent bonds. D.Three nitrogen ionic bonds.
B.Four carbon covalent bonds.
Which of the following is not a product of the light reactions of photosynthesis? A.ATP B.Glucose C.NADPH + H+ D.Oxygen gas
B.Glucose
Select the correct sequence concerning glucose catabolism A.Glycolysis →Pyruvate → Acetyl CoA → Electron Transport → Citric Acid Cycle B.Glycolysis → Pyruvate → Acetyl CoA → Citric Acid Cycle → Electron Transport C.Glycolysis → Acetyl CoA → Pyruvate → Electron Transport → Citric Acid Cycle D.Glycolysis → Acetyl CoA → Pyruvate → Citric Acid Cycle → Electron Transport
B.Glycolysis → Pyruvate → Acetyl CoA → Citric Acid Cycle → Electron Transport
Meiosis and mitosis are both processes that involve nuclear division. What is the difference between the two? A.Mitosis is nuclear division, resulting in haploid gametes. Meiosis is nuclear division, resulting in diploid somatic cells. B.Mitosis is nuclear division, resulting in diploid somatic cells. Meiosis is nuclear division, resulting in haploid gametes. C.Mitosis is nuclear division, resulting in diploid gametes. Meiosis is nuclear division, resulting in haploid somatic cells. D.Mitosis is nuclear division, resulting in syngamy. Meiosis is nuclear division, resulting in zygotes.
B.Mitosis is nuclear division, resulting in diploid somatic cells. Meiosis is nuclear division, resulting in haploid gametes.
Primary structure of proteins is maintained by A.H-bonds B.Peptide bonds C.Disulfide linkages D.Hydrophobic interactions
B.Peptide bonds
Tertiary structure of proteins does not directly involve A.H-bonds B.Peptide bonds C.Disulfide linkages D.Hydrophobic interactions
B.Peptide bonds
Given what is known about the minimal essential functions of cellular life, if you could create an artificial cell, which of the following structures must you include? A.Cell wall B.Ribosome C.Mitochondria Nucleus
B.Ribosome
Alpha helix and beta pleated sheets are examples of which level of protein structure? A.Primary B.Secondary C.Tertiary D.Quaternary
B.Secondary
How would the surface area-to-volume ratio of eight 1-mm cubes compare to the surface area-to-volume ratio of one 2-mm cube? A.They would be equal B.The 1-mm cubes would have a greater surface area-to-volume ratio C.The 2-mm cube would have a greater surface area-to-volume ratio
B.The 1-mm cubes would have a greater surface area-to-volume ratio
Which of the following is common to both cellular respiration and the light reactions of photosynthesis? A.The transfer of electrons to glucose B.The chemiosmotic formation of ATP C.Oxygen is one of the byproducts D.Mitochondria are essential organelles
B.The chemiosmotic formation of ATP
A single base substitution mutation is least likely to be deleterious when the base change results in _____. A.a stop codon B.a codon that specifies the same amino acid as the original codon C.an amino acid substitution that alters the tertiary structure of the protein D.an amino acid substitution at the active site of an enzyme
B.a codon that specifies the same amino acid as the original codon
Compartmentalization in eukaryotic cells has the advantage of A.insulating the cell from temperature changes B.allowing specialization by separating different cellular processes C.allowing protein synthesis by ribosomes resulting in locomotion
B.allowing specialization by separating different cellular processes
During which phase of mitosis do the two sister chromatids become individual chromosomes? A.telophase B.anaphase C.prophase D.metaphase
B.anaphase
In humans, if nondisjunction led to an individual with a genotype of XXY, that person would A. be female because each cell has two X chromosomes. B.be male because each cell has one Y chromosome. C.display both male and female characteristics. D.not survive.
B.be male because each cell has one Y chromosome. C.display both male and female characteristics.
Each chromosome has a ___________, a point of constriction that bind specific proteins and holds two sister chromatids together. A.DNA strand B.centromere C.node D.synapse
B.centromere
An inducer A.combines with a repressor and prevents it from binding the promoter B.combines with a repressor and prevents it from binding the operator C.binds to the promoter and prevents the repressor from binding to the operator D.binds to the operator and prevents the repressor from binding at this site
B.combines with a repressor and prevents it from binding the operator
The enzymes catalyzing the reactions of glycolysis are found in the A.mitochondria. B.cytoplasm. C.nucleus. D.Golgi apparatus.
B.cytoplasm.
Small cells function more effectively, because as cells become larger their surface area to volume ratio A.increases. B.decreases. C.stays the same. D.is squared. E.is cubed.
B.decreases
Weak ionic bonds formed between the negative phosphate functional group and partially or fully positive amino acids of proteins modified by a kinase do which of the following? A.make functional ATP B.distort a protein from one functional state to another C.activate phosphatases to remove the phosphate group D.alter the permeability of the cell's membranes
B.distort a protein from one functional state to another
In cacti, CO2 is stored ______ for later use in the Calvin cycle A.in the stems, roots, and leaves. B.during the evening. C.in glucose molecules. D.in the stroma.
B.during the evening.
Plant cells typically achieve cytokinesis by A.binary fission. B.forming a cell plate across the middle of the cell. C.forming a cleavage furrow that pinches the cell into two. D.chromosome elongation.
B.forming a cell plate across the middle of the cell.
If the copy number of a proto-oncogene is increased by gene duplication then the proto-oncogene has undergone A.a missense mutation. B.gene amplification. C.a chromosomal translocation. D.retroviral insertion. a nonsense mutation.
B.gene amplification.
If you wanted to convert a proto-oncogene to an oncogene, which of the following methods would you choose? A.growth factor exposure B.genetic damage C.pair the proto-oncogene with a tumor-suppressor gene D.halt cell cycle progression
B.genetic damage
The two copies of each chromosome in human body cells are called A.sister chromatids. B.homologous chromosomes. C.sister chromosomes. D.daughter chromosomes. E.genes.
B.homologous chromosomes.
Cytochromes are respiratory proteins. Which of the following statements is true about them? They reside A.free in the lung cells of all vertebrates. These molecules contain a heme group with an iron atom at its center B.in the mitochondria and are specifically associated with the electron transport system C.in the mitochondria and are specifically associated with the Kreb cycle D.in the mitochondria and are specifically associated with glycolysis
B.in the mitochondria and are specifically associated with the electron transport system
Phosphofructokinase is an allosteric enzyme that catalyzes the conversion of fructose-6-phosphate to fructose-1,6-bisphosphate, an early step of glycolysis. In the presence of oxygen, an increase in the amount ATP in a cell would be expected to A.inhibit the enzyme and thus increase the rate of glycolysis and the concentration of citrate. B.inhibit the enzyme and thus slow the rates of glycolysis and the citric acid cycle. C.activate the enzyme and increase the rates of glycolysis and the citric acid cycle. D.activate the enzyme and thus slow the rates of glycolysis and the citric acid cycle.
B.inhibit the enzyme and thus slow the rates of glycolysis and the citric acid cycle.
Acetyl CoA A.is formed within mitochondria by the reduction of pyruvate B.is formed within mitochondria by the oxidation of fatty acids C.is formed in the cytoplasm by the oxidation of glucose D.is formed in the cytosol during the complete oxidation of glucose
B.is formed within mitochondria by the oxidation of fatty acids
When cyclin binds Cdk, A.the cell transitions from G2 to S B.kinase activation can occur C.chromosomes condense D.the cell quickly enters M phase
B.kinase activation can occur
Occasionally, chromosomes fail to separate during meiosis, leading to daughter cells that have an abnormal number of chromosomes. This phenomenon is called A. epistasis. B.nondisjunction. C.crossing over. D.pleiotropy.
B.nondisjunction.
Y-linked genes include a gene that produces hairy pinnae (the external ear). A male with hairy pinnae will pass this trait A.to his sons and daughters B.only to his sons C.only to his daughters D.only to his grandsons E.to all his children if the mother is a carrier
B.only to his sons
The oxidation of malate to oxaloacetate is coupled to the reduction of NAD+ to NADH + H+. NAD+ is a(n) A.reducing agent. B.oxidizing agent. C.vitamin. D.phosphorylating agent
B.oxidizing agent.
The specific amino acid sequence in a protein is its A.zero order structure B.primary structure C.secondary structure D.tertiary structure E.quaternary structure
B.primary structure
Yeast cells under anaerobic conditions A.die. B.produce ethyl alcohol (ethanol). C.produce oxygen. D.switch to oxidative respiration. E.push the glycolytic pathway backward.
B.produce ethyl alcohol (ethanol).
Chromosomes start to condense & the spindle starts to form in A.anaphase B.prophase C.prometaphase D.telophase E.metaphase
B.prophase
You label cells with a radioactive isotope of sulfur (35S). The only molecules that would be radioactively labeled in these cells are A.lipids B.proteins C.carbohydrates D. nucleic acids
B.proteins
The photosynthetic pigment chlorophyll absorbs A.infrared light B.red and blue light C.green light D.white light
B.red and blue light
Sex determination in mammals is due to the SRY gene. Which of the following could allow a person with an XX karyotype to develop a male phenotype? A.the loss of the SRY gene from an autosome B.translocation of SRY to a X chromosome C.a person with an extra autosomal chromosome D. a person with one normal and one shortened (deleted) X
B.translocation of SRY to a X chromosome
A single glucose molecule can drive the Krebs cycle A.one turn. B.two turns. C.three turns. D.six turns.
B.two turns.
Animals inhale air containing oxygen and exhale air with less oxygen and more carbon dioxide. After inhalation, the oxygen missing from the air will mostly be found in A.the carbon dioxide that is exhaled. B.water. C.organic molecules. D.lactate.
B.water.
Examine the following recombination data and determine the proper order of the genes on the Drosophila X chromosome. Assume y is in the 0.0 position. Recombination Gene 1 Gene 2 frequency Yellow (y) vermilion (v) 0.322 Vermilion miniature (m) 0.030 White (w) vermilion 0.297 Yellow white 0.010 White minature 0.327 A.y m v w B.y w v m C.y m w v D.y w m v
B.y w v m
Type 1 fucosidosis is a rare human disease. Patients cannot hydrolyze the disaccharide fucose, and as a result have severe neurological decline and die by age 6. The disease is due to a defect in the gene that encodes the lysosomal enzyme that breaks down fucose, and is inherited in an autosomal recessive manner. Jane and John have a child who has Type 1 fucosidosis. What is the probability that their next child will also have the disease? A.Virtually no chance B.¼ C.½ D.¾
B.¼
Which offspring inherit all their mitochondrial DNA from their mother and none from their father? A. Daughters B. Sons C. Both sons and daughters D. Neither sons nor daughters
C. Both sons and daughters
The functional group that forms covalent bonds between R groups within a polypeptide and that stabilizes tertiary structure isA.-NH2 B.-COOH C.-SH D.-OH
C.-SH
How many molecules of water are used to completely hydrolyze a polymer that is 11 monomers long? A.12 B.11 C.10 D.9
C.10
In a two-point cross to map genes A and B, you obtained 100 recombinant flies and 900 non-recombinant flies. How far apart are these genes? A.1.0 cM B.9.0 cM C.10.0 cM D.100 cM
C.10.0 cM
In dogs, erect ears and barking while following a scent are due to dominant alleles; droopy ears and silence while following a scent are due to recessive alleles. A dog homozygous dominant for both traits is mated to a droopy-eared, silent follower. The expected F1 phenotypic ratios should be A.9:3:3:1 B.8:8 or 1:1 C.16:0 D.4:8:4 or 1:2:1
C.16:0
What fraction of offspring of the cross AaBb × AaBb is homozygous for all the dominant alleles, assuming that they are on different chromosomes? A.1⁄4 B.1⁄8 C.1⁄16 D.1⁄32
C.1⁄16
Classical albinism results from a recessive allele. Which of the following is the expected ratio for the progeny when a normally pigmented male with an albino father has children with an albino woman? A.3⁄4 normal; 1⁄4 albino B.3⁄4 albino; 1⁄4 normal C.1⁄2 normal; 1⁄2 albino D.All normal
C.1⁄2 normal; 1⁄2 albino
Let P = purple flowers and p = white, and T = tall plants and t = dwarf. Of the 16 possible gamete combinations in the dihybrid cross, how many would be the phenotype white, tall A.None B.1 C.3 D.9
C.3
Reverse transcriptase is an enzyme that can synthesize DNA from an RNA template. What DNA sequence is produced from an RNA molecule with the sequence 5'AUUGACGGU3'? A.3'UAACUGCCA5'. B.5'TTTCTGCCT3'. C.3'TAACTGCCA5'. D.5'ATTCAGCCT3'. E.3'TUUCTGCCU5'.
C.3'TAACTGCCA5'.
When CO2 is added to RuBP, the first stable product synthesized is: A.Pyruvate B.Glyceraldehyde 3-phosphate C.3-Phosphoglycerate D.ATP
C.3-Phosphoglycerate
A species that three sets of homologous chromosomes can have __ different combinations of chromosomes in its gametes? A.3 B.6 C.8 D.9
C.8
In the ABO blood type system, A.A, B, and O are codominant B.A, B, and O are incompletely dominant C.A and B are codominant D.O is incompletely dominant to A and B E.A is dominant to B, and B is dominant to O
C.A and B are codominant
In humans, the male has an X and a Y sex chromosome. The human female has two X chromosomes. In birds, the female has a Z and a W sex chromosome while the male has two Z chromosomes. Which of the following statements is accurate about which parent determines the sex of the offspring based on inheritance of the necessary sex chromosome? A. In humans and birds, the male determines the sex of all the offspring. B.In humans and birds, the female determines the sex of all the offspring. C.In humans, the male determines the sex of the offspring, and in birds the female determines the sex. D.In humans, the female determines the sex of the offspring, and in birds the male determines the sex.
C.In humans, the male determines the sex of the offspring, and in birds the female determines the sex.
Both C4 and CAM plants solve the problem of photorespiration by A.Fixing most of their CO2 at night B.Closing their stomata during the day C.Increasing the CO2/O2 ratio for RuBisCO D.Using more sunlight
C.Increasing the CO2/O2 ratio for RuBisCO
Which of the following is true of quaternary structure? A.Found in all proteins B.Only found in eukaryotic proteins C.Involves more than one polypeptide chain D.Is a type of ionic bond
C.Involves more than one polypeptide chain
Height and eye colors are two examples of continuous variation in humans. Whereas in pea plants the tall allele is dominant over the short allele, there are no intermediate heights in peas. Which of the following is the best explanation for the differences described above? A.The intermediate size pea plant seeds are aborted within the seedpod and thus will never develop. B.The intermediate size pea plant seeds have deleterious alleles that prevent them from germinating. C.Many genes, rather than one gene for a characteristic, control some variations in species. D.These variations in humans are affected by lack of dominance in the alleles that control these traits.
C.Many genes, rather than one gene for a characteristic, control some variations in species.
What structure is not found in all cells? A.Plasma membrane B.Ribosomes C.Mitochondria D.DNA
C.Mitochondria
Which of the following components are to nucleic acids what R-groups are to amino acids? A.Ribose/deoxyribose B.Phosphate C.Nitrogenous base D.Nucleoside E.Nucleotide
C.Nitrogenous base
Which of the following components differs between the different nucleotides of DNA? A.Ribose/deoxyribose B.Phosphate C.Nitrogenous base D.Covalent bonds holding them together
C.Nitrogenous base
Which of the following statements correctly describes the use of ligand-gated ion channel receptors? A.Ligand binding is irreversible, resulting in a permanent change in this ion channel's activity. B.The binding site of this type of receptor is most often in the middle of the membrane. C.Once the ligand is bound, the ion channel activity can alter the cytosolic concentration of the ion. D.The ligand involved is often a phosphategroup that is covalently added to thecytosolic side of this ion channel.
C.Once the ligand is bound, the ion channel activity can alter the cytosolic concentration of the ion.
Which of the following statements about Mendelian genetics is false? A.Alternative forms of genes are called alleles B.A locus is a gene's location on its chromosome C.Only two alleles can exist for a given gene in a population D.A genotype is a description of the alleles that represent an individual's genes E.Individuals with the same phenotype can have different genotypes
C.Only two alleles can exist for a given gene in a population
Which bond is used to hold together the backbone of a single DNA strand? A.Hydrogen B.Peptide C.Phosphodiester D.Glycosidic
C.Phosphodiester
Which bond is used to hold together the backbone of a single protein strand? A.Hydrogen B.Peptide C.Phosphodiester D.Glycosidic
C.Phosphodiester
Which of the following is true for carbon fixation? A.Produces ATP B.Occurs only in the dark C.Produces NADP+ D.Requires photons directly
C.Produces NADP+
In the process of transcription, _____. A.DNA is replicated B.RNA is duplicated C.RNA is synthesized D.mRNA attaches to ribosomes
C.RNA is synthesized
Which of the following statements about sister chromatids is true? A.Sister chromatids are produced during mitosis. B.Sister chromatids are held together by complementary base pairing of DNA at the centromere. C.Sister chromatids are copies of each other and are formed just prior to cell division. D.After mitosis, sister chromatids contain different versions, or alleles, of the same genes.
C.Sister chromatids are copies of each other and are formed just prior to cell division.
Which molecule is used to mark or label proteins for destruction? A.Proteases B.Proteasome C.Ubiquitin D.Methylation
C.Ubiquitin
SRY is best described as _____. A.a gene present on the X chromosome that triggers female development B.an autosomal gene that is required for the expression of genes on the Y chromosome C.a gene region present on the Y chromosome that triggers male development D.an autosomal gene that is required for the expression of genes on the X chromosome
C.a gene region present on the Y chromosome that triggers male development
In sickle cell anemia, the defective hemoglobin differs from the normal hemoglobin by A.the color of the pigment. B.the size of the molecule. C.a single amino acid substitution. D.the total number of amino acids. E.the type of blood cell it is found in
C.a single amino acid substitution.
The function of NAD+ is to A.cause the release of energy to adjacent cells when energy is needed in aerobic conditions. B.hasten the release of energy when the cell has been deprived of oxygen. C.carry hydrogen atoms and free energy from compounds being oxidized and to give hydrogen atoms and free energy to compounds being reduced. D.block the release of energy to adjacent cells.
C.carry hydrogen atoms and free energy from compounds being oxidized and to give hydrogen atoms and free energy to compounds being reduced.
Organisms generally have many more genes that assort independently than the number of chromosomes. This phenomenon is due to A.independent assortment. B.segregation. C.crossing over. D.epistasis. E.pleiotropy.
C.crossing over.
Animal cells typically achieve cytokinesis by A.binary fission. B.forming a cell plate across the middle of the cell. C.forming a cleavage furrow that pinches the cell into two. D.chromosome condensation.
C.forming a cleavage furrow that pinches the cell into two.
One difference between mitosis and meiosis I is that A.homologous chromosome pairs synapse during mitosis B.chromosomes do not replicate in the interphase preceding meiosis I C.homologous chromosome pairs synapse during meiosis but not during mitosis D.spindles composed of microtubules are not required during meiosis E.sister chromatids separate during meiosis but not during mitosis
C.homologous chromosome pairs synapse during meiosis but not during mitosis
The human X and Y chromosomes _____. A.are both present in every somatic cell of males and females B.are the same size and have the same number of genes C.include genes that determine an individual's sex D.are called autosomes
C.include genes that determine an individual's sex
All of the following are examples of monomer: polymer pairings except A.amino acids: proteins. B.nucleotides: DNA. C.monosaccharides: polypeptide. D.glucose: starch
C.monosaccharides: polypeptide.
At the end of cytokinesis II of meiosis, each of the four resulting cells contains A.one full set of chromosomes, each with two chromatids. B.two full sets of chromosomes, each with two chromatids. C.one full set of chromosomes, each a single chromatid. D.two full sets of chromosomes, each a single chromatid. E.a different number of chromosomes.
C.one full set of chromosomes, each a single chromatid.
At the end of meiosis and cytokinesis, each of the four resulting cells contains A.one full set of chromosomes, each with two chromatids. B.two full sets of chromosomes, each with two chromatids. C.one full set of chromosomes, each a single chromatid. D.two full sets of chromosomes, each a single chromatid.
C.one full set of chromosomes, each a single chromatid.
Semiconservative replication involves a template. What is the template? A.single-stranded binding proteins B.DNA polymerase C.one strand of the DNA molecule D.an RNA molecule
C.one strand of the DNA molecule
A polymer with the sequence 5' ACGTACGAATAG 3' is a A.protein. B.piece of RNA. C.piece of DNA. D.polysaccharide.
C.piece of DNA.
Transcription factors are A.RNA sequences that bind to RNA polymerase B.DNA sequences that regulate transcription C.proteins that bind to regulatory DNA sequences D.polysaccharides that bind to the transcripts
C.proteins that bind to regulatory DNA sequences
Crossing spherical-seeded pea plants with wrinkled-seeded pea plants resulted in progeny that all had spherical seeds. This indicates that the wrinkled-seed trait is A.neutral B.dominant C.recessive D.environmental
C.recessive
Glycogen is to animal cells as ________ is to plant cells A.lipid B.cellulose C.starch D.protein
C.starch
Recombination between linked genes comes about for what reason? A.Nonrecombinant chromosomes break and then rejoin with one another. B.Independent assortment sometimes fails. C.Linked genes travel together at anaphase. D.Crossovers between these genes result in chromosomal exchange.
D.Crossovers between these genes result in chromosomal exchange.
Nearsightedness is dominant to normal vision and hazel eyes are dominant to blue eyes. A nearsighted woman with hazel eyes who is heterozygous for both traits marries a man with normal vision and hazel eyes. His genotype for eye color is the same as his wife's. Their three children all have blue eyes and normal vision. What is the probability that their next child will have blue eyes and be nearsighted? A.1/4 B.1/2 C.3/8 D.1/8 E.5/8
D.1/8
In guppies, fan tail is dominant to flesh tail, and rainbow color is dominant to pink. F1 female guppies are crossed with flesh-tailed, pink-colored males, and the following progeny are observed: 98 fan-tailed, pink-colored; 102 flesh-tailed, rainbow-colored; 399 flesh-tailed, pink-colored; and 401 fan-tailed, rainbow-colored guppies. Assuming that the F1 female guppies have both dominant alleles on one chromosome, the map distance between these two genes is A.80 cM B.25 cM C.0.8 cM D.20 cM
D.20 cM
In a lecture class with an engaging and clear teacher, what fraction of the new material presented during the semester does a student typically learn? A.90% B.70% C.50% D.25% E.15%
D.25%
Which of the following DNA sequences is complementary to 5' ATGGTCAGT 3'? A.5' ATGGTCAGT 3' B.5' TGACTGGTA 3' C.5' TACCAGTCA 3' D.5' ACTGACCAT 3'
D.5' ACTGACCAT 3'
A dominant allele K is necessary for normal hearing. A dominant allele M on a different locus results in deafness no matter which other alleles are present. If a kkMm individual is crossed with a Kkmm individual, _______ percent of the offspring will be deaf. A.0 B.25 C.50 D.75 E.None of the above
D.75
Between which two genes below would you expect the highest frequency of recombination? A.A and W B.E and G C.A and E D.A and G
D.A and G
Pyruvate oxidation produces all of the following except A.NADH B.acetyl-CoA C.CO2 D.ATP
D.ATP
Which of the following is not produced by the Krebs cycle? A.ATP B.NADH C.FADH2 D.Acetyl-CoA E.CO2
D.Acetyl-CoA
How does RuBisCO "decide" whether to act as an oxygenase or a carboxylase? A.Rubisco has 10 times more affinity for O2 than CO2; therefore, it favors O2 fixation B.If O2 is relatively abundant, rubisco acts as a carboxylase C.If O2 predominates, rubisco fixes it and the Calvin-Benson cycle occurs D.As the ratio of CO2 to O2 falls in the leaf, the reaction of rubisco with O2 is favored and photorespiration proceeds
D.As the ratio of CO2 to O2 falls in the leaf, the reaction of rubisco with O2 is favored and photorespiration proceeds
Which best describes what a plasma membrane-spanning receptor actually does upon reception of a signal? A.The receptor binds an extracellular signalmolecule and passes it into the cell. B.Activated receptors directly producea response to the signal. C.It uses the energy from the signal topower its transduction. D.Binding of the signal molecule alters thereceptor's other binding sites and activities.
D.Binding of the signal molecule alters thereceptor's other binding sites and activities.
Which of the following is true of sister chromatids? A.They are replicated chromosomes still joined together at the centromere B.They are nearly identical in mitotic chromosomes C.They are nearly identical in meiotic chromosomes D.Both A and B are true E.A, B, and C are all true
D.Both A and B are true
Which of the following statements about cyclin-dependent kinases (Cdks) or cyclin is false? A.Different Cdks act at different points in the cell cycle. B.A Cdk can catalyze the phosphorylation of other proteins. C.Cdks use ATP as a substrate. D.Cyclin is made continuously during the cell cycle.
D.Cyclin is made continuously during the cell cycle.
Which of the following DNA replicating enzymes is responsible for relieving the relieving the strain from rapid unwinding of the DNA molecule? A.DNA primase B.DNA polymerase I C.DNA helicase D.DNA gyrase E.Topoisomerase F.DNA ligase
D.DNA gyrase E.Topoisomerase
You are studying the effects of specific transcription factors on the activation of gene expression. You notice that one particular transcription factor binds far away from the promoter of its target gene. What can explain this? A.The transcription factor transcribes small RNAs that then bind to the promoter and activate the gene's expression. B.The transcription factor tags the enhancer with ubiquitin to stimulate transcription. C.RNA looping brings the transcription factor closer to the promoter and initiates gene transcription. D.DNA looping brings the transcription factor closer to the promoter and initiates gene transcription.
D.DNA looping brings the transcription factor closer to the promoter and initiates gene transcription.
If there are 1013 cells in the average human body and 46 chromosomes in each cell, which of the following distances is closest to the length of all that DNA in the human body? A.From Cincinnati to Cleveland and back B.From Cincinnati to Paris and back C.From Cincinnati to the moon and back D.From Cincinnati to the sun and back, seventy times
D.From Cincinnati to the sun and back, seventy times
Imagine that the TATA box for gene X becomes highly methylated. How will this affect the expression of gene X? A.There will be no effect. B.Gene X will be transcribed but not translated. C.Gene X will be transcribed if the transcription factors receive the appropriate environmental signal. D.Gene X will not be transcribed or translated.
D.Gene X will not be transcribed or translated.
Over time, natural selection eliminates individuals with detrimental phenotypes from a population. However, there are several examples in the human population in which harmful genetic polymorphisms are maintained. Why? A.Individuals with two wild type alleles have advantages over individuals carrying the harmful allele. B.Individuals with two harmful alleles have advantages over individuals carrying one copy of the harmful allele. C.Homozygous individuals have some other advantage over individuals with one wild type allele and one mutated allele. D.Heterozygous individuals have some other advantage over individuals with two wild type alleles.
D.Heterozygous individuals have some other advantage over individuals with two wild type alleles.
Huntington's disease is caused by a single dominant allele. It is a lethal disease, yet it persists in the human population. Which of the following statements best describes why? A.Huntington's disease is sex-linked and every human has at least one X chromosome; thus, the chances are extremely high for this allele to be maintained in the human population. B.Huntington's disease can present symptoms so mild that they appear to lack dominant expression of the allele in some individuals; in those cases, the allele is passed on to the offspring. C.While lethal to a parent, Huntington's disease will not be lethal to the offspring since it can skip a generation. D.Huntington's disease presents symptoms in midlife, after most people have already had offspring.
D.Huntington's disease presents symptoms in midlife, after most people have already had offspring.
Which statement about an individual that is homozygous for an allele is false? A.Each of its cells possesses two copies of that allele B.Each of its gametes contains one copy of that allele C.It is true-breeding with respect to that allele D.Its parents were necessarily homozygous for that allele E.It can pass that allele to its offspring
D.Its parents were necessarily homozygous for that allele
For glycolysis to continue, all cells require A.a respiratory chain. B.oxygen. C.mitochondria. D.NAD+.
D.NAD+.
The ABO blood groups in humans are determined by a multiple allelic system in which A and B are codominant, and are dominant to O. If an infant born to a type O mother also is type O, possible phenotypes for the father are A.O or A B.A or B C.O only D.O, A, or B E.impossible to determine
D.O, A, or B
Which of the following is not an input to photosynthesis? A.CO2 B.H2O C.Light D.O2
D.O2
Let P = purple flowers and p = white, and T = tall plants and t = dwarf. What combinations of gametes could be produced by a heterozygote for both the traits A.PpTt only B.Pp, Tt C.P, p, T, t D.PT, Pt, pT, pt
D.PT, Pt, pT, pt
Which of the following is found in all prokaryotes? A.Cell wall B.Flagella C.Nucleus D.Plasma membrane
D.Plasma membrane
Which is not a component of the translation machinery? A.mRNA B.tRNA C.Ribosomes D.Protein polymerase
D.Protein polymerase
What is the oxidizing agent in the following reaction?Pyruvate + NADH + H+ → Lactate + NAD+ A.NADH B.NAD+ C.Lactate D.Pyruvate
D.Pyruvate
ATP hydrolysis may be written as: ATP + H2O → ADP + Pi (reaction 1) and the phosphorylation of glucose by: glucose + Pi → glucose 6-phosphate + H2O (reaction 2). Which statement about these two reactions is false? A.The sum of reactions 1 and 2 is: ATP + glucose + H2O → ADP + glucose 6-phosphate (reaction 3) B.Reaction 1 is exergonic C.Reaction 2 is endergonic D.Reaction 3 has a positive ΔG
D.Reaction 3 has a positive ΔG
Which of the following statements is false concerning sister chromatids? A.The formation of sister chromatids doubles the amount of DNA in a cell. B.Sister chromatids are held together at the centromere by cohesin proteins. C.Sister chromatids are formed during the S phase of the cell cycle. D.Sister chromatids separate during telophase.
D.Sister chromatids separate during telophase.
Which of the following is not found in DNA? A.Carbon B.Oxygen C.Nitrogen D.Sulfur E.Phosphorus
D.Sulfur
The most accurate nucleotide base composition of the DNA double helix is A.G=A B.T=C C.T+A=C+G D.T+G=A+C E.A=U
D.T+G=A+C
Which of the following is essentially the reverse of prophase? A.Anaphase B.Interphase C.Metaphase D.Telophase E.Cytokinesis
D.Telophase
Which of the following statements best fits as an analogy for a cell with a mutation in a tumor-suppressor gene? A.The gas pedal of a car gets stuck while pushed down. B.The gas pedal of a car does not work at all. C.The brake pedal of a car gets stuck while pushed down. D.The brake pedal of a car does not work at all.
D.The brake pedal of a car does not work at all.
A couple has a child with Down syndrome. The mother is 39 years old at the time of delivery. Which of the following is the most probable cause of the child's condition? A.The woman inherited this tendency from her parents. B.The mother had a chromosomal duplication. C.One member of the couple underwent nondisjunction in somatic cell production. D.The mother most likely underwent nondisjunction during gamete production.
D.The mother most likely underwent nondisjunction during gamete production.
Which of the following is not a misconception that applies to evolution in general and Dr. Lenski's experiments in particular? A.Individual bacterial cells are evolving. B.Species of bacteria that try harder (through metabolic regulation) are able to evolve faster and thus get what they need to survive. C.It has been nearly impossible to observe evolution since it occurred so long ago and is a very slow process, if it occurs at all. D.The populations of bacteria did not evolve by chance, but rather those cells that were able to survive and reproduce better, due to chance mutations, were able to increase in number
D.The populations of bacteria did not evolve by chance, but rather those cells that were able to survive and reproduce better, due to chance mutations, were able to increase in number
During which phase of the cell cycle are mitochondria and chloroplasts distributed equally among daughter cells? A.G2 B.M C.C D.There is no mechanism to distribute mitochondria and chloroplasts equally among daughter cells.
D.There is no mechanism to distribute mitochondria and chloroplasts equally among daughter cells.
Photosynthesis is the process that uses light energy to extract hydrogen atoms from which of the following sources? A.Glucose B.Chlorophyll C.CO2 D.Water
D.Water
A steroid hormone is bound by an intracellular receptor. When it does, the resulting complex is most likely to do which of the following? A.open channels in the membrane for other substances to enter B.open channels in the nuclear envelope for cytoplasmic molecules to enter C.mediate the transfer of phosphate groups to/from ATP D.act as a transcription factor in the nucleus E.make water-soluble molecules able to diffuse across membranes
D.act as a transcription factor in the nucleus
The mechanism by which the inducer causes the repressor to detach from the operator is an example of A.catabolite repression B.transcription C.transposition D.allosteric regulation E.recombination
D.allosteric regulation
A sequence of three RNA bases can function as a A.codon B.anticodon C.gene D.both 1 and 2 E.both 1 and 3 F.1, 2, and 3
D.both 1 and 2
Fats and oils all contain three A.glycerol molecules B.phosphate groups C.glucose molecules D.fatty acids
D.fatty acids
Crossing over involves the exchange of genetic material between A.sister chromatids B.males and females C.sex chromosomes D.homologous chromosomes
D.homologous chromosomes
A bacterial gene regulatory system is likely to have all of the following except A.genes. B.an operator. C.a promoter. D.introns. E.an operon
D.introns.
RNA polymerase does not have the ability to proofread like DNA polymerase does, therefore RNA polymerase makes a lot more mistakes. Why is that not a serious problem compared to a lack of proofreading ability in DNA polymerase? A.Cells have a backup copy of DNA so making mistakes is not a big issue B.Redundancy (or wobble) in the genetic code eliminates the impact of mistakes in mRNA synthesis C.The RNA polymerase has 3' to 5' exonuclease activity, allowing it to fix mistakes. D.mRNA is made in large amounts, and is not passed down to daughter cells like DNA is, so mistakes can be tolerated.
D.mRNA is made in large amounts, and is not passed down to daughter cells like DNA is, so mistakes can be tolerated.
Males are more often affected by sex-linked traits than females because _____. A.male hormones such as testosterone often alter the effects of mutations on the X chromosome B.female hormones such as estrogen often compensate for the effects of mutations on the X chromosome C.X chromosomes in males generally have more mutations than X chromosomes in females D.males are hemizygous for the X chromosome
D.males are hemizygous for the X chromosome
The enzymes of the citric acid cycle are located in the A.cytoplasm. B.inter-membrane space of mitochondria. C.vesicles of the ER. D.matrix of the mitochondria.
D.matrix of the mitochondria.
MAPK and MEK are intracellular signaling proteins that mediate cell division induced by growth factors. When mutations in the normal MAPK and MEK genes result in an abnormally high level of MAPK and MEK activity and an increased rate of cell division, then the mutated gene is called a(n) A.spliceosome. B.transposon. C.tumor-suppressor gene. D.oncogene.
D.oncogene.
A chromatid is A.one of the pairs of homologous chromosomes. B.a homologous chromosome. C.a newly replicated bacterial chromosome. D.one-half of a newly replicated eukaryotic chromosome.
D.one-half of a newly replicated eukaryotic chromosome.
A(n) ____ is to a nucleotide as a glycosidic linkage is to a sugar. A.ester bond B.peptide bond C.hydrogen bond D.phosphodiester bond
D.phosphodiester bond
Cytokinesis occurs right after A.prophase B.G2 C.anaphase D.telophase
D.telophase
The graph represents the concentration of cyclins over the course of the cell cycle. Which of the following statements is true regarding the phase of the cell cycle where the red (or left) arrow is pointing? At this point in the cell cycle, A.all sister chromatids are fully formed. B.DNA has already been replicated correctly. C.chromosomes have properly aligned on the metaphase plate and are beginning to separate. D.the cell is determining if conditions are favorable for cell division.
D.the cell is determining if conditions are favorable for cell division.
One of the main reasons genes assort independent of one another is that A.they produce unrelated traits. B.they are on the same chromosome. C.they are different alleles. D.they are on different chromosomes.
D.they are on different chromosomes.
Cleft chin is a sex-linked dominant trait. A man with a cleft chin marries a woman with a round chin. What percent of their female progeny will show the cleft chin trait? A.0 B.25 C.50 D.75 E.100
E.100
Which sequence of events correctly describes the initiation and elongation steps of translation in prokaryotic cells? (1) initiator tRNA binds start codon on mRNA (2) small ribosomal subunit binds to mRNA (3) large ribosomal subunit binds (4) tRNA entry and peptidyl transfer reaction (5) translocation of ribosome and release of tRNA A.1, 2, 3, 4, 5 B.1, 2, 3, 5, 4 C.1, 3, 2, 4, 5 D.2, 3, 1, 5, 4 E.2, 1, 3, 4, 5
E.2, 1, 3, 4, 5
In cocker spaniels, black color (B) is dominant over red (b), and solid color (S) is dominant over spotted (s). If the offspring between BBss and bbss individuals are mated with each other, what fraction of their offspring will be expected to be black and spotted? A.1⁄16 B.9⁄16 C.1⁄9 D.3⁄16 E.3⁄4
E.3⁄4
The number of codons that actually specify amino acids is A.20 B.23 C.45 D.60 E.61 F.64
E.61
A particular cell has half as much DNA as other cells in a mitotically active tissue. The cell in question is most likely in A.anaphase. B.prophase. C.G2. D.metaphase. E.G1.
E.G1.
Based on the gene and protein sequences that follow, what type of mutation has occurred and what is the effect on the polypeptide? Normal gene: ATGGCCGGCCCGAAAGAGACC Mutated gene: ATGGCCGGCACCGAAAGAGACC Normal protein: Met-Ala-Gly-Pro-Lys-Glu-Thr Mutated protein: Met-Ala-Gly-Thr-Glu-Arg-Asp A.base addition - silent B.substitution - missense C.base addition - missense D.substitution - nonsense E.base addition-frameshift
E.base addition-frameshift
Sudan IV, a dye that binds to nonpolar molecules, is used to detect the presence of macromolecules in food. Sudan IV would test positive in the presence of what macromolecule? A.Starch B.DNA C.Chitin D.Hemoglobin E.fats
E.fats
Sports physiologists at an Olympic training center wanted to monitor athletes to determine at what point their muscles were functioning anaerobically. They could do this by checking for the buildup of which molecule? A.ATP B.carbon dioxide C.ADP D.oxygen E.lactate
E.lactate
The end-product of glycolysis is A.oxaloacetate. B.NAD+. C.alcohol. D.ADP. E.pyruvate F.glucose.
E.pyruvate
In the cyclic reaction sequence called the Krebs cycle, the following chemical events take place except A.the acetyl group is joined with a four carbon molecule, oxaloacetate B.the resulting six carbon molecule is oxidized C.electrons generated are used to produce NADH D.two carbons per cycle are made into CO2 molecules E.pyruvate molecules are restored to the cycle
E.pyruvate molecules are restored to the cycle