Bio 121 Unit 6: Genetic Technology

Q62: A patient is admitted to the hospital with a mysterious infection. After running some standard tests, doctors believe that the infection is caused by one of three closely-related bacterial strains - A, B, or C - that are hard to treat because they have become resistant to some antibiotics. Strain A is resistant to antibiotic beta and antibiotic omega Strain B is resistant to antibiotic alpha and antibiotic omega Strain C is resistant to antibiotic alpha and antibiotic beta To make sure they treat the infection with the correct drug, doctors order DNA fingerprinting of a sample of bacteria taken from the patient for comparison to known fingerprints of strains A, B, and C. With which antibiotic should the patient be treated? Picture A. antibiotic alpha B. antibiotic beta C. antibiotic omega D. antibiotic beta or antibiotic omega E. any antibiotic will work to kill the bacteria causing the infection

A. antibiotic alpha

Q46: Gene replacement _____ occurs when a cloned gene recombines with the normal gene on a chromosome to create a genetically modified organism (GMO). A. gene replacement B. gene knockout C. transformation D. infection E. transfection

A. gene replacement

Q58: Which of the following is an example of a clone on the organism level? A. identical twins B. fraternal twins C. two plants of the same species D. offspring with characteristics of both parents E. chicks hatched from the same mother

A. identical twins

Q2: Gene cloning A. is the process of making multiple copies of a gene B. is the process of isolating a particular gene of interest C. is the process of determining the nucleotide sequence of a gene of interest D. is the process of taking a gene of interest in one organism and putting it into another organism E. is the process of making an organism that is genetically identical to its parent and its siblings

A. is the process of making multiple copies of a gene

Q48: The FtsZ gene in bacteria encodes an ancestral tubulin that is important in binary fission (the mechanism of cell division in prokaryotes). To study the FtsZ gene in eukaryotes, researchers made an FtsZ knockout in the moss Physcomitrella patens. What is the most likely phenotype of the knockout moss? A. its cells won't divide normally, because like prokaryotic cells, plant cells have cell walls B. its chloroplasts won't divide normally, because chloroplasts used to be free-living prokaryotes xxx C. there will be no effect because a knockout plant will make half the normal amount of protein D. the plant will die, because knocking out any gene is lethal for an organism E. there will be no effect because tubulin is not required by cells

A. its cells won't divide normally, because like prokaryotic cells, plant cells have cell walls

Q3: Which of the following vectors must be transformed to get into bacterial cells? A. plasmid B. yeast C. virus D. bacteriophage xxx E. fungus

A. plasmid

Q50: Which of the following is an advantage of molecular pharming compared to expression of mammalian proteins in bacteria? A. proteins are more likely to function properly when expressed in mammals B. mammalian and bacterial genes use different genetic codes C. post-translational modifications do not occur in mammals D. mammals are easier to grow in the lab than bacteria E. molecular pharming is cheaper than growing bacteria xxx

A. proteins are more likely to function properly when expressed in mammals

Q32: What type of science is a researcher performing if she is conducting experiments to try and map the location of a gene on a particular chromosome? A. structural genomics B. transcriptomics C. proteomics D. functional genomics E. metabolomics

A. structural genomics

Q56: You wish to express gene X in soybeans. You clone gene X into a Ti plasmid (shown below), transform the recombinant plasmid into Agrobacterium tumefaciens, treat soybean cells with the transformed A. tumefaciens, and place the cells on medium containing the antibiotics kanamycin and carbencillin. What is the purpose of these two antibiotics? Picture A. the carbenicillin ensures that the cells contain a Ti plasmid and the kanamycin ensures that the cells have a recombinant Ti plasmid B. the carbenicillin and kanamycin both ensure that the cells picked up recombinant T DNA C. the kanamycin ensures that the cells contain recombinant T-DNA and the carbenicillin kills the A. tumefaciens xxx D. the carbenicillin ensures that the cells contain recombinant T-DNA and the kanamycin kills the A. tumefaciens xxx E. the carbenicillin and kanamycin both kill the A. tumefaciens xxx

A. the carbenicillin ensures that the cells contain a Ti plasmid and the kanamycin ensures that the cells have a recombinant Ti plasmid

Q23: A probe is a segment of DNA that is complementary to a gene of interest. A researcher uses a probe complementary to the cytochrome c gene and performs a colony hybridization on bacteria that carry a horse genomic library. What can be concluded about a colony that binds to the probe? A. the horse cytochrome c gene is on a plasmid found in the bacteria. B. the bacteria are producing horse cytochrome c mRNA. xxx C. the bacteria are producing horse cytochrome c protein. xxx D. the horse cytochrome c gene is in the bacterial chromosome. xxx E. the bacteria contain a plasmid that allows them to grow in the presence of the probe

A. the horse cytochrome c gene is on a plasmid found in the bacteria.

Q63: The first human gene therapy was approved for patients suffering ADA (adenosine deaminase) deficiency. In this therapy, lymphocytes were removed from the patient, the normal ADA gene was put into the cells, and the cells were returned to the bloodstream. How was the normal ADA put into the lymphocytes? A. via a viral vector B. microinjection C. via a plasmid vector D. via the polymerase chain reaction E. by fusing normal lymphocytes with deficient lymphocytes

A. via a viral vector

Q27: You have the following DNA template and want to use PCR to amplify the double-stranded region that is underlined. Which of the following primers should you use? 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5' A. 5' - AGGGC- 3' and 5' -GATTG- 3' xxx B. 5' -CAATC- 3' and 5' -GCCCT- 3' C. 3' -CAATC- 5' and 3' -GCCCT- 5' D. 3' - AGGGC- 5' and 3' -GATTG- 5' E. 5' -GTTAG -3' and 5' -ATCCC -3'

B. 5' -CAATC- 3' and 5' -GCCCT- 3'

Q8: Which of the following stretches of double-stranded DNA is mostly likely to be recognized as a restriction enzyme cutting site and create fragments with sticky ends? A. 5′-GTTCAT-3′ 3′-CAAGTA-5′ xxx B. 5′-TCCGGA-3′ 3′-AGGCCT-5′ C. 5′-ACCCCT-3′ 3′-TGGGGA-5′ D. 5′-GAATCG-3′ 3′-CTTAGC-5′ E. 5′-TTTTTT-3′ 3′-AAAAAA-5′

B. 5′-TCCGGA-3′ 3′-AGGCCT-5′

Q51: A researcher wants to introduce the human gene encoding tissue plasminogen activator (used to dissolve blood clots) into a mammal so that the protein will be secreted into the milk of the mammary gland. What is required for the researcher's success? A. The gene should be placed a considerable distance away from the promoter of a gene that is expressed in mammary cells xxx B. The gene should be placed next to the promoter of a gene that is expressed in mammary cells C. The gene should be placed a considerable distance away from the promoter of a gene that is expressed in multiple types of cells D. The gene should be placed next to the promoter of a gene that is expressed in multiple types of cells E. The gene should be inserted in place of the promoter of a gene that is expressed in multiple types of cells xxx

B. The gene should be placed next to the promoter of a gene that is expressed in mammary cells

Q47: The FtsZ gene in bacteria encodes an ancestral tubulin that is important in binary fission (the mechanism of cell division in prokaryotes). To study the FtsZ gene in eukaryotes, researchers made an FtsZ knockout in the moss Physcomitrella patens. Which of the following statements about this knockout plant is accurate? A. The knockout plant is heterozygous for an abnormal FtsZ gene xxx B. The knockout plant does not produce any normal FtsZ protein C. The knockout plant contains a copy of the bacterial FtsZ gene D. The knockout plant makes bacterial FtsZ protein E. The knockout plant makes half the normal amount of FtsZ protein

B. The knockout plant does not produce any normal FtsZ protein

Q45: Deinococcus radiodurans is a prokaryote that is naturally resistant to radiation. The E. coli mercuric reductase gene has been engineered into D. radiodurans, making D. radiodurans able to detoxify the ionic mercury often produced as result of the manufacture of nuclear weapons. This is an example of A. contig mapping B. bioremediation C. reproductive cloning D. gene therapy E. molecular pharming

B. bioremediation

Q55: Which of the following statements about the modified Ti plasmid used to make transgenic plants is NOT accurate? A. it is derived from a plasmid found in the bacterium Agrobacterium tumefaciensxxx B. it causes crown gall formation C. it contains a screenable marker gene xxx D. it contains a T-DNA region that integrates into the plant cell's genome xxx E. it contains unique restriction enzyme recognition sites for inserting a gene of interest xxx

B. it causes crown gall formation

Q18: A plasmid that has genes for both tetracycline resistance and ampicillin resistance is cut with the restriction enzyme BamHI. BamHI cuts within the ampicillin resistance gene. Caenorhabditis elegans DNA that has been cut with BamHI is ligated into the linearized plasmid to make a genomic DNA library. The mixture is transformed into E. coli. Which antibiotic should be added to the medium to select cells that contain the recombinant plasmid? A. ampicillin and tetracycline xxx B. tetracycline C. X-gal D. ampicillin E. neither ampicillin or tetracycline xxx

B. tetracycline

Q59: Which of the following accurately describes the process used to make Dolly the sheep? A. Mitochondrial DNA was taken from one female and injected into the mammary of another female. xxx B. A sheep embryo was produced by in vitro fertilization. At an early stage, the cells of the embryo were separated, and each cells was put into a surrogate sheep mother. xxx C. A mammary cell of one sheep was fused with an enucleated egg of another sheep. The resulting diploid embryo was placed in a surrogate sheep mother. D. A set of twins - one male and one female - were mated. Since the twins had identical DNA, their lamb was a clone. E. The sheep to be cloned was given a drug that induced the cells of her ovary to divide by binary fission. The resulting diploid eggs did not need to be fertilized.

C. A mammary cell of one sheep was fused with an enucleated egg of another sheep. The resulting diploid embryo was placed in a surrogate sheep mother.

Q31: Dideoxy nucleotides are used in which of the following processes? A. Microarray analysis B. Transformation C. DNA sequencing D. PCR xxx E. making a recombinant plasmid

C. DNA sequencing

Q35: You are performing a DNA sequencing reaction and add dideoxy cytosine to one tube. What can you conclude about the products of the reaction? A. They will all be the same size and end in a C. B. No product will be formed. C. They will be of different sizes, all ending in a C. D. They will all be the same size and end in a G. E. They will be of different sizes, all ending in a G. xxx

C. They will be of different sizes, all ending in a C.

Q57: The bacterium Alcaligenes eutrophus naturally produces polyhydroxybutyrate (PHB), a biodegradable thermoplastic. In 1992, Poirier, et al., reported in the journal Science that the two genes responsible for the production of PHB in bacteria had been introduced into the plant Arabidopsis thaliana, and it was demonstrated that the plants produced PHB. What type of vector was likely used to introduce the bacterial genes into the A. thaliana? (Poirier, Dennis, Klomparens, Somerville. 1992. Polyhydroxybutyrate, a biodegradable thermoplastic, produced in transgenic plants. Science. 256: 520-523.) A. BAC xxx B. YAC C. Ti plasmid D. viral vector E. BAC or YAC xxx

C. Ti plasmid

Q24: Following treatment with restriction enzymes, what procedure would be used to separate DNA fragments of different lengths? A. transformation B. transfection C. gel electrophoresis D. polymerase chain reaction E. microarray analysis

C. gel electrophoresis

Q20: Which of the following would NOT be true of cDNA produced using horse liver tissue as a starting material? A. it could be used to create a library of genes expressed in horse liver B. it is produced from mRNA using reverse transcriptase C. it contains genes from horse liver cells with both exons and introns D. it is a copy of an mRNA expressed in horse liver cells E. it can be sequenced using the dideoxy chain-termination method

C. it contains genes from horse liver cells with both exons and introns

Q49: The protein p53 is a tumor suppressor - it regulates the cell cycle and is important in preventing cancer in humans. What phenotype would you expect in p53 knockout mice? A. p53 knockout mice would not be helpful in the study of a human disease B. p53 knockout mice would not get cancer C. p53 knockout mice would be more susceptible to cancers D. p53 knockout mice would not be able to go through meiosis E. p53 knockout mice would not be able to go through mitosis

C. p53 knockout mice would be more susceptible to cancers

Q54: Why is the production of transgenic plants somewhat easier than the production of transgenic animals? A. plant cells lack cell walls, so uptake of DNA is easier than in animal cellsxxx B. plant cells are more stable than animal cells xxx C. plant cells are totipotent D. plant cells are more highly evolved as they contain both chloroplasts and mitochondria E. all of the above are reasons why plant cells are more easily transformed than animal cells xxx

C. plant cells are totipotent

Q25: You cut a plasmid with a restriction enzyme that cuts it into three pieces - one fragment is 240 base pairs, one fragment is 600 base pairs, and one fragment is 1200 base pairs. You carry out electrophoresis of the digested sample. Which of the fragments will be closer to the top of the gel where the sample was inserted? A. the 240 base pair fragment B. the 600 base pair fragment C. the 1200 base pair fragment D. they will all be near the top because they all have sticky ends E. it depends on the charge of the DNA fragment

C. the 1200 base pair fragment

Q52: The milk of goats has been genetically modified to produce human antithrombin, a protein with anticoagulant properties. How did the recombinant plasmid containing the human antithrombin gene get into the goats? A. the goats ingested bacterial pellets containing the recombinant plasmid, the DNA then integrated into their cells xxx B. the recombinant plasmid was injected into mammary cells xxx C. the recombinant plasmid was put into a goat oocyte, which was in turn fertilized and implanted into a surrogate goat mother D. the recombinant plasmid was put into a viral vector; the virus then infected the goat cells xxx E. the goat cells were treated with chemical agents such as calcium chloride, which made them competent to take up DNA xxx

C. the recombinant plasmid was put into a goat oocyte, which was in turn fertilized and implanted into a surrogate goat mother

Q6: Which of the following statements is TRUE of restriction enzymes? A. they cleave DNA only at sites of adjacent thymine bases xxx B. they are not naturally produced by bacteria, but are bioengineered by humans xxx C. they protect bacterial cells from invasion by foreign DNA D. they cut at random sites within a genome E. there are less than 10 restriction enzymes known xxx

C. they protect bacterial cells from invasion by foreign DNA

Q30: Primers are used in both PCR and in DNA sequencing. What is the purpose of the primers? A. to add nucleotides to a growing DNA strand xxx B. to separate the DNA template strands C. to provide a 3'- OH for DNA polymerase to build a new DNA strand D. to terminate synthesis of the growing DNA strand E. to separate various-sized DNA products

C. to provide a 3'- OH for DNA polymerase to build a new DNA strand

Q34: Under what circumstances would a molecular geneticist need to use a bacterial artificial chromosome (BAC)? A. when cloning small, prokaryotic genomes xxx B. when cloning small, eukaryotic genomes xxx C. when cloning large, eukaryotic genomes D. when the DNA inserts to be used for cloning are very small E. when sequencing small proteins

C. when cloning large, eukaryotic genomes

cDNA

Complementary DNA cDNA does not contain introns

Q37: Shown below is the output from an automated sequencing reaction. What is the sequence of the DNA template strand? Picture A. 5' - CCTGATAGAGTCTCCCT - 3' xxx B. 3' - CCTGATAGAGTCTCCCT - 5' xxx C. 3' - GGACTATCTCAGAGGGA - 5' D. 5' - GGACTATCTCAGAGGGA - 3' E. 5' - CCTGATAGAGTCTCCCT - 3' 3' - GGACTATCTCAGAGGGA - 5'

D. 5' - GGACTATCTCAGAGGGA - 3'

Q4: If a plasmid lacks an origin of replication which of the following will happen when it is transformed into bacteria? A. Bacteria containing the plasmid will not be able to grow in the presence of antibiotics. B. The plasmid will not be useful in producing a protein because it lacks an RNA polymerase binding site. C. There will not be regions to clone genes into the plasmid. D. As the bacteria divide they will lose the plasmid. E. The plasmid cannot be cut with restriction enzymes.

D. As the bacteria divide they will lose the plasmid.

Q12: You transform bacteria with a plasmid carrying the ampicillin-resistance gene ampR. How would you determine which bacteria took up the plasmid? A. Bacteria containing the plasmid would be able to grow in the absence of ampicillin. B. Bacteria containing the plasmid would turn blue. C. Ampicillin-resistance is necessary for the plasmid DNA to get into the bacteria. D. Bacteria containing the plasmid would be able to grow in the presence of ampicillin. E. Bacteria containing the plasmid would be able to produce ampicillin.

D. Bacteria containing the plasmid would be able to grow in the presence of ampicillin.

Q64: If you have a double stranded synthetic piece of DNA that you want to attach to a PCR product, which enzyme would you use? A. restriction enzyme xxx B. Taq DNA polymerase xxx C. reverse transcriptasexxx D. DNA ligase E. DNA polymerase xxx

D. DNA ligase

Q10: After a fragment of DNA containing the gene of interest has been inserted into a vector, how are the gaps between the two pieces of DNA sealed together? A. DNA polymerase catalyzes the formation of hydrogen bonds in the DNA backbone. xxx B. DNA gyrase creates tension in the DNA backbone to hold the molecule together. xxx C. DNA helicase causes the double helix to wind into its stable form. xxx D. DNA ligase catalyzes the formation of covalent bonds in the DNA backbone. E. Restriction enzymes have the ability to join the two DNA fragments. xxx

D. DNA ligase catalyzes the formation of covalent bonds in the DNA backbone.

Q28: You have the target DNA and primers shown below. You add the target DNA and primers, along with dATP, dTTP, dGTP, dCTP and Taq DNA polymerase to a test tube. After 30 cycles of PCR, which of the following is true about the DNA in your test tube? Target DNA: 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5' Primer 1: 5' - GATCAA - 3' Primer 2: 5' - CGGAAA - 3' A> There will be around a billion DNA molecules and most will look just like the template 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5' B. There will be around a billion DNA molecules and most will be single stranded, either 5' - CCGGATCAATCAATGCCGAATTTCCGTATAGGGCCTAGTAG - 3' OR 3' - GGCCTAGTTAGTTACGGCTTAAAGGCATATCCCGGATCATC - 5' C. Only the template and primers will be present; since no DNA helicase was added the strands won't separate so no new DNA can be made D. There will be around a billion DNA molecules and most will contain the region that is flanked by the primers 5' - GATCAATCAATGCCGAATTTCCG - 3' 3' - CTAGTTAGTTACGGCTTAAAGGC - 5' E. There will be around a million DNA molecules of various sizes, depending on where chain termination occurred xxx

D. There will be around a billion DNA molecules and most will contain the region that is flanked by the primers 5' - GATCAATCAATGCCGAATTTCCG - 3' 3' - CTAGTTAGTTACGGCTTAAAGGC - 5'

Q29: Why is Taq polymerase used in a polymerase chain reaction (PCR)? A. Taq polymerase has proofreading activity and thus makes fewer errors than other DNA polymerases. B. Unlike other DNA polymerases, Taq polymerase is not inhibited by dideoxy nucleotides. C. Taq polymerase can produce DNA from an RNA template, unlike other DNA polymerases. D. Unlike other DNA polymerases, Taq polymerase is heat stable and survives the 94 degree denaturation step in PCR. E. Taq polymerase is more efficient than other DNA polymerases.

D. Unlike other DNA polymerases, Taq polymerase is heat stable and survives the 94 degree denaturation step in PCR.

Q5: What is the advantage of using a viral vector over a plasmid vector in cloning a human gene? A. A viral vector contains circular DNA, thus it is easier to insert the gene of interest. xxx B. Viruses are easier to clone genes into than plasmids. xxx C. Viruses are smaller and easier to transform than plasmids. xxx D. Viruses can carry larger genes than plasmids. E. Only viruses can be used to express proteins. xxx

D. Viruses can carry larger genes than plasmids.

Q39: You are working in a cancer lab and are interested in identifying some genes that are important in the onset of lung cancer. You have several genes you think may be involved, so you "print" spots of the DNA sequences of interest on a microarray slide. After doing this, you isolate mRNA from both normal lung cells and cancerous lung cells. Before you use these mRNAs to probe the microarray slide, you need to do which of the following? A. make cDNA and amplify the cDNA using PCR xxx B. amplify the mRNA using PCR C. sequence the mRNA D. add reverse transcriptase and fluorescent nucleotides to the mRNA to make cDNA E. clone each mRNA into a BAC vector

D. add reverse transcriptase and fluorescent nucleotides to the mRNA to make cDNA

Q16: The lacZ gene encodes A. aromatase B. glucose dehydrogenase C. succinate dehydrogenase D. b-galactosidase E. carbonic anhydrase

D. b-galactosidase

Q33: What is required for a group of clones to be considered a contig? A. the clones need to have nonoverlapping regions of DNA B. the clones should contain identical regions of DNA C. the clones should contain completely unique regions of DNA D. the clones should have overlapping regions of DNA E. the clones should have identical, nonoverlapping regions of DNA

D. the clones should have overlapping regions of DNA

Q60: Short tandem repeat sequences (STRs) can be used for DNA fingerprinting because ____. A. they are found in different locations in individuals B. their DNA sequence varies between individuals C. they can be amplified by PCR xxx D. the number of repeats varies between individuals E. they are expressed at different levels in individualsxxx

D. the number of repeats varies between individuals

Q43: What is bioremediation? A. the production of recombinant bacteria to produce human proteins B. the use of genetic technology toQ engineer tissues to replace damaged organs C. the use of non-human organisms to produce medicine for human use D. the use of living organisms to detoxify pollutants in the environment E. the production of transgenic plants that are resistant to disease

D. the use of living organisms to detoxify pollutants in the environment

Q17: You cut some sheep DNA and some plasmid DNA with the same restriction enzyme. The plasmid contains an AmpR gene and a lacZ gene. You mix together the fragments of sheep DNA and the linearized plasmid. You transform bacteria with your mixture, and plate the bacterial cells on growth media containing the antiobiotic ampicillin and X-gal (the substrate of beta-galactosidase). You need to pick some bacterial colonies that contain recombinant plasmids. Which colonies do you choose? A. the blue colonies; any cells containing eukaryotic (sheep) DNA will be blue xxx B. any colony, all colonies will contain plasmids; it requires additional testing to determine if the plasmid is recombinant xxx C. any colony; if they grow on the media they are recombinant D. the white colonies; only cells that contain a recombinant plasmid will be white E. the large colonies; large colonies are more resistant to the antiobiotic and thus more likely to contain a recombinant plasmid xxx

D. the white colonies; only cells that contain a recombinant plasmid will be white

Q13: Restriction enzymes are invaluable tools in gene cloning because A. they cut both strands of DNA at specific sites B. they replicate the gene of interest C. they can produce sticky ends so DNA from different sources can be joined together D. they cut at specific sites within the DNA and produce sticky ends allowing DNA from different sources to be joined together E. they replicate the DNA of interest, they cut at specific sites within the DNA, and produce sticky ends allowing DNA from different sources to be joined together xxx

D. they cut at specific sites within the DNA and produce sticky ends allowing DNA from different sources to be joined together

Palindromic

Describing a section of double stranded DNA in which the sequence of bases on one strand is inverted and repeated on the other. Thus the following sequence is palindromic: ACTTGCAAGT TGAACGTTCA Palindromic sequences are common in DNA and are at the sites at which the DNA is cleaved by restriction enzymes.

Q44: How could bioremediation be used to treat an oil spill? A. By adding genes for enzymes to the oil spill to break down the petroleum hydrocarbons. B. By spreading enzymes on the oil spill that metabolize petroleum hydrocarbons. C. By sequencing the genes found in the oil spill to identify mutations. D. By creating bacteria that can produce petroleum hydrocarbons. E. By creating bacteria that can metabolize petroleum hydrocarbons.

E. By creating bacteria that can metabolize petroleum hydrocarbons.

Q14: You grow a culture of bacteria and split it into two culture tubes. One sample of bacteria you treat with calcium and the other is not treated. When you transform both samples with a plasmid, only the samples treated with calcium take up the plasmid. Which of the following best explain your results? A. The bacteria require calcium to grow. B. DNA is degraded in the absence of calcium. C. Calcium precipitates DNA, preventing it from being taken up by cells. D. The bacteria use calcium as a source of energy to take up the DNA. xxx E. The calcium makes the bacterial membrane more porous to DNA.

E. The calcium makes the bacterial membrane more porous to DNA.

Q1: In order to produce human insulin in bacteria what must be done first? A. The bacterial insulin gene must be cloned.xxx B. Bacteria containing the human insulin gene are grown.xxx C. Human insulin protein is purified from the bacteria. xxx D. The human insulin gene must be transformed into bacteria. xxx E. The human insulin gene must be cloned.

E. The human insulin gene must be cloned.

Q11: A plasmid vector and chromosomal DNA are treated separately with the same restriction enzyme. The digested plasmid and chromosomal DNA were incubated together with DNA ligase and transformed into bacteria. Plasmids isolated from some of the colonies do not contain inserted chromosomal DNA. Which of the following could explain this observation? A. The chromosomal DNA was very short and did not have any restriction sites for the enzyme used. B. The two sticky ends of the plasmid could hybridize to both sticky ends of the chromosomal DNA fragments. xxx C. The two sticky ends of the plasmid could hybridize with two ends of another type of plasmid. xxx D. The two sticky ends of the vector would remain free or unhybridized.xxx E. The two sticky ends of the plasmid could hybridize back together, recircularizing.

E. The two sticky ends of the plasmid could hybridize back together, recircularizing.

Q21: Which of the following statements about genomic libraries and cDNA libraries is TRUE? A. a cDNA library is derived from chromosomal DNA B. a genomic library is derived from mRNA C. a genomic library is made using reverse transcriptase D. a genomic library is derived from mRNA and is made using reverse transcriptase E. a cDNA library is derived from mRNA and is made using reverse transcriptase

E. a cDNA library is derived from mRNA and is made using reverse transcriptase

Q22: Which of the following is an advantage of cDNA libraries? A. cDNA lacks exons B. cDNA libraries are easy to make C. cDNA libraries are more stable than other DNA libraries D. cDNA libraries utilize genomic DNA, which is relatively easy to obtain E. cDNA only contains protein coding exons

E. cDNA only contains protein coding exons

Q42: Human growth hormone (HGH) is a peptide hormone that stimulates growth, cell division and regeneration. HGH is made in the anterior pituitary gland. A researcher wants to introduce the gene encoding human growth hormone into E. coli so she can produce large quantities of the peptide hormone for medical treatments. Which of the following should the researcher do? A. obtain the HGH gene from a human genomic library produced from DNA from any human tissue B. obtain an HGH gene from either a genomic or cDNA library C. obtain an HGH gene from another prokaryote D. obtain the HGH gene from a human genomic library produced from DNA of the anterior pituitary gland E. obtain the HGH gene from a human anterior pituitary gland cDNA library

E. obtain the HGH gene from a human anterior pituitary gland cDNA library

Q26: A small amount of DNA is collected from a crime scene. However, the amount of DNA collected is insufficient to perform the necessary experiments to link a suspect to the crime. Which method could be utilized to increase the amount of DNA? A. DNA sequencing B. microarray analysis C. gel electrophoresis D. fluorescent labeling of DNA xxx E. polymerase chain reaction (PCR)

E. polymerase chain reaction (PCR)

Q41: If a protein is regulated post-translationally you could detect changes by examining a species ____. A. genome B. metabolome C. microsome D. transcriptosome E. proteome

E. proteome

Q38: In a DNA microarray, _____ are attached to the slide and ___ are fluorescently labeled. A. the samples, the probesxxx B. the probes, nucleotides xxx C. the samples, nucleotides xxx D. nucleotides, the samples xxx E. the probes, the samples

E. the probes, the samples

Vector

From the Latin "one who carries". Vector DNA acts as a carrier of the DNA segment that is to be cloned. In cloning experiments, a vector may carry a small segment of chromosomal DNA, perhaps only a single gene. By comparison, a chromosome carries up to a few thousand genes.

Knockout

Informal term for the generation of a mutant organism in which the function of a particular gene has been completely eliminated (a null allele).

Molecular Pharming

Pharming is a portmanteau of farming and "pharmaceutical" and refers to the use of genetic engineering to insert genes that code for useful pharmaceuticals into host animals or plants that would otherwise not express those genes, thus creating a genetically modified organism (GMO).[1][2] Pharming is also known as molecular farming, molecular pharming[3] or biopharming. The products of pharming are recombinant proteins or their metabolic products. Recombinant proteins are most commonly produced using bacteria or yeast in a bioreactor, but pharming offers the advantage to the producer that it does not require expensive infrastructure, and production capacity can be quickly scaled to meet demand, at greatly reduced cost.

PCR

Polymerase chain reaction; A technique for amplifying DNA sequences in vitro by separating the DNA into two strands and incubating it with oligonucleotide primers and DNA polymerase. It can amplify a specific sequence of DNA by as many as one billion times and is important in biotechnology, forensics, medicine, and genetic research.

Plasmid

Small circular pieces of DNA, that are found naturally in many strains of bacteria and exist independently of bacterial chromosome.

Q53: Shown below are steps in making a transgenic plant. 1. Expose plant cells to Agrobacterium tumefaciens 2. Place plant cells on selective medium 3. Transform the recombinant plasmid into Agrobacterium tumefaciens 4. Insert gene of interest into Ti plasmid 5. Place plant cells on growth medium with plant hormones

The correct order: 4. Insert gene of interest into Ti plasmid 3. Transform the recombinant plasmid into Agrobacterium tumefaciens 1. Expose plant cells to Agrobacterium tumefaciens 2. Place plant cells on selective medium 5. Place plant cells on growth medium with plant hormones

Gene Cloning

The process of gene cloning is used to produce large amounts of a gene or its protein product;

Q61: The steps of DNA fingerprinting are shown below. 1. Isolate DNA from samples 2. Label DNA with fluorescent marker 3. PCR using primers that flank STRs 4. Detection of fluorescent fragments 5. Gel electrophoresis Which of the following choices shows these steps in the correct order?

3. PCR using primers that flank STRs 1. Isolate DNA from samples 2. Label DNA with fluorescent marker 5. Gel electrophoresis 4. Detection of fluorescent fragments

BAC

A bacterial artificial chromosome (BAC) is a DNA construct, based on a functional fertility plasmid (or F-plasmid), used for transforming and cloning in bacteria, usually E. coli.

Clone

A clone is a group of identical cells that share a common ancestry, meaning they are derived from the same cell.

Contig

A contig (from contiguous) is a set of overlapping DNA segments that together represent a consensus region of DNA.

Primer

A primer is a strand of nucleic acid that serves as a starting point for DNA synthesis. It is required for DNA replication because the enzymes that catalyze this process, DNA polymerases, can only add new nucleotides to an existing strand of DNA. The polymerase starts replication at the 3'-end of the primer, and copies the opposite strand.

Q36: You analyze some DNA using an automated sequence reaction. The first peak you observe is labeled with a red fluorescent label. From this you can conclude that the most ____ base in the DNA is a _____ containing the red fluorescent label. A. 3', dideoxynucleotide B. 5', dideoxynucleotide xxx C. 5', deoxynucleotide xxx D. 3', deoxynucleotide

A. 3', dideoxynucleotide

Q7: Which of the following sequence pairs is a palindrome? A. 5′-TCCGGA-3′ 3′-AGGCCT-5′ B. 5′-GAATCG-3′ 3′-CTTAGC-5′ C. 5′-GTTCAT-3′ 3′-CAAGTA-5′ xxx D. None of the paired sequences are a palindrome. E. 5′-TCACGT-3′ 3′-TCACGT-5′ xxx

A. 5′-TCCGGA-3′ 3′-AGGCCT-5′

Q9: Shown below is a diagram for a plasmid vector you want to use to clone a gene. The diagram shows the location of the recognition sites for four restrictions enzymes, BamHI (B), EcoRI (E), HindIII (H), and XhoI (X). The genes encoding beta-lactamase (AmpR) and beta-galactosidase (lacZ) are indicated. If you were to use this vector, which enzyme should be used to linearize the plasmid in preparation for cloning? Picture A. BamHI B. EcoRI C. HindIII xxx D. XhoI E. EcoRI and XhoI

A. BamHI

Q40:You are working in a cancer lab and are interested in identifying some genes that are important in the onset of lung cancer. You have several genes you think may be involved, so you "print" spots of the candidate DNA sequences on a microarray slide. After doing this, you isolate mRNA from both normal lung cells and cancerous lung cells. You make fluorescently-tagged cDNA from each mRNA sample; the cDNAs from normal cells are tagged with a green-colored molecule and the cDNAs from cancer cells are tagged with a red-colored molecule. You hybridize the cDNAs with the microarray and get the following data. (Green spots are labeled with "G", red spots are labeled with "R"). Picture Which of the following spots represent DNA that you should study further as potentially having a role in lung cancer? A. Spots A1 and C6 B. Spots B4 and B6 xxx C. Spots A1, B4, B6, and C6 D. All spots except A1 and C6 E. All spots except A1, B4, B6, and C6

A. Spots A1 and C6 (all red ones)

Q19: A DNA library is A. a collection of recombinant vectors containing DNA fragments of a given organism B. a collection of books about clones C. a line of bacteria that contains a DNA fragment of interest D. a series of restriction enzymes that can be used to produce a variety of sizes of DNA fragments xxx E. a collection of recombinant plasmids containing a particular gene from many different organisms xxx

A. a collection of recombinant vectors containing DNA fragments of a given organism

Q15: You insert a fragment of sheep DNA into a plasmid containing an AmpR gene. You transform bacteria with the recombinant plasmid, and plate the cells on growth media containing the antibiotic ampicillin. Each colony on the plate arose from _____ that ____ to ampicillin. A. a single colony; is resistant B. many bacteria; are sensitive xxx C. many bacteria; are resistant xxx D. a single colony; is sensitive xxx

A. a single colony; is resistant