bio

In comparing a frog cell in metaphase of mitosis with one in metaphase I of meiosis, how would tell you which was which?

Unlike mitosis, in meiosis each chromosome would be opposite its homolog.

The sex chromosome complement of a normal human female is

XX

Which of the following represents a chromosomally normal human female?

XX

An anticodon is __________.

a set of triplet bases that is complementary to a codon triplet on mRNA

A cell that has a cell wall is undergoing cell division, and the following events are observed: the formation of a cell plate and the division of the cell into two daughter cells. What type of cell is being observed and what process(es) is it going through?

plant cell; telophase and cytokinesis of mitosis

The inheritance of height and weight can best be described as __________.

polygenic

Consider the following sequence and explain what effect the mutation has on the protein that is translated.UCUAUGUUUCACAGAGGGAAACCCUAACCC (wild type)UCUAUGUUUCACUGAGGGAAACCCUAACCC (mutant)

prematurely stops the translation of the protein

asexual reproduction

produces offspring genetically identical to the parent

The centrosomes move away from each other and the nuclear envelope breaks up during which phase of mitosis?

prophase

The phase of mitosis during which the mitotic spindle begins to form is

prophase

Which of the following shows mitosis in the correct chronological order?

prophase, prometaphase, metaphase, anaphase, telophase

Which plants in this figure must all be heterozygous?

purple-flowered plants in the F1 generation

The site of translation is

ribosomes in the cell cytoplasm

During replication, the original "parent" DNA __________.

serves as the template for the creation of two complete sets of DNA

During which phase of mitosis does the nuclear envelope re-form?

telophase

Which of the following takes place during translation?

the conversion of genetic information from the language of nucleic acids to the language of proteins

A gene is usually _____.

the information for making a polypeptide

During _____ both the contents of the nucleus and the cytoplasm are divided.

the mitotic phase

The information carried by a DNA molecule is in _____.

the order of the nucleotides in the molecule

The genetic material is duplicated during

the s phase

The alleles of a gene are found at ________ chromosomes.

the same locus on homologous

The transfer of genetic information from DNA to RNA is called

transcription

During the process of translation, __________ matches an mRNA codon with the proper amino acid.

transfer RNA

Meiosis I produces _____ cells, each of which is _____.

two ... haploid

Which of the following is only associated with RNA?

uracil

What is an allele?

an alternative version of a gene

The sister chromatids separate and begin moving toward opposite poles of the cell during which phase of mitosis?

anaphase

What type of inheritance fits the data in this pedigree?

autosomal recessive

At the end of the mitotic (M) phase, the cytoplasm divides in a process called _________________.

cytokinesis

The two strands of a DNA molecule are joined to each other through _____.

hydrogen bonds between nucleotide bases

Where do transcription and translation occur in prokaryotic cells?

in the cytoplasm

In a eukaryotic cell, transcription takes place _____.

in the nucleus

When you cross two heterozygotes (Aa), the offspring will most likely be __________.

in the ratio 1:1 homozygotes to heterozygotes

Which processes lead to most genetic variation in sexually reproducing organisms?

independent orientation of chromosomes in meiosis crossing over random fertilization

Which of the following occurs when RNA polymerase attaches to the promoter DNA?

initiation of a new RNA molecule

During _____ the cell grows and replicates both its organelles and its chromosomes.

interphase

Eukaryotic cells spend most of their cell cycle in which phase?

interphase

Any gene located on a sex chromosome

is called a sex-linked gene

A child with cystic fibrosis can be born to two parents who do not have the disease. This is because the disease _____.

is caused by a recessive allele

A certain species of animal has six pairs of chromosomes. How many DNA molecules are present in the nuclei of these animals during G2 phase?

24

All the offspring of a cross between a black-eyed Mendelian and an orange-eyed Mendelian have black eyes. What is the expected phenotypic ratio of a cross between two orange-eyed Mendelians?

0 black-eyed:1 orange-eyed

In a standard monohybrid cross between purple-flowered and white-flowered peas, in which purple flowers are dominant, what fraction of the purple-flowered peas in the F2 generation would you expect to be true-breeding?

1/3

Flower color in snapdragons is an example of incomplete dominance. If a red-flowered plant is crossed with a white-flowered plant, the F1 generation has pink flowers. If a pink-flowered plant is crossed with another pink-flowered plant, the expected progeny plants will be __________.

25% red, 50% pink, and 25% white

Which of these gametes contains one or more recombinant chromosomes?

B and C

Which of the following statements regarding sexual and asexual reproduction is true?

Sexual reproduction is more likely to increase genetic variation than is asexual reproduction.

A cell replicates its entire chromosomal DNA only __________.

before it is about to divide

As a patch of scraped skin heals, the cells fill in the injured area but do not grow beyond that. This is an example of

density-dependent inhibition

When animal cells are grown in a petri dish, they typically stop dividing once they have formed a single, unbroken layer on the bottom of the dish. This arrest of division is an example of

density-dependent inhibition.

When we say that an organism is haploid, we mean that _____.

its cells each have one set of chromosomes

Which of the following is a function of a tRNA molecule?

joining to only one specific type of amino acid

Which of the following does not occur during RNA processing?

mRNA attaches to the small subunit of a ribosome

Can you match each genetics term with its description? 1. A character is an inherited feature that varies from individual to individual.

1. A character is an inherited feature that varies from individual to individual. 2. A trait is one particular variation of a character. 3. A genetic cross involving parents that differ in a single character is called a monohybrid cross. 4. Most human genes come in alternate versions called alleles. 5. If an organism has two non-identical versions of a gene, the one that is expressed in the organism is called the dominant allele. 6. If an organism has two non-identical versions of a gene, the one that is not expressed in the organism is called the recessive allele. 7. The physical traits of an organism are called its phenotype. 8. The genotype is the genetic makeup of an organism.

Asexual reproduction requires ________ individual(s), whereas sexual reproduction requires _______ individual(s).

1;2

How many pairs of autosomes do humans have?

22

In a cell containing 10 chromosomes, meiosis results in the formation of daughter cells containing __________ chromosomes.

5

When one DNA molecule is copied to make two new DNA molecules, the resulting DNA molecules contain

50% of the parent DNA

Can you label the components of replicating DNA strands?

A . parental DNA B. DNA polymerase c.Leading starnd d,Lagging strand. e DNA ligase F.Replication fork

Which of the following checkpoints does not occur late in G1?

A check that chromosome replication has been successfully completed

Which of the following events occurs during transcription?

A molecule of RNA is formed based on the sequence of nucleotides in DNA.

Can you correctly label this diagram of the human life cycle?

A) Gametes B) Haploid C) Meiosis D) Fertilization E) Diploid F)Zygote G) Mitosis.

Can you correctly label these images of chromosomes?

A- Homologous chromosomes - These are chromosome pair which are inherited from each parent that is one from male and on other one from the female. Gene position is same in these chromosomes but the alleles may differ. B- centromere - region on the chromosome where the sister chromatids get attached and also spindle does attached to centromere during mitosis. C - sister chromatids - half of the chromosome that has been replicated. D- autosomes - these chromosomes does not account for sex determination. E- sex chromosomes - out of total 23 pairs of chromosomes in human, one is sex chromosomes which accounts for sex determination. F- karyotype - is a picture of chromosomes of a person which evaluates the number, size, shape etc of the chromosomes.

Which of the following statements regarding genotypes and phenotypes is false?

An organism with two different alleles for a single trait is said to be homozygous for that trait.

In some cats, black coat color (B) is dominant over brown (b) and a striped fur pattern (S) is dominant over a marbled fur pattern (s). You rescued a black striped cat from an animal shelter but could not determine its exact genotype. To do so, you mated the cat with a brown marbled cat. The mating produced 3 brown marbled, 2 brown striped, 2 black marbled, and 3 black striped. Immediately, you concluded the genotype of your rescued cat was

BbSs

Which of the following statements regarding cell division is false?

Cell division is common in eukaryotes but rare in prokaryotes.

Which one of the following does not play a role in translation?

DNA

A gene made of __________ is transcribed into __________ and then translated to form a __________.

DNA ... RNA ... protein

Which of the following statements regarding DNA is false?

DNA contains the nitrogenous base uracil.

Using the figure, can you complete the sentences about the structures and processes involved with the flow of information through the cell? DNA is a long linear polymer

DNA is a long linear polymer found in the nucleus of a cell, shaped like a double helix, and associated with the transmission of genetic information. A ribosome serves as the site of protein synthesis in the cytoplasm. Transcription is the first step of gene expression, during which a particular segment of DNA is converted into RNA. Translation is the process in which mRNA codons are converted into an amino acid sequence. A protein is made up of hundreds or thousands of smaller units called amino acids, attached to one another in long chains. The principal role of RNA is to act as a messenger carrying instructions from DNA out of the nucleus for the synthesis of proteins.

What enzyme joins DNA fragments?

DNA ligase

Which of the following enzymes catalyzes the elongation of a new DNA strand?

DNA polymerase

Which of the following options best depicts the flow of information when a gene directs the synthesis of a cellular component?

DNA → RNA → protein

Can you identify the molecules and processes involved in the flow of genetic information through a cell?

DNA, Transcription (arrow), RNA, translation above ribosome, Protein (end)

Which of these phases encompasses all of the stages of mitosis?

E

An insect that has the genotype EeGGcc will have the same phenotype as an insect with the genotype __________.

EEGgcc

Which of the following is true of tRNAs?

Each tRNA binds a particular amino acid.

Consider the cell cycle shown below. Cells will usually divide if they receive the proper signal at a checkpoint in the __________ phase of the cell cycle.

G1

If one strand of DNA is CGGTAC, then the complementary strand would be

GCCATG

During binary fission, each copy of the duplicating chromosome moves to opposite ends of the cell. What does this achieve?

It ensures that each daughter cell receives one copy of the chromosome.

Using the genetic code shown, what protein sequence does the RNA sequence CUAGCUCGAUAUCUC code for? Second mRNA baseThirdmRNAbase(3′endofcodon) UCAGUUUUPheUCUSerUAUTyrUGUCysUUUCUCCUACUGCCUUALeuUCAUAA StopUGA StopAUUGUCGUAG StopUGGTrpGCCUULeuCCUProCAUHisCGUArgUCUCCCCCACCGCCCUACCACAAGlnCGAACUGCCGCAGCGGGAAUUIleACUThrAAUAsnAGUSerUAUCACCAACAGCCAUAACAAAALysAGAArgAAUGMet orstartACGAAGAGGGGGUUValGCUAlaGAUAspGGUGlyUGUCGCCGACGGCCGUAGCAGAAGluGGAAGUGGCGGAG

Leu - Ala - Arg - Tyr - Leu

Plants grow taller through mitosis at the tips of their shoots (above ground) and at the tips of their roots (below ground). Here are two samples of tissue taken from a grass plant, one from the tip of the root and one from the mid part of the plant. StageSample 1Sample 2Interphase74%98%Prophase18%0.5%Metaphase4%0.2%Anaphase2%0.1%Telophase1%

Metaphase lasts about twice as long as anaphase

Which of the following statements regarding mitosis and meiosis is false?

Mitosis produces daughter cells with half the number of chromosomes as the parent cell.

Which of the following statements best explains why dominant alleles that cause lethal disorders are less common than recessive alleles that cause lethal disorders?

Most individuals carrying a lethal dominant allele have the disorder and die before they reproduce, whereas individuals carrying a lethal recessive allele are more likely to be healthy and reproduce.

In giraffes, long necks (N), long legs (L), dark spots (D), and the ability to digest maize (M) are all dominant traits. What possible genotype could a long-necked, short-legged, light-spotted, maize-digesting giraffe have?

NnllddMM

In an individual of genotype Aa, where are the A and a alleles physically located?

One allele is on one chromosome, and the other is in the same position (locus) on the homologous chromosome.

Imagine a particular character (such as flower color) that is determined by a single gene. If this gene is present in two forms, how can you tell which allele is dominant and which is recessive?

Perform a cross between two true-breeding individuals and observe the trait or traits expressed by the F1 individuals.

Suppose we have a pea plant with purple flowers, determined by the dominant allele P. How might you determine whether the plant is homozygous (PP) or heterozygous (Pp)?

Perform a testcross: Cross the plant with a white one, which must be homozygous recessive (pp).

Crossing over occurs during _____.

Prophase I

Synapsis occurs during _____.

Prophase I

During _____ a spindle forms in a haploid cell.

Prophase II

Which of the following statements regarding RNA is false?

RNA contains the sugar dextrose.

Which of the following enzymes catalyzes the production of a strand of RNA from DNA?

RNA polymerase

DNA replication occurs in

S phase of interphase

Plants grow taller through mitosis at the tips of their shoots (above ground) and at the tips of their roots (below ground). Here are two samples of tissue taken from a grass plant, one from the tip of the root and one from the mid part of the plan StageSample 1Sample 2Interphase74%98%Prophase18%0.5%Metaphase4%0.2%Anaphase2%0.1%Telophase1%0.1%

Sample 2 is likely from tissue in the middle of the plant because fewer cells are in any mitotic stage

During anaphase II, __________.

Sister chromatids separate and migrate toward opposite poles.

What nucleotide sequence would be found on the complementary DNA strand of the strand shown here?

TGACA

How would the shape of a DNA molecule change if adenine paired with guanine and cytosine paired with thymine?

The DNA molecule would have irregular widths along its length.

Which of the following statements regarding a DNA double helix is true?

The amount of adenine is equal to the amount of thymine, and the amount of guanine is equal to the amount of cytosine.

Which of the following statements regarding the cell cycle control system is false?

The cell cycle control system operates independently of the growth factors.

What event will immediately follow the event shown in the following image?

The cell will divide into two plant cells

You and your lab partner are observing a cell under a microscope, but you do not know whether it is a eukaryote or a prokaryote. Which of the following observations regarding the chromosomes would you use to immediately conclude that the cell is a eukaryote?

The chromosomes are housed in a membrane-enclosed nucleus.

What must happen before a cell can begin mitosis?

The chromosomes must be duplicated.

You are observing a single cell under a microscope. You go home for the night, and the next day you see four cells. The four cells look similar, and when you stain them with a dye that binds to DNA they all appear to contain the same amount of DNA as the original cell. What likely happened overnight?

The single cell divided to form two new cells, and the two new cells each divided to form four total cells, all by asexual reproduction.

Which of the following statements is false?

The start codon can be different depending on what kind of protein is to be translated

During cell division, what role do centrosomes play?

They organize the microtubules.

Imagine you're counseling a couple who have undergone carrier screening for Tay-Sachs disease. The man is a carrier, and the woman does not carry the Tay-Sachs allele. How should you advise them?

They should be informed that if they have a child, the child will not have Tay-Sachs disease but will have a 50% chance of being a carrier of the Tay-Sachs allele.

In eukaryotes, translation is initiated only after transcription is completed. However, prokaryotes can initiate translation before a gene is completely transcribed. Which choice is the best explanation for this observation?

Translation in eukaryotes cannot occur until the RNA leaves the nucleus, whereas in prokaryotes both transcription and translation occur in the cytoplasm.

When messenger RNA (mRNA) is being transcribed, the RNA base _____ always pairs with the base _____ in DNA.

U... A

During transcription, an RNA molecule (shown in red) is transcribed from DNA (shown in blue). Can you label the bases on the RNA transcript?

UCGA CAUCGAAU

With the exception of identical twins, siblings who have the same two biological parents are likely to look similar, but not identical, to each other because they have

a similar but not identical combination of genes.

________ marks the end of a gene and causes transcription to stop.

a terminator

Can you label the phases of the cell cycle?

a- G1 phase b - S phase C - interphase D - G2 phase E - M phase F - Mitosis G - cytokinesis

Can you identify the genotypes in this human pedigree for deafness?

a. Dd b DD or Dd c. dd d. DD or Dd e. DD or Dd f. dd

Can you correctly label the genotypes and phenotypes in this Punnett square of a monohybrid cross? Mendel discovered that the allele for green seed pods (G) is dominant to the allele for yellow seed pods (g). He crossed true-breeding (homozygous) parental plants with green (GG) and yellow (gg) seed pods to produce an F1 generation, all of which were heterozygous (Gg) with green seed pods. He then crossed two of these F1 plants to produce an F2 generation. Drag the genotypes and phenotypes from the left to correctly complete the Punnett square for the F2 generation. Drag only blue labels to blue targets and pink labels to pink targets. Labels may be used more than once.

a. GG b. green plant c. Gg d. green plant e. Gg f. green plant g. gg h. yellow plant

Can you correctly label various parts of a DNA molecule?

a. double helix b. phospate group c.deoxyribose d. hydrogen bond e. base pair f. nucleotide g. nitrogenous base

Can you label these chromosomes with the correct genetic terms?

a. homologous chromosomes b. gene locus c. recessive allele d. centromere e. sister chromatids f. alleles g. dominant allele

During translation, the message in mRNA is translated into a protein. Can you identify the structures and molecules involved in translation?

a. mRNA b. small subunit of ribosome c. large subunit of ribosome d. amino acid e. tRNA f. anticodon

Can you identify the similarities and differences between mitosis and meiosis?

a. mitosis b.prophase c.metaphase d. anaphase, telophase, & cytokinesis e.meiosis f.propase 1 g. metaphase 1 h. anaphase I, telophase I, & cytokinesis I. meiosis II

Can you identify the structures of a chromosome?

a. pair of homologous chromosomes b. centromere c. sister chromatids

The four bases contained in DNA are _____.

adenine, guanine, cytosine, thymine

The stage of mitosis during which the chromosomes move toward separate poles of the cell is _____.

anaphase

As shown in the figure below, at what point in meiosis do the chromosomes segregate from one another?

anaphase I

Homologous chromosomes migrate to opposite poles during _____.

anaphase I

During _____ sister chromatids separate.

anaphase II

Research since Mendel's time has established that the law of segregation of genes during gamete formation

applies to all sexually reproducing organisms

The creation of genetically identical offspring by a single parent, without the participation of sperm and egg, is called

asexual reproduction

Why does a DNA strand grow only in the 5' to 3' direction?

because DNA polymerases can only add nucleotides to the 3' end of the growing molecule

Which of the following conditions would prevent cell division due to density-dependent factors?

being completely surrounded by other cells

During the replication of DNA molecules, __________.

both strands of the parent molecule act as templates

Ultraviolet (UV) radiation is damaging because it __________.

causes mutations in DNA

Which of the following occurs during interphase?

cell growth and duplication of the chromosomes

Meiosis differs from mitosis in that _____ only occurs in meiosis.

crossing over

The mechanism that "breaks" the linkage between linked genes is

crossing over

A cleavage furrow forms in an animal cell during _____.

cytokinesis

The process by which the cytoplasm of a eukaryotic cell divides to produce two cells is called

cytokinesis

Mendel's law of independent assortment states that

each pair of alleles (chromosomes) segregates independently of the other pairs of alleles during gamete formation.

True or false. Mitosis takes place during M phase of the cell cycle, which is longer than interphase.

false

Which of the following is a feature of plant cell division that distinguishes it from animal cell division?

formation of a cell plate

Consider the photograph shown below. You can determine this is a plant cell rather than an animal cell because it has __________.

formed a cell plate

Meiosis II typically produces _____ cells, each of which is _____.

four ... haploid

DdEe pea plants can produce _____ type(s) of gametes, but a ddee plant can produce _____ type(s) of gametes.

four ... one

We would expect that a 15-nucleotide sequence that includes a stop codon at the end (as part of the 15-nucleotide sequence) will direct the production of a polypeptide that consists of

four Amino acids

The function of meiosis is to make __________.

four cells with a haploid number of chromosomes

What is the typical result when a diploid cell undergoes meiosis?

four haploid cells

During asexual reproduction, yeast cells can produce _____.

genetically identical offspring

A carrier of a genetic disorder who does not show symptoms is most likely to be ________ to transmit it to offspring.

heterozygous for the trait and able

Two chromosomes in a nucleus that carry genes controlling the same inherited characteristics are

homologous chromosomes.

During anaphase I, __________.

homologues chromosomes separate and migrate toward opposite poles

In some organisms such as certain fungi and algae, cells undergo mitosis repeatedly without subsequently undergoing cytokinesis. What would be the consequence of this?

large cells containing many nuclei

Genes located close together on the same chromosomes are referred to as ________ genes and generally ________.

linked; do not sort independently during meiosis

During the transcription of a given portion of a DNA molecule, __________.

mRNA is synthesized from only one of the strands

Which of the following is a correct statement about mRNA?

mRNA moves from the nucleus to the cytoplasm following RNA processing.

In the genetic code,

many amino acids are specified by more than one codon.

Sex-linked conditions are more common in men than in women because

men need to inherit only one copy of the recessive allele for the condition to be fully expressed.

During which phase of mitosis do the chromosomes line up on a plane equidistant from the two spindle poles?

metaphase

The chromosomes line up in the center of the cell during which phase of mitosis?

metaphase

During _____ chromosomes align single file along the equator of a haploid cell.

metaphase II

The figure below shows the initiation of translation. The first amino acid inserted into a new polypeptide chain in eukaryotic cells is always __________.

methionine

A physical or chemical agent that changes the nucleotide sequence of DNA is called a(n)

mutagen

Any change in the nucleotide sequence of DNA is called a

mutation

Most people afflicted with recessive disorders are born to parents who were

not affected at all by the disease

How many sex chromosomes are in a human gamete?

one

What is the normal complement of sex chromosomes in a human male?

one X chromosome and one Y chromosome

The term binary fission is best applied to _____.

prokaryotes

Multiple origins of replication on the DNA molecules of eukaryotic cells serve to

shorten the time necessary for DNA replication

A terminator in mRNA synthesis is a(n) __________.

specific nucleotide sequence in DNA that signals a stop of transcription

The chromosomes arrive at the poles and nuclear envelopes form during which phase of mitosis?

telophase

At the end of _____ and cytokinesis, haploid cells contain chromosomes that each consist of two sister chromatids.

telophase I

At the end of _____ and cytokinesis there are four haploid cells.

telophase II

At the start of mitotic anaphase,

the centromeres of each chromosome come apart.

The "one gene-one enzyme" hypothesis states that

the function of an individual gene is to dictate the production of a specific polypeptide.

If protein production were an assembly line, a ribosome would be _____.

the worker who puts all of the pieces together

During mitosis, the chromosomes move because _____.

they attach to a dynamic, precisely regulated mitotic spindle

How many loci are shown on the homologous chromosomes in the figure below?

three

Experiments have demonstrated that the "words" of the genetic code (the units that specify amino acids) are

three-nucleotide sequences

Mitosis and cytokinesis result in the formation of __________; meiosis and cytokinesis result in the formation of __________.

two diploid cells : four haploid cells

At the end of telophase I of meiosis, as cytokinesis occurs, there are __________.

two haploid cells

Looking into your microscope, you spot an unusual cell. Instead of the typical rounded cell shape, the cell has a very narrow middle separating two bulging ends. It sort of looks like the number 8! You realize that this cell is

undergoing cytokinesis.