Bio Ch. 14

A model organism is easy to grow and manipulate in the laboratory and has representative characteristics common to a larger group of organisms (e.g., a mouse for mammals).

14.1 1. What is a model organism, and why is Neurospora a good model for studying biochemical genetics?

Srb, Horowitz, Beadle, and Tatum treated wild-type Neurospora with X rays to cause mutations. Strains that could not grow without the addition of an amino acid (arginine) were isolated. The strains were separately incubated without arginine but with intermediates along the proposed biochemical pathway that makes arginine. Growth in one of the intermediates meant that the mutation for that strain must occur in a gene encoding an enzyme that acts before that substance in the pathway. In this way, the collection of mutant strains led to identification of the intermediates in the pathway and their order, and ultimately to the enzyme that acts to convert each intermediate into the next.

14.1 2. how were the experiments of mutant strains of Neurospora set up to determine the order of steps in a biochemical pathway?

The central dogma states that DNA is transcribed to RNA, which gets translated into protein, a process that is unidirectional.

14.2 1. What is the central dogma of molecular biology?

In retroviruses, the genome is RNA. To replicate, the RNA is converted to a DNA copy, which is then transcribed into RNA. This violated the original central dogma in that the DNA-to-RNA conversion was thought to be unidirectional.

14.2 2. Do retroviruses violate the central dogma? Explain.

If the code were just single letters (A or t or G or C) each letter would translate to one amino acid (41). But there are 20 amino acids, so a single letter code could not unambiguously identify all amino acids. a doublet code would create 16 possible codons (42), not enough to uniquely identify all 20 amino acids. A triplet code using four letters as 64 unique possibilities (43), more than enough for 20 amino acids and stop codons. The codes is redundant (there is more than one codon per amino acid) but not ambiguous (a codon does not stand for more than one amino acid).

14.3 1. Explain why the genetic code has triplets (e.g., AUA) of nucleotides, rather than singlets (e.g., A) or doublets (e.g., AU).

RNA polymerase binds to DNA at the promoter. The DNA is unwound to expose the bases. The enzyme has biding sites for substrates, the ribonucleoside triphosphates. The enzyme then adds nucleotides to a growing chain by complementary base pairing to template DNA.

14.3 2. Describe the actions of RNA polymerase during transcription.

DNA must be replicated exactly. Any error in DNA in a gene that encodes a protein will result in an error in the RNA that is transcribed from that DNA region. This could result in a different codon and therefore a different amino acid at that location in the protein. The protein's function may change. RNA is made in many copies. So an error in an RNA could result in an error in the protein translated from it, but since there are many more normal copies of that RNA, there could be plenty of the normal protein for normal function.

14.3 3. Errors in transcription occur about 100,000 times more often than errors in DNA replication. Why can t his higher rate be tolerated in RNA but not in DNA synthesis?

At the 5' end, a "cap" of modified GTP is added. This facilitates binding of mRNA to the ribosome and protects the mRNA from hydrolysis by ribonucleases. At the 3' end a poly A tail is added, with 100-300 A nucleotides. This assists in export of mRNA from the nucleus.

14.4 1. How and why is the pre-mRNA trasncript modified at the 5' and 3' ends during mRNA processing?

192 amino acids would be encoded by 576 nucleotides. Add start and stop codons for a total of 582 base pairs in DNA. The DNA has extra base pairs for the promoter and terminator of transcription, introns, and a sequence for mRNA binding to the ribosome.

14.4 3. A gene that is 1,440 base pairs long codes fora polypeptide that is 192 amino acids long. Discuss the discrpancy.

rRNA acts as a scaffold for proteins to make the ribosome structure, with biding sites for tRNA. An rRNA has a nucleotide sequence region complementary to a region on mRNA so the two RNAs can bind and begin translation. An rRNA acts as the catalyst for peptide bond formation.

14.5 1. What are the roles of rRNA molecules in the ribosomes?

a. 3'-TACGGGCCCAATTCTTAAAATTTTACT-5' b. the bottom strand is transcribed: it has sequences that are transcribed into start AUG and stop UGA codons in RNA c. mRNA: AUGCCCGGGUUAAGAUAUUUUAAAUGA Polypeptide: Met-Pro-Gly-Leu-Arg-Tyr-Phe-Lys

14.5 2. Given the DNA sequence: 5'-ATGCCCGGGTTAAGATATTTTAAATGA-3' a. write out the sequence of the complementary DNA strand b. indicate which strand is used as a template for transcription (and how you know this) c. write out the sequence of the transcribed mRNA, and provide the amino acid sequences of the translated peptide

Aa polysome is formed when more than one ribosome is bound to mRNA t the same time. This can occur because ribosomes move along mRNA is a 5'-to-3' direction, translating as they go, much like a cafeteria line. Polysomes allow more proteins to be made at a given time from an mRNA.

14.5 3. What are the stucure and significance of a polysome?

Signal sequences are translated to regions in a protein that bind to recognition molecules and/or receptors associated with a particular destination in the cell.

14.6 1. How do signal sequences determine where a protein will go after it is made?

codon: specifies for a particular amino acid, each codon is completmetary to the corresponding triplet of bases in the DNA molecule from which it was transcribed anticodon: at about the midpoint on the tRNA polynucleotide chain there is a triplet of bases called the anticodon, which is complementary to the mRNA codon for the particular amino acid that the tRNA carries

Compare and contrast the anticodon with the codon.

introns: intervening regions of DNA, get transcribed but are then spliced out to the pre-mRNA in the nucleus exons: coding sequences, only the exons remain in the mRNA that reaches the ribosome

Compare introns with exons? Do introns appear in the final mRNA transcript?

Transcription: the information in a DNA sequence (gene) is copied into a complementary strand translation: this RNA sequence is used to create the amino acid sequence of a polypeptide

Define trasncription and translation, and understand their role in the "central dogma of molecular biology."

No, so far, we have seen in terms of protein synthesis, the function of a gene is to prescribe the production of a single, specific polypeptide. But not all genes code for polypeptides. Many DNA sequences are transcribed to RNA molecules that are not translated into polypeptides, but instead have other functions.

Do all genes code for polypeptides?e in

The same basic genetic code is used by all the species on our planet. A common genetic code provides a common language for evolution. Cells come from other cells- cell theory

Does the genetic code vary amoung organisms? What is the evolutionary siginficance of this?

termination of translation: translation terminates when the A site of the ribosome encounters a stop codon on the mRNA.

How and why does translation end?

hydrophobic interatctions, ionic bonds, noncovalent bonds

How are ribosomal subunits attached to each other?

They treated the wild-type Neurospora with X-rays, which function as a mutagen, something that damages DNA causing mutations, heritable alternations in the DNA sequence. After the X-ray treatment, some Neurospora strains could no longer grow on the minimal medium. These results suggested that mutations have simple effects, and that each mutation causes a defect in only one enzyme in a metabolic pathway.

How did the Beadle and Tatum experiments on bread mold mutations lead to the "one-gene, one-enzyme" hypthesis?

RNA: Uracil (u), the sugar is: ribose, generally single stranded DNA: Thymine (T) the sugar is: deoxyribose, generally double stranded

How does RNA differ from DNA?

If a newly formed polypeptide is meant to do its work elsewhere, a signal sequence (or signal peptide) a short stretch of amino acids attached to the polypeptide, will tell the polypeptide where in the cell it belongs. Proteins destined for different locations have different signals.

How does a newly synthesized protein moved into the nucleus or exported from the cell?

1. introns spliced out 2. 5' cap is added to the 5' end 3. poly A tail is added to the 3' end

How is mRNA processed? In other owrdsd, what is added to each end of the mRNA before it leaves the nucleus?

5'-3- direction

In what direction is the newly formed RNA transcript produced?

DNA polymerase: synthesize a DNA strand and is used in DNA replication, faster RNA polymerase: is used during transcription to synthesize the mRNA strand, don't require a primer capable of initiating a new strand. Does not require a primer, does not have proofreading ability, produces single-stranded RNA (5'-3' of growing strand) 1000s of RNA transcripts are made per gene

In what three ways does RNA polymerase differ from DNA polymerase?

the polypeptide chain that is release from the ribosome is not necessarly a functional protien

Is a protein complete immediatley following translation?

1. ribosomoal RNA (rRNA) rRNA + proteins make up ribosomes 2. messenger rna (mrna) carry the messages, DNA template information from DNa to ribosome (instructions to make polypeptide) One strand of DNA is copied to a completmentary mRNA strand. 3 Transfer RNA (trna) takes amino acids to site of protein synthesis (ribosomes) binds specific amino acids and recognizes specific sequences in mRNA

What are the three kinds of RNA that are involved in protein synthesis?

Initiation, elongation, termination

What are the tree stages of transcription?

Proteolysis glycosylation phosphorylation

What are three common post-translational protein modifications?

initiation, elongation, termination

What are three stages of translation?

The cell gets by with about two-thirds tRNA specifies because the specificity for the base at the 3' end of the codon (and the 5' end of the anticodon) is not always strictly observed. This phenomenon is called wobble, and it is possible because in some cases unusual or modified nucleotide bases occur in the 5' position of the anticodon. wobble occurs is some matches but not in others; of most importance, it does not allow the genetic code to be ambiguous.

What is "wobble" and what is its relation to the genetic code?

As assemblage consisting of a strand of mRNA with its beadlike ribosomes and their growing polypeptide chains is called a polyribosome, or polysome. Cells that are actively synthezising protins conatain large numbers of polysomes and few free ribosomes or ribosomal subunits.

What is a polyribosome?

A translator is required to convert the information in mRNA (a language composed of a sequence of nucleotides) into the language of protein (consisting of a sequence of amino acids) In biology, that translator is a special kind of RNA molecule called transfer RNA (tRNA) to ensure accurate translation that is, to ensure that the protein made is the one specified by the mRNA-the tRNAs must 1. read each codon correctly, and 2. fetch the amino acids corresponding to each codon and deliver them to the ribosome.

What is tRNA and wht is its role in translation?

The genetic code is the informational key by which a sequence of mRNA nucleotides corresponding to a gene is translated into the sequence of amino acids composing the protein expressed by that gene. Codon: three nucleotides in messenger RNA that direct the placement of a particular amino acid into a polypeptide chain. A codon is three nucleotides long because it represents three adjacent nucleotide bases in the mRNA polynucleotide.

What is the genetic code? What is a codon? Why is a codon three nucleotides long? (wjy not one or two nucleotides long?)

P: breaks the bond between the tRNA and its amino acid in the P site A: codon recognition: the anticodon of an incoming tRNA binds to the coodn at the A site E: free trna is moved to the e site, and then released as the ribosome shifts by one codon, so that the growing polypeptide chain moves to the P site

What occurs in the 'A' site the 'P' site and the 'E' site of hte ribosome during elongation of the polypeptide?

Transcription begins when RNA polymerase binds to a special sequence of DNA called a promoter. Promoters are important control sequences that "tell" the RNA polymerase where to start transcription and which strand of DNA to transcribe. Where RNA polymerase is going to bind.

What region of DNA is needed to start transcription? What occurs on this region of DNA during transcription?

1. RNa polymerase 2. the four ribonucleoside triphosphates (atop, gtp ctp, utp) 3. DNA template for base pairings (salts and pH buffer, if done in a test tube)

What three basic groups of macromolecuels are required for transcritption to occur?

RNA and proteins ribosomes are irregularly shaped and composed of two subunits. Each subunit contains rRNA and numerous proteins. There are 3 sites for the tRNA binding. Condon-anticodon interactions between tRNA and mRNA occur only at the P and A sites. non covalently A given ribosome does not specifically prdocue just one kind of proteoin.

What two macromoleuccles make up ribosomes? What is the basic strucure of a ribosome? Are ribosomes specific for specific proteins produced?

Nucleus

Where in the cell does transcription occur?

AUG

Which mRNA codon starts translation?

Synthesis of DNA from RNA is called reverse transcription, and viruses that employ this kind of transcription are called retroviruses. retroviruses rely on the host cell's transcription machinery to make more RNA. This RNA can either be translated to produce viral proteins, or incorporated as the viral genome into new viral particles.

Why are retroviruses excpetions to the central dogma?

Just as initiation sites in the DNA template strand specify the starting point for transcription, particular base sequences specify its termination. There are two mechanisms for ending transcription.

Why does transciription terminate at a specific point in the RNA?

Home of George Beadle; won a Nobel Prize in Physiology and Medicine in 1958. Beadle and Tatum used X-rays as mutagens. They mutated strains of bread mold. Mutants needed additional nutrients to grow.

Why is Wahoo, Nebraska famous?

The one-gene, one-enzyme relationship has undergone several modifications in light of our current knowledge of molecular biology. Many proteins, including many enzymes, are composed of more than one polypeptide chain or subunit. So, it is more correct to speak of a one-gene, one-polypeptide relationship.

Why is the "one-gene, one-enzyme" hypothesis now called the "one-gene, one-polypeptide hypthosis"?

The genetic code is redundant (more than one codon may specifiy for a particular amino acid) but not ambiguous, no codon specifies more than one amino acid.

Why is the genetic code redundant, and not ambiguous?

cytoplasm, ribosomes

where does cell translation occur?