Bio Chap 13

अब Quizwiz के साथ अपने होमवर्क और परीक्षाओं को एस करें!

• What are telomeres? Why are they only needed on eukaryotic chromosomes, not prokaryotic chromosomes?

Telomeres: the ends of eukaryotic chromosomes. They are special short nucleotide sequences. Eukaryotic chromosomes are linear & prokaryotic chromosomes are circular.. they don't have an end.

• DNA replication takes place during which phase of the cell cycle?

The S phase in Interphase.

• Which part of a nucleotide is not involved in phosphodiester bonds?

The nitrogenous bases.

• What are Okazaki fragments? Why are they only formed on the lagging strand, not the leading strand?

The segments of the lagging strand. The Okazaki fragments are formed because the lagging strands are made of the discontinued fragments.

• Why are the two strands in a DNA double helix described as 'antiparallel'?

Their subunits run in opposite directions. One run 3' to 5' & the other runs 5' to 3'...

• In nucleotides, the phosphate group is always attached to which carbon?

'5 prime (number 5) carbon.

• What are the building blocks of DNA?

Nucleotide

• Why are RNA primers necessary

The initiate the synthesis for DNA. RNA primers are the initial nucleotide chain that is produced during DNA synthesis.

• Describe the specific functions of these enzymes needed for DNA replication: Helicase, Topoisomerase, DNA primase, DNA polymerase III, DNA polymerase I, DNA ligase.

o Helicase The enzymes that untwist the double helix at the replication forks, separating the two parental stands and making them available as template strands. o Topoisomerase Relieve the torque generated by unwinding the helix, preventing the helix from further coiling. o DNA primase Synthesizes RNA primers, using the parental DNA as a template. o DNA polymerase III Adds a DNA nucleotide to the RNA primer and then continues adding DNA nucleotide, complementary to the parental DNA template strand, to the growing end of the new DNA strand. o DNA polymerase I Replaces the RNA nucleotides of the adjacent primer with the DNA nucleotides. o DNA ligase Joins the Okazaki fragmenets from the lagging strand, creating a continuous DNA strand.

• Are RNA primers needed on the leading strand, lagging strand, or both?

Both.

• Describe the function of histones.

Histones are responsible for the first level of DNA packaging in chromatin. ''

• Why is DNA replication describes as 'semi-conservative'?

It's semi conservative because it basically conserves one strand from from the parental strand. In semi conservation the two strands of the parental molecule separate, and each functions as a template for synthesis of a new, complementary strand. In contrast to the conservative model of DNA.. the parental strands is never restored together.

• What are the three parts of every nucleotide?

Nitrogenous Base, A phosphate group and a five carbon sugar.

• If the sequence on one DNA strand is ATCGGCCGCTTAAAAACACCG, then what is the sequence on the complimentary strand?

3-TAGCCGGCGCAATTTTGTGGC-5

• Explain the structural difference between purines are pyrimidines.

Adenine and Guanine are purines.. which are nitrogenous bases that have two organic rings. They are 2x the size of pryimades. Cytosine and thymine are nitrogenous bases that are pyrimades.. they have a single ring.


संबंधित स्टडी सेट्स

Periodic Table and Classes of Elements

View Set

ГЛАВА 38 Патофізіологія нервової системи

View Set

CMN 577 Unit 1 Exam: Hepatitis and HIV

View Set

Cinderella Man Questions - US HISTORY

View Set