Bio Exam questions

Match each of the proteins involved in DNA replication with its function. Some of these proteins have more than one function. 1. helicase 2. topoisomerase II 3. single-stranded binding proteins 4. DNA polymerase attaches DNA nucleotides to an RNA primer unwinds the DNA duplex relieves the stress on the replication fork caused by unwinding proofreads the growing DNA strands and replaces mismatched nucleotides prevents strands of DNA from rejoining after being unwound

4 1 2 4 3

. Proto-oncogenes can change into oncogenes that cause cancer. Which of the following best explains the presence of these potential time bombs in eukaryotic cells? A. Proto-oncogenes normally help promote cell division. B. Proto-oncogenes are mutant versions of normal genes. C. Cells produce proto-oncogenes as they age. D. Proto-oncogenes first arose from viral infections. E. Proto-oncogenes are genetic "junk."

A

. Which type of protein does DNA wrap around so that it can be packaged in a cell? A. histones B. topoisomerase C. ribosomalproteins D. DNA polymerase E. spliceosome proteins

A

A lab technician has a sample of cells and wants to rapidly degrade their membranes. Of the following substances, which should she apply to the cells to achieve her goal? A. A solution that breaks down phospholipids B. A solution that breaks down complex carbohydrates C. A solution that breaks down nucleic acids D. A solution that breaks down simple carbohydrates

A

A new experimental pesticide is being tested by a large agricultural chemical company. An unfortunate side effect in plants treated with this new product is a decrease in ATP production in the chloroplasts. (Interestingly, production of ATP in the mitochondria is unaffected.) Given this observation, which of the following would you expect to be directly affected by the new pesticide? Select one: a. the synthesis of triose phosphates from 3-phosphoglycerate b. the transport of electrons along the photosynthetic electron transport chain c. the carboxylation of RuBP by rubisco d. the oxidation of RuBP by rubisco

A

Assuming A-U and G-C pairing between the anticodon and the codon, what anticodon in tRNAMet would pair with the codon 5'-AUG-3'? A. 5'-CAU-3' B. 5'-GUA-3' C. 5'-UAC-3' D. 5'-ATG-3' E. 5'-AUG-3'

A

CDKs are important in the regulation of the cell cycle. They carry out their function by: A. B. C. D. adding phosphate groups to target proteins. removing phosphate groups from target proteins. degrading cyclin proteins. preventing the progression of a cell from one stage of the cell cycle to the next.

A

Complete oxidation of glucose to CO2 involves two different mechanisms for synthesizing ATP: oxidative phosphorylation and substrate-level phosphorylation. Which is true of substrate-level phosphorylation? a. An enzyme catalyzes the transfer of a phosphate group to ADP from an organic molecule to form ATP. b. Most of the ATP generated in cellular respiration is generated by substrate-level phosphorylation. c. ATP is generated indirectly through the transfer of high-energy electrons from electron carriers to an electron transport chain. d. ATP is generated by release of energy from the electron carriers NADH and FADH2.

A

If the Km for Enzyme A and Substrate B is 25uM and the Km for the same Enzyme A and substrate C is 50uM, what can you conclude? a. Enzyme A has a higher affinity for Substrate B than for Substrate C. b. Enzyme A has a higher affinity for Substrate C than for Substrate B. c. The concentration of the substrate is higher in the experiment with Enzyme A and Substrate C. d. No conclusion can be made.

A

Imagine you have discovered a new species of bacteria. To begin your investigation of this organism, you run an assay on the total nucleotide content of the bacterial DNA. If the cytosine content of DNA from the bacterial cells is 40%, what is the adenine content? A. 10 % B. 20% C. 40% D. 60% E. It is not possible to calculate this number for prokaryotes.

A

Nonvirulent bacteria can still be transformed into virulent bacteria if it is combined with debris from heat-killed virulent bacteria. Which of the treatments listed below will prevent the transformation of bacteria into the virulent type? A. DNase. B. RNase. C. protease. D. no enzyme.

A

One of your friends is arguing that viruses are "alive." What information would you provide to convince him that viruses can't be considered alive? A. Viruses cannot carry out metabolic reactions. B. Viruses contain either RNA or DNA. C. Viruses typically have protein coats, which are distinct from plasma membrane. D. Viruses can carry out metabolic reactions, independent of their environment. E. Viruses hijacks a cell's machinery to insert their genetic material into the cell's genome so viral proteins can be made.

A

Phosphofructokinase (PFK) is an allosteric enzyme that catalyzes a key step in glycolysis. Which of the following is true about this enzyme? Select all that apply. Select one or more: a. ATP acts as an inhibitor of PFK activity b. ADP and AMP are allosteric activators of PFK activity. Correct c. Decreased levels of citrate in the cytoplasm inhibit PFK activity. d. Cells switch to β-oxidation of fatty acids when PFK activity is inhibited.

A

The emperor penguins of Antarctica live on a diet of fish and crustaceans obtained from the cold Antarctic seawaters. During their annual breeding cycle, however, they migrate across the frozen continent to their breeding grounds 50 miles away from the sea (and 50 miles away from their source of food). For over two months the male emperor penguins care for and incubate the eggs while the females return to the sea to feed. During this time a male penguin can lose up to 50% of its biomass (by dry weight). Where did this biomass go? Select one: a. It was converted to CO2 and H2O and then released. b. It was converted to heat and then released. c. It was converted to ATP molecules.

A

The fact that DNA replication occurs in virtually the same way in all organisms reflects: Select one: a. its origin early in the history of life. b. its multiple origins in different lineages of organisms. c. the laws of thermodynamics. d. the fact that mutations are generally harmful. e. the universal genetic code.

A

The reactions of the Calvin cycle used to be referred to as the "dark reactions" of photosynthesis, implying that light was not required for this pathway to incorporate CO2 into carbohydrate. However, in the absence of light the Calvin cycle shuts down. Which of the following parts of the Calvin cycle would be impacted first by the absence of light energy? Select one: a. the reduction of 3-phosphoglycerate and the regeneration of RuBP b. the carboxylation of RuBP and the reduction of 3-phosphoglycerate c. the carboxylation of RuBP and the regeneration of RuBP d. the carboxylation of RuBP and the synthesis of hexose sugars

A

Using PCR, a student wants to amplify a sequence of known DNA from a genomic DNA sample. The two primers are both designed to pair with sequences that have a 40% GC content. Using a particular set of denaturation temperatures, annealing temperatures, and extension temperatures, the experiment does not produce the expected single DNA fragment of a single known size, but instead a set of fragments of varied sizes. Which of the following could account for these results? Select one: a. The annealing temperature was too low so that the primers can bind with multiple genomic sequences that contain some mismatched bases. b. The denaturation temperature was too high so that the primers can bind with each other as well as with multiple genomic sites containing mismatches. c. The extension temperature was too low so that many fragments were terminated before the full fragment was replicated.

A

What is the central dogma? A. DNA is transcribed into RNA, which is translated into protein. B. RNA is transcribed into DNA, which is translated into protein. C. DNA is transcribed into protein, which is translated into RNA. D. RNA is transcribed into protein, which is translated into DNA

A

When fats are used as an energy source, the fatty acids are broken down to acetyl-CoA. That means that fats bypass the reactions of ___ and enter the respiratory pathway at ________. Select one: a. glycolysis; the citric acid cycle b. fermentation; glycolysis c. the citric acid cycle; oxidative phosphorylation d. the citric acid cycle; glycolysis e. oxidative phosphorylation; fermentation

A

Which of the following best describes how ATP synthase converts the potential energy of the proton gradient to the chemical energy of ATP? Do protons flow through the Fo or F1? Select one: a. Kinetic energy from the flow of protons is converted to the kinetic energy of rotation of the F0 subunit; the rotation of the F0 subunit leads to rotation of the F1 subunit, which can then catalyze ATP synthesis. b. The flow of protons through the F0 subunit reduces the F1 subunit, which allows ADP to be oxidized to ATP. c. The flow of protons through the F0 subunit oxidizes the F1 subunit, which allows ADP to be reduced to ATP. d. Kinetic energy from the flow of protons is stored in a new electrochemical gradient within the F0 subunit. The potential energy of the electrochemical gradient, in turn, is converted to kinetic energy in the F1 subunit and used to catalyze ATP synthesis.

A

Which of the following sequences correctly represents the flow of energy through living systems? Select one: a. light -> photosynthesis -> carbohydrate -> cellular respiration -> ATP -> heat b. water -> photosynthesis -> carbohydrate -> cellular respiration -> ATP -> CO2 c. water -> photosynthesis -> carbohydrate -> cellular respiration -> ATP -> water d. light -> photosynthesis -> carbohydrate -> cellular respiration -> ATP -> water e. CO2 -> photosynthesis -> carbohydrate -> cellular respiration -> ATP -> heat

A

Questions 31-32 are related to the sequence below. A double-stranded DNA molecule is being transcribed, only part of which is shown below. The nucleotides shown in bold are the starting point of transcription. 5'-ATGA TCGGA TCGA TCCA T-3' 3'-TACTAGCCTAGCTAGGTA-5' 31. Which of the following is the correct mRNA produced from the transcription of this DNA molecule? A. 5'-AUGAUCGGAUCGAUCCAU-3' B. 3'-AUGAUCGGAUCGAUCCAU-5' C. 5'-UACUAGCCUAGCUAGGUA-3' D. 3'-UACUAGCCUAGCUAGGUA-5' 32. If the RNA transcript resulting from the DNA sequence above is translated codon by codon from one end to the other, which of the following polypeptides would correspond to this mRNA? A. NH2- Met-Ile-Gly-Ser-Ile-His -COOH B. NH2-Tyr-Leu-Ala-Arg-Lue-Val-COOH C. COOH-Met-Ile-Gly-Ser-Ile-His-NH2 D. COOH- Tyr-Leu-Ala-Arg-Lue-Val -NH2

A A

For questions 43-45, choose A if the statement TRUE or B if it is FALSE: 43. Methylated cytosines are often observed in CpG islands near genes that are repressed. 44. Gene regulation by small regulatory RNAs in eukaryotes may have evolved originally as a defense against viruses and transposable elements 45. Histone modification occurs only during early development.

A A B

Questions 26-28 are related to chloroplasts and mitochondrion. Choose A if the statement is True and B if false. 26. Chloroplasts and mitochondria are most closely related to certain bacteria. 27. Mitochondria generate ATP while chloroplasts use the energy in sunlight to make simple sugars. 28. Mitochondria and chloroplasts are integral parts of the endomembrane system and are specifically connected to the endoplasmic reticulum.

A A B

What will happen when the ribosome shifts one codon further on the mRNA, assuming the next codon is not a stop codon? For questions 26-30, select A if the statement is TRUE and B if it is FALSE. 26. The tRNA carrying the polypeptide will be in the P site. 27. The tRNA that was carrying the polypeptide will be ejected from the ribosome. 28. The sites of the ribosomes will be relabeled (from left to right) P, A, E. 29. A new tRNA will bind to the ribosome. 30. The tRNA that is shown in the A site in the figure above will be ejected from the ribosome.

A A B A B

For questions 38-41, choose A if the statement is CORRECT and B if it is INCORRECT 38. The energy of the starting materials for a reaction equals the sum of the product energies plus energy released as heat and disorder. 39. The amount of useable energy resulting from a reaction is always less than the total energy available in the starting materials. 40. The energy in a system that is not available to perform work is referred to as enthalpy. 41. The entropy of the starting materials for a reaction is always greater than the entropy of the products.

A A B B

Which of the following are true of the signal transduction pathways we have discussed this semester? Choose A if the statement is True and B if false. 39. Binding of the signal to the receptor depends on weak, non-covalent interactions. 40. Proteins change their shape and activity when they are phosphorylated. 41. Phosphate molecules are passed from one kinase to the next in kinase cascades. 42. Attachment of Ubiquitin to proteins activates kinase enzymes.

A A B B

Organisms that have been modified to contain DNA from other species are known as: Select all that apply. Select one or more: a. transgenic organisms. b. genetically modified organisms (GMOs). c. recombinant DNA organisms. d. DNA hybrids.

A B

A Cancer Biology lab is leading a research to test the effect of a new drug on activating a tumor suppressor pathway that is known to be inactive in some forms of cancer. To get FDA approval to start trials with humans, they must demonstrate that the side effects of this drug are not lethal. For what we talked in class, which of the steps below (21-24) would normally be followed by a lab doing these types of research? Choose A is the choice is CORRECT and B if it is INCORRECT 21. Find an experimental organism that has homologous genes to those involved in the tumor suppressor pathway. 22. Start with an experimental organism that is complex, like dogs, so the research conclusions are directly applicable to humans. 23. Fruit flies won't be an organism of choice because they have a modular development, which means that different parts in the body of the fly are independently regulated. 24. The experimental organism of choice ideally should have a hig

A B B A

For questions 35-38, choose A if the statement TRUE or B if it is FALSE regarding why the primary transcript in prokaryotes can immediately serve as mRNA while in eukaryotes it undergoes elaborate multistep processing 35. Primary transcripts in eukaryotes contain introns that have to be removed. 36. The sigma factor in eukaryotes is unable to enter the nucleus. 37. A 5¢ cap is added to the prokaryotic primary transcript allowing the ribosome to start translation immediately. 38. Prokaryotes do not have a nuclear envelope and the ribosome can start translation even before transcription ends

A B B A

Which of the following can yield a significant amount of metabolic energy via cellular respiration? Select all that apply. Select one or more: a. candy bar. b. egg. c. multivitamanis d. bread. e. fiber. f. coffee. g. oil.

A B D G

How would you explain the need, in fermenting cells, to acquire more food? Select all that apply. Select one or more: a. Glucose is not fully oxidized in fermentation. b. Since these organisms don't take in oxygen, they don't need much food. c. The energetic gain by fermentation is relatively small. d. They produce alcohol, which gives them enough energy to power the cell.

A C

Which of the following would you expect to observe in response to an increase in the concentration of cellular ADP provided that the cell has plenty of glucose and oxygen? Select all that apply. Select one or more: a. an increase in phosphofructokinase activity b. a decrease in acetyl-CoA production c. an increase in CO2 production d. an increase electron transport chain activity e. an increase in the pH of the mitochondrial matrix f. a decrease in the reduction of oxygen to form water g. an increase in ATP production by substrate-level phosphorylation h. an increase in ATP production by ATP synthase

A C D H

Questions 21-23 are based on the DNA sequence below A. 5'- (promoter)ACAAGATGTACCATCTTTGCGACAGGAGAGAGGATGTGTGTGCGACTGTTAGTGAACGC(Poly-A Signal)-3' B. 3'- (promoter)TGTTCTACATGGTAGAAACGCTGTCCTCTCTCCTACACACACGCTGACAATGACTTGCG(Poly-A Signal)-5' 21. Identify the template strand. Choose A (Top) or B (Bottom) 22. Knowing that introns are indicated by the bolded & underlined sequences, the sequence of a mature mRNA that includes exons 1 and 4 only is: A. 3'-UGUUCUACAUGACACGCUGA-5' B. 5'-AGUCGCACAGUACAUCUUGU-3' C. 5'-ACAAGAUGUACUGUGCGACU-3' D. 3'-UCAGCGUGUCAUGUAGAACA-5' 23. The peptide sequence of the mature mRNA that you determined in question 22 is: A. NH2- Met -COOH B. NH2-Cys-Ser-Thr-COOH C. Met-Tyr-Cys-Ala-Thr-COOH D. NH2- Ser-Arg-Thr-Val-His-Leu -COOH E. There is not a start codon

A C or D C

Which of the following could be true if a plant cell is exposed to a toxin that makes the thylakoid membrane freely permeable to protons? Select all that apply. Select one or more: a. There would be no ATP available to drive carbohydrate synthesis in the Calvin cycle. b. There would be no ATP needed to split water molecules early in the light-dependent pathway. c. There would be no ATP produced in the chloroplasts to power photosynthesis in the absence of light energy. d. The amount of NADPH in the chloroplast would increase. e. ATP generated by the mitochondria would be used to power photosynthesis, so plant cells would not have enough ATP left to supply the many other processes that require it.

A D

Questions 43-47 are related to cell division. Choose A for mitosis, B for meiosis, C for both, and D nor neither. 43. produces two genetically identical, diploid daughter cells 44. produces four genetically identical, haploid daughter cells 45. parent cell undergoes two rounds of DNA replication 46. homologous chromosomes exchange DNA prior to dividing 47. parent cells are diploid

A D D B C

A few years ago, a group of scientists discovered a sea slug that was able to harvest and maintain chloroplasts from algae. The slug did not feed on the algae. Scientist called these organisms "solar powered sea slugs". In classifying organisms according to their source of energy and carbon, how would you classify this "solar powered sea slug? a. as photoheterotrophs b. as photoautotrophs c. as chemoautotrophs d. as chemoheterotroph

B

A novel virus is discovered in which each virus particle includes both double-stranded DNA and single- stranded RNA. The sequence of the RNA is not complementary to either of the strands of DNA. To determine whether the genetic material of the virus consists of the DNA or the RNA, or both, you conduct three different experiments. In the first, you try infecting cells with the virus's DNA alone; in the second, you try infecting the cells with the virus's RNA alone; and in the third, you try infecting the cells with both the virus's DNA and RNA together. What result would tell you that the DNA alone is the genetic material? Remember that a virus particle inserts its genetic material into a host cell, and that the host cell expresses the genetic material as if it were its own genetic material, producing many more viruses. A. The first and second experiments result in infections but the third does not. B. The first and third experiments result in infections but the second does not. C. The second and third experiments result in infections but the first does not. D. The first experiment results in an infection but the second and third do not.

B

Alternative splicing allows for: A. two or more different proteins to be made from a single processed mRNA. B. different polypeptides to be made from a single gene. C. increased stability of a mature mRNA. D. enhanced recognition of an mRNA by a ribosome. E. multiple genes to be used to code for a single polypeptide chain

B

An increase Tm (melting temperature) for a dsDNA (double stranded DNA) may be due to a high content of C+G. This is because: A. G and C are bonded with an ionic bond, which require more energy to break, as oppose to the double hydrogen bonds between A and T. B. G and C are bonded with a triple hydrogen bond, which may require more energy to break, as oppose to the double hydrogen bonds between A and T. C. G and C are bonded with a double hydrogen bond, which may require more energy to break, as oppose to the triple hydrogen bonds between A and T. D. G and C are bonded with a covalent bond, which may require more energy to break, as oppose to the triple hydrogen bonds between A and T.

B

Arrange the steps in RNA splicing in order from earliest to latest. 1 - exon ends are covalently joined together 2 - components of the spliceosome bind conserved regions near the 5′ end of the intron 3 - the spliceosome brings the 5′ splice site close to the splice site at the 3′ end of the intron, cleaving the bond that holds the lariat on the transcript 4 - the proximity enables a reaction that cuts the RNA at the 5′ splice site, and the cleaved end of the intron connects back on itself forming a lariat

B

Cellular respiration releases energy. In cellular respiration: a. organic molecules such as carbohydrates are converted to chemical energy that can be used to do the work of the cell. b. the chemical potential energy stored in organic molecules is converted to chemical energy that can be used to do the work of the cell. c. chemical potential energy in the bonds of ADP is transferred to the chemical potential energy in the bonds of ATP.

B

Choose the correct order of the substrate of each of the phases of cellular respiration. a. Electron carriers > Glucose > Pyruvate > Acetyl-CoA b. Glucose > Pyruvate > Acetyl-CoA > Electron Carriers c. Pyruvate > Acetyl-CoA > Electron Carriers > Glucose d. Acetyl-CoA > Electron Carriers > Glucose > Pyruvate

B

During photosynthesis, is reduced to . Select one: a. water; carbon dioxide b. carbon dioxide; sugar c. oxygen; water d. sugar; oxygen e. carbon dioxide; oxygen

B

Hydrolytic enzymes must be segregated and packaged to prevent general destruction of cellular components. Which of the following organelles contains these hydrolytic enzymes in animal cells? A. Central vacuole. B. Lysosome. C. Chloroplast. D. Mitochondrion. E. Ribosome.

B

In humans and other mammals, dosage compensation is achieved by: A. males transcribing twice the normal amount of copies of X-chromosome genes. B. females randomly inactivating one X chromosome in each cell. C. females inactivating the paternal X chromosome in each cell. D. females decreasing transcription of both X chromosomes by half. E. females eliminating one X chromosome in each cell.

B

In transcription, the energy to attach each successive ribonucleotide to the growing RNA chain comes from: A. the RNA polymerase itself. B. cleavage of the high-energy phosphate bonds of the incoming nucleotide. C. cleavage of the high-energy phosphate bonds of the growing transcript. D. cleavage of the 2' hydroxyl group on the ribose of the incoming nucleotide.

B

Low temperatures slow the activity of rubisco but enhance its ability to select CO2 over O2. Low temperatures thus: Select one: a. increase photorespiration rates. b. decrease photorespiration rates. c. increase the production of reactive oxygen species. d. increase photosynthesis rates.

B

Many promoters of a hypothetical conserved gene have mostly adenines and thymines. What is the most likely reason for this high proportion of adenines and thymines? A. RNA polymerases are better at incorporating uracils and thymines into RNA molecules than incorporating guanines and cytosines. B. This is the region for separating template and nontemplate strands, and A-T base pairs are easier to separate than G-C base pairs. C. Accessory proteins like sigma factors or transcription factors bind more easily to AT-rich sequences than they do to GC-rich sequences. D. It is possible to create more unique sequences for recognition with adenines and thymines than it is with guanines and cytosines. E. None of the other answer options is correct.

B

Predict how phospholipids arrange themselves when they are placed in a nonpolar solution. A. The phospholipid heads would orient toward the solution. B. The phospholipid tails would orient toward the solution. C. The phospholipids would form a bilayer. D. The phospholipid would form a liposome.

B

Protein folding starts taking place as soon a protein is being synthesized, but chaperones prevent it from fully folding until translation is completed. How do chaperones recognized unfolded or misfolded proteins? a. In the cell, chaperones recognize hydrophilic R groups that are exposed on unfold proteins. b. In the cell, chaperones recognize hydrophobic R groups that are exposed on unfold proteins. c. In the cell, chaperones recognize and bind to the SRP signal sequence of the nascent polypeptide. d. In the cell, chaperones recognize and bind to a localization sequence.

B

The regeneration of RuBP typically limits the rate of photosynthesis under low light intensities. This is because: Select one: a. RuBP regeneration requires ADP. b. RuBP regeneration requires ATP. c. RuBP regeneration is part of the "dark reactions." d. photosynthesis occurs only in high light.

B

What happens to the carbon atoms of glucose as they pass through glycolysis? a. One molecule of glucose becomes six molecules of carbon dioxide and some of the carbon atoms are converted to ATP. b. One molecule of glucose becomes two molecules of pyruvate and some of the carbon atoms are oxidized. c. One molecule of glucose becomes six molecules of carbon dioxide and all of the carbon atoms are reduced. d. One molecule of glucose becomes two molecules of pyruvate and some of the carbon atoms are converted to energy.

B

When we say that DNA replication is semiconservative, we mean that: Select one: a. only half of an organism's DNA is replicated during each cell division. b. when DNA is replicated, each new double helix contains one parental strand and one newly synthesized daughter strand. c. when DNA is replicated, one double helix contains both parental strands and one contains two newly synthesized daughter strands. d. parental DNA stays in the parent cell and daughter DNA ends up in the daughter cell.

B

Which major checkpoint delays the cell cycle when DNA replication is incomplete? A. G1 checkpoint B. G2 checkpoint C. M checkpoint D. G1, G2, and the M checkpoints E. None of the checkpoints delays the cell cycle when DNA replication is incomplete.

B

Which of the following would be inhibited by a drug that specifically blocks the addition of phosphate groups to proteins? A. ligand-gated ion channel signaling B. receptor tyrosine kinase activity C. G protein-coupled receptor signaling D. adenylyl cyclase activity E. phosphatase activity

B

Which one of the following statements is TRUE about cellular respiration? a. The ultimate receptor of electrons during the electron transport chain is the ATP synthase. b. The only phase of cellular respiration that has endergonic reactions is Glycolysis. c. An increase in the strength of the proton gradient in the inner membrane of a mitochondrion would make the ATP synthase spin slower. d. The high-energy electrons from electron carriers are transferred directly to the ATP.

B

Why fruit flies are called "a geneticist Swiss Army knife"? a. Because they have a low recombination rate. b. Because there is a huge collection of transgenic flies (i.e. manipulated genome). c. Because they have many homologous genes with vertebrates. d. Because it's an organism that has been used by geneticists for over 100 years.

B

You are doing a study on a new protein in bacteria. You found that some key amino acids in the active site of this enzyme are two Arginines and one Lysine. What would you predict the substrate's chemical properties to be? a. Hydrophobic b. Hydrophilic and negatively charged c. Hydrophilic and positively charged d. Cannot tell from this information

B

You may be familiar with the story of Philippides, the famous Greek runner who is said to have run from Marathon to Athens to deliver news of a military victory against the Persians at the Battle of Marathon, and then died after completing his run. Based on what you know of aerobic respiration and fermentation, why might Philippides have died? Select one: a. His muscles may have produced toxic levels of lactic acid, causing his blood to become more basic. b. His muscles may have produced toxic levels of lactic acid, causing his blood to become more acidic. c. His muscles may have produced toxic levels of ethanol, causing his blood to become more basic. d. His muscles may have produced toxic levels of ethanol, causing his blood to become more acidic. e. His muscles may have produced toxic levels of both ethanol and lactic acid, causing his blood to become more acidic.

B

Which of the following would disrupt the signaling pathway described in Diagram 1 and cause no output to occur? 33. Mutate the TK1 gene such that the resulting TK1 protein is constantly in an active state. 34. Mutate the RTK receptor such that it cannot dimerize.

B A

Questions 29-34 are based on the Diagram 1, below. Choose A if the statement is True and B if false. Diagram 1 (REFERENCE TEST) 29. Before the cell is exposed to signal, TK1 is phosphorylated 30. Binding of signal causes the receptor to dimerize, which leads to activation of the receptor's kinase function 31. If TFa is mutated such that it cannot be phosphorylated, then it cannot enter the nucleus 32. A feedback loop could occur if activation of the transcription factor (TFa) leads to the production of a phosphatase that targets the receptor.

B A A A

• For the examples in questions 31-35, chose A if it is CATABOLISM and B if it is ANABOLISM 31. synthesis of new DNA copies prior to cell division 32. hydrolysis of glycogen (a glucose polymer) during activity 33. break down of fat (triglyceride) stores as a source of cellular energy 34. a person losing weight on a calorie restriction diet 35. an animal increasing its fat reserves before going into hibernation

B A A A B

For question 17-20, choose A is the statement is CORRECT and B if it is INCORRECT The lactose operon is under positive control by the CRP-cAMP complex. In order for the operon to be fully inducible, the CRP-cAMP complex must be: 17. CRP-cAMP complex must be at low concentration. 18. CRP-cAMP complex must be at high concentration. 19. CRP-cAMP complex must be bound to the regulatory region of the operon. 20. CRP-cAMP complex must be absent from the regulatory region of the operon.

B A A B

For questions 39-42, choose A if the statement TRUE or B if it is FALSE regarding why the 5' cap is added to the RNA during processing: 39. helps prevent formation of complex three-dimensional structures in the messenger RNA. 40. helps prevent rapid breakdown of the messenger RNA. 41. is needed for ribosomes to attach to messenger RNA. 42. aids in the accuracy of translation of the messenger RNA into protein.

B A A B

Choose A if the statement is True and B if false. A new, photosynthetic single-celled organism was recently discovered and was classified by the team of scientists who discovered it as a new species of bacterium. If they are correct, which of the following would you expect to be true of this organism? 21. The cell has membrane-bound organelles, including an endoplasmic reticulum and lysosomes. 22. The cell's genetic material is localized to a region called the nucleoid. 23. The cell has ribosomes. 24. The cell has chloroplasts. 25. The cell synthesizes most of its ATP in mitochondria.

B A A B B

For questions 47-50, choose A if the statement TRUE or B if it is FALSE regarding mechanisms of gene regulation; 47. Mutations that prevent the methylation of histones associated to tumor suppressor genes may cause cancer. 48. A single gene can produce different proteins. 49. Acetylation is a mechanism often used by cells to prevent the expression of harmful (mutant) genes such as those responsible for genetic diseases like cystic fibrosis. 50. Chromatin may be remodeled by chemical modification of the chromosome's histone proteins.

B A B A

Questions 35-42 are based on the Diagram 2, below. Choose A if the statement is True and B if false. *REFERENCE EXAM* You are studying a developing chick embryo and decide to isolate a cell and figure out what kind of cell it is. These tests find: - The SR (self-renewal) receptor is present - The DIV (cell division) genes are on - The DIFF (skin differentiation) genes are blocked - TF (transcription factor) of the neuron pathway is in the cytoplasm - TK2 of the skin pathway is not phosphorylated 35. This cell is most likely a differentiating skin cell 36. TK1 of the neuron pathway is phosphorylated 37. The ID (inhibitor of differentiation) genes are on 38. TF of the Neuron pathway is in the nucleus

B A B A

For questions 42-45, use the figure on the right. Choose A if the statement is CORRECT and B if it is INCORRECT. * *REFERENCE EXAM 42. The dotted line curve represents a reaction without an enzyme 43. C indicates the activation energy of the catalyzed reaction 44. The change in free energy (DG) is indicated by arrow E 45. This reaction should occur spontaneously

B B A A

DNP (2,4-dinitrophenol) is an effective weight-loss agent that was used in diet pills in the 1930s. It has since been removed from the market (though it is available online) because of serious side effects such as fever, cataracts, rashes, and sometimes death. DNP inserts into the inner mitochondrial membrane and shuttles protons between the intermembrane space and the matrix. Based on this information, which of the following might you predict? Select all that apply. Select one or more: a. increased hydrolysis of ATP b. reduced ATP production c. dissipation of the proton gradient d. increased ATP production

B C

For questions 17-19, use the representation of a protein, and identify: REFERENCE TEST 17. Alpha helix 18. Beta sheet 19. Tertiary structure

B C A

How would you characterize the process of fermentation? Select all that apply. Select one or more: a. a very useful way of deriving energy without oxygen as the amount of ATP made is high b. a limited way of deriving energy without oxygen as the amount of ATP made is low c. a useful process in the production of alcohol d. a useful process in the production of cheese and yogurt e. a useful process for making glucose f. a useful process for organisms that were present when there was very little atmospheric oxygen

B C D F

Questions 48-50 are related to the statement below. You are doing an experiment on a new class of G protein−coupled receptor. You make several cell lines that each express the receptor, the corresponding G protein, and adenylyl cyclase. Each cell line has different mutations in these components. You decide to measure cyclic AMP (cAMP) in the cells of each cell line to understand the effect of each of these mutations. Below is a list of mutations. For each, choose A if the amount of cAMP in the cells will increase, B if cAMP will decrease, or C if cAMP will stay the same. 48. A mutation in the G protein−coupled receptor that prevents it from binding to the G protein. 49. A mutation in the α subunit of the G protein that prevents the release of bound GTP. 50. A mutation of the G protein−coupled receptor that allows it to bind the α subunit of the G protein in the absence of ligand.

BAA

. G protein-coupled receptors are transmembrane receptors involved in cell signaling. The amino acid sequence of these proteins reveals that the polypeptide chain of the protein has seven hydrophobic regions. Based on this information, what can you conclude about how the protein is associated with the cell membrane? A. The receptor is likely to be a peripheral membrane protein. B. The polypeptide chain is likely to span the membrane once. C. The polypeptide chain is likely to span the membrane seven times. D. The polypeptide chain is likely to span the membrane fourteen times. E. The receptor is likely to be synthesized on free ribosomes.

C

. Rosalind Franklin's famous Photo 51provided the final clues to Watson and Crick to determine the structure of the molecule of DNA. What conclusion did Crick reach after learning about the measurements of the picture? A. Because the distance between the two strands was always equal, Crick concluded that purine molecule (adenine or guanine) always bonds with other purines and pyrimidine molecule (cytosine or thymine) always bonds with other pyrimidine. B. Because the distance between the two strands was always equal, Crick concluded that purine molecules (adenine or guanine) and pyrimidine molecules (cytosine or thymine) should make a triple helix DNA molecule. C. Because the distance between the two strands was always equal, Crick concluded that a purine molecule (adenine or guanine) always bonds with pyrimidine molecule (cytosine or thymine). D. Because the distance between the two strands was always equal, Crick concluded that purine molecules (adenine or guanine) and pyrimidine molecules (cytosine or thymine) should be outside of the DNA molecule.

C

. You are studying the transport of a particular substance into epithelial cells grown in culture. You notice that you can only find the substance inside the cell when ATP is present. How is the protein moving through the membrane? A. By facilitated diffusion. B. By passive transport. C. By active transport. D. By simple diffusion

C

A researcher is evaluating the expression of p53 in cells she is culturing in the laboratory. She notices that in a small group of cells, high levels of phosphorylated p53 occur in the nuclei. What can she deduce about these cells? A. These cells are normal. B. Within these cells, the cell cycle has been halted at the G2/M transition. C. These cells likely contain damaged DNA. D. All of these cells have entered meiosis. E. All of these cells have entered mitosis.

C

After several weeks of no rain during the summer, you observe that leaves of some plants are wilted. Which of the following would you expect to observe at the cellular level with respect to photosynthesis? Select one: a. More glucose is going to be produced to compensate for the absence of water. b. The rate of the oxidation and reduction of the thylakoid electron transport chain will be greater than normal. c. The rate of the reduction of chlorophyll molecules will be decreased. d. More CO2 will be incorporated into carbohydrate. e. More ATP is going to be synthesized by ATP synthase in the chloroplasts.

C

As a piece of linear DNA is replicated, the leading strand will have _________ RNA primer(s) and the lagging strand will have ________ RNA primer(s). Select one: a. one; one b. one; two c. one; many d. many; one e. many; many

C

Continuing your experiment with "red" and "green" labeled chromosomes, you allow cells with DNA labeled "red" in both DNA strands to undergo two rounds of DNA replication in the presence of "green" nucleotides. What pattern of fluorescence would you expect to see in the sister chromatids of each chromosome? Select one: a. one chromatid red, the other green b. one chromatid red, the other yellow c. one chromatid green, the other yellow d. both chromatids yellow

C

During elongation of translation, the growing polypeptide is transferred from the tRNA in the ______ site of the ribosome to the tRNA in the _______ site as a peptide bond is formed between the growing polypeptide and the newest tRNA. A. A;P B. A;E C. P;A D. P;E E. E;A F. E;P

C

In human cells such as muscle tissue, the product of fermentation is: Select one: a. acetic acid. b. pyruvate. c. lactic acid. d. FADH2. e. ethanol.

C

In the gel diagram below, note that the DNA fragments in lane 1 are sorted by size and that the larger size fragments move a smaller distance from their original positions in the slots at the top of the gel. Why do smaller fragments move a greater distance than larger fragments in an electrophoresis gel? a. The smaller fragments have fewer negative charges along the DNA backbone. b. The smaller fragments are more likely to remain double stranded. c. The smaller fragments have less difficulty getting through the pores in the gel. d. The smaller fragments are less likely to get tangled up with one another.

C

The parallel lines shown here represent the paired strands of a DNA double helix. If this molecule undergoes one round of replication, which ends are shorter in the daughter molecules than in the parental molecules? https://moodle.umass.edu/pluginfile.php/2033893/question/questiontext/2161215/4/1025554/paralleleDNA.png Select one: a. w and x b. w and y c. w and z d. y and x e. y and z

C

Which one of the following interactions is not a stabilizing force at the tertiary level of protein organization? A. an ionic bond between a positively charged R group and a negatively charged R group B. hydrophobic clustering of nonpolar R groups in the interior of a protein C. hydrogen bonding between the carbonyl oxygen of one peptide bond and an amide hydrogen of a nearby peptide bond D. disulfide linkages between cysteine residues E. van der Waals interactions between R groups in close proximity

C

Which product(s) of the Calvin cycle is (are) exported from the chloroplast for use by the plant cell? Select one: a. RuBP b. sucrose and glucose c. triose phosphates d. NADPH e. ATP

C

Why do the functions of many receptor kinases depend on the fluid nature of the plasma membrane? A. The generation of cAMP requires a fluid membrane. B. Binding of ligand to the receptor requires a fluid membrane. C. The receptor monomers must move together and dimerize to be activated. D. Phosphorylation requires a fluid membrane.

C

• Using the figure shown on the right, identify what is represented by each of the curves. Note that the first curve on the top is A, the one in the middle is B, and the third one on the bottom is C. For each of the statements below, select the appropriate letter. REFERENCE TEST 26. This curve represents the effect of a noncompetitive inhibitor. 27. This curve represents a normal enzyme. 28. This curve represents the effect of a competitive inhibitor

C A B

8. Thinking of gene expression in eukaryotic cells during the cell cycle, in which phase of the cell cycle is gene expression almost completely shut down? A. G1 phase B. Sphase C. G2 phase D. M phase

D

A double-stranded DNA molecule contains 2% of the trinucleotide 5'-ATG-3'. What other trinucleotide also has an abundance of 2%? A. 5'-TAC-3' B. 3'-CAT-5' C. 5'-CAT-3' D. 3'-TAC-5'

D

A research group has discovered an organism with cells that contain a previously undescribed organelle. They do some tests on the isolated organelle to see if it is involved in any major metabolic reactions. To do this, they incubate these organelles for a period of time and determine changes in the amount of various substances in the suspending solution. The results follow. glucose-NO CHANGE CO2-NO CHANGE O2- DECREASE ATP-INCREASE NADH-DECREASE Select one: a. pyruvate oxidation b. citric acid cycle c. glycolysis d. electron transport chain/oxidative phosphorilation e. glycolysis and the citric acid cycle

D

Consider a cell in which one of the proteins or enzymes involved in DNA replication is altered in a way that results in an increased rate of single-base changes in the newly synthesized DNA strand. Which function of which protein is most likely disrupted in this situation? Select one: a. the unwinding function of helicase b. the winding stress relief function of topoisomerase II c. the fragment joining function of DNA ligase d. the proofreading function of DNA polymerase e. the strand separation function of single-stranded binding protein

D

Folding domains show how structure relates to function because: A. they create regions whose shape and charge can bind specific small molecules. B. they create surfaces whose shape and charge allows them to interact with other folding domains. C. they change the configuration of the polypeptide in such a way as to facilitate proper folding of other regions. D. All of these choices are correct.

D

Forensic technicians unearth a skeleton from a shallow grave. They extract a tiny amount of DNA from the pulp found in the teeth. How could they obtain sufficient DNA for an analysis of the victim's genes? Select one: a. subject the DNA to gel electrophoresis b. use a nucleic acid probe c. subject the specimen to amniocentesis d. use the polymerase chain reaction e. subject the DNA to restriction enzymes

D

Imagine that a primary RNA transcript from your favorite eukaryotic gene was processed incorrectly, such that it has no 5' cap. What would be the result? A. Translation would proceed normally. B. Termination would be affected, as release factors would be unable to bind to ribosomes. C. Translation would commence at an AUG site in the middle of the RNA sequence. D. The initiation complex would fail to form properly, and translation would not occur. E. Translation would commence properly, but elongation would be severely affected.

D

Insulin is a protein hormone that helps to control the level of glucose in the blood. It is secreted from specialized cells in the pancreas. Based on this information, which path does insulin take out of the cell? A. ER membrane à vesicle membrane à plasma membrane à exterior of cell B. vesicle à ER à Golgi apparatus à exterior of cell C. nucleus à ER à Golgi apparatus à vesicle à exterior of cell D. ER à Golgi apparatus à vesicle à exterior of cell E. ER à nucleus à cytosol à exterior of cell

D

Several chemical properties make water uniquely suited for its role as a central "molecule of life." Which of the following is false? A. Hydrogen bonding leads to high cohesiveness between water molecules. B. Water resists temperature changes. C. Water molecules are always polar. D. Water is a good solvent of polar and non-polar molecules.

D

The oligonucleotide primers used in the polymerase chain reaction are typically 20-30 nucleotides in length or longer; however, for purposes of this problem let's assume that six nucleotides is long enough. You wish to amplify the fragment shown below (the raised dots indicate several kilobases of DNA sequence not shown) and decide to design primers corresponding to the regions that are shown in bold. What primer sequences would you use? 5'-TCAAACTTGCATGTG•••GAGCCATGTGGCACAAA-3' 3'-AGTTTGAACGTACAG•••CTCGGTACACCGTGTTT-5' Select one: a. 5'-GCAAGT-3' and 5'-TGCCAC-3' b. 5'-ACTTGC-3' and 5'-GTGGCA-3' c. 5'-GCAAGT-3' and 5'-GTGGCA-3' d. 5'-ACTTGC-3' and 5'-TGCCAC-3'

D

What feature of double-stranded DNA makes it necessary to have a leading strand and a lagging strand during replication? Select one: a. the hydrogen bonding between bases b. the base stacking of the bases c. the negative charge on the sugar-phosphate backbone d. the antiparallel orientation of the strands

D

Why did scientists many years ago believe that protein was the storage molecule for genetic information instead of DNA? A. There are more building blocks for protein than there are for DNA. B. Proteins have a wider variety of three-dimensional shapes than DNA. C. Proteins carry out a great range of cellular functions. D. All of these choices are correct.

D

You find a way to attach either a red or green fluorescent dye to nucleotides. Double-stranded DNA molecules with both strands labeled red fluoresce red, those with both strands labeled green fluoresce green, and those with one strand labeled red and the other green fluoresce yellow. You grow human cells in the presence of "red" nucleotides until both DNA strands of all chromosomes fluoresce red. You then allow one round of DNA replication in the presence of "green" nucleotides. What pattern of fluorescence do you expect to see in the sister chromatids of each chromosome? Select one: a. one chromatid red, the other green b. one chromatid red, the other yellow c. one chromatid green, the other yellow d. both chromatids yellow

D

Celery stalks that are immersed in fresh water for several hours become stiff and hard. Similar stalks left in a 0.15 M salt solution become limp and soft. From this we can deduce that the cells of the celery stalks are A. hypertonic to both fresh water and the salt solution. B. hypotonic to fresh water but hypertonic to the salt solution. C. isotonic with fresh water but hypotonic to the salt solution. D. hypotonic to both fresh water and the salt solution. E. hypertonic to fresh water but hypotonic to the salt solution.

E

If there was a mutation in the vacuole of a plant cell that makes the water molecules leak out into the environment, what would occur? A. The plant would be limp B. The cells would not have adequate turgor pressure C. Cellular processes would not function properly D. OnlyAandB E. A,B,andC F. None would occur

E

In the experiments conducted by Avery, McCarty, and MacLeod (extracts of virulent + nonvirulent bacteria were treated with a different enzyme that would destroy either DNA, RNA, or protein), which one of the following hypothetical results would indicate that protein, not nucleic acid, was Griffith's transforming principle? A. None of the extracts from heat-killed cells is able to transform nonvirulent bacteria. B. All of the extracts from heat-killed cells are able to transform nonvirulent bacteria. C. Only the extracts from heat-killed cells treated with RNase are unable to transform nonvirulent bacteria. D. Only the extracts from heat-killed cells treated with DNase are unable to transform nonvirulent bacteria. E. Only the extracts from heat-killed cells treated with protease are unable to transform nonvirulent bacteria.

E

What determines the shape of a protein? A. The polarity of the amino acids' R group B. Itsfunction C. The hydrogen bonds between amino acids that form the alpha helices or beta sheets D. Only A and B E. Only A and C

E

When we say that the cell is the fundamental unit of life, we mean that: A. All living things are made up of one or more cells. B. The smallest entity that can be considered living is a cell. C. A single cell can carry out all life processes. D. Life doesn't exist in the absence of cells. E. All of the answer options are correct.

E

In addition to introducing mutations in a gene, DNA editing by means of CRISPR can also correct mutations in a gene. Select one: True False

TRUE

In the lactose operon of E. coli, the lacP- mutation: a. never produces the structure genes b. produces the structural genes only in the presence of the inducer c. produces the structural genes only in the absence of the inducer d. produces the structural genes all the time

a

A cell that normally lives in an environment at 24 degrees Celsius is exposed to 50 degrees celsius for a half hour. What do you predict would happen to the proteins' structures in the cell? that normally lives in an environment at 24 degrees Celsius is exposed to 50 degrees Celsius for a half a. Proteins will move faster, increasing entropy. b. The proteins would be denatured. c. The proteins will be degraded. d. The proteins will become activated.

b

For the same cell in the question above, you run and experiment and find out that not all the cell's protein have been affected by the increase in temperature. How would you explain this observation? a. The proteins not affected by the heat have a completely different primary structure from the proteins that were affected. b. The cell expresses a chaperone protein that shielded some proteins from the heat. c. The mRNA of the proteins affected by the heat was weaker. d. The proteins that were affected by the heat have more hydrophilic amino acids.

b

Which of the following amino acid changes you predict it might NOT CAUSE A CHANGE in the function of a protein? a. Alanine is normally in the inside of a globular protein and it changed to Cysteine. b. Aspartate is normally part of the active site of an enzyme and got changed to Glutamate. c. Proline is normally on the surface of a fibrous protein changed to a Phenylalanine. d. A change on the amino acid sequence always affects the function of a protein.

b

Use the attached protein sorting diagram to answer to questions 6-10. Mark A if the statement is CORRECT and B if it is INCORRECT. 6. The enzyme helicase, which is involved in DNA replication, will be synthesized in a ER bound ribosome. 7. A nascent peptide that has an anchor signal must also have a signal sequence for SRP. 8. Enzymes present in the lumen of the Golgi apparatus are responsible for modifying proteins and lipids. Therefore, they must be synthesized in free ribosomes. 9. Most proteins containing a signal sequence located at their amino terminal ends are sorted to a mitochondrion or chloroplast. 10. Cells in pancreas that produce insulin must have enlarged RER.

b a b b a

Which of the following genotypes produces functional lactose permease constitutively? a. I+P+O+Z-Y+ b. I+P+O+Z+Y- c. I-P+O+Z-Y+ d. I-P+O+Z+Y-

c

Which of the following is not a function of the signal recognition particle (SRP)? a. halts translation. b. binds to the ribosome. c. binds to a channel in the rough endoplasmic reticulum. d. targets certain proteins to be synthesized on the rough endoplasmic reticulum.

c

. The following are two genotypes of the lactose operon in E. coli: I+ P- Oc Z+ Y+ I- P+ O+ Z+ Y+ Do either of these genotypes produce β-galactosidase and permease in the presence of lactose? a. Both produce β-galactosidase and permease. b. Neither produces β-galactosidase and permease. c. The first one produces β-galactosidase and permease, the second does not. d. The first one does not produce β-galactosidase and permease, the second does.

d

What kinds of molecules are most likely to pass through a cell membrane by passive diffusion? A. large polar B. large and hydrophobic C. ionic D. small and hydrophobic E. glucose

d

Which of the following is one of the ways that the membranes of winter wheat are able to remain fluid when it is extremely cold? A. By increasing the length of phospholipid chains in the membrane. B. By decreasing the number of hydrophobic proteins in the membrane. C. By increasing the percentage of cholesterol molecules in the membrane. D. By increasing the percentage of unsaturated phospholipids in the membrane.

d

• Use the attached diagram of the Lac Operon for questions 11-13 11. Where would the lac repressor be bound in a (nonmutant) E. coli cell that is growing in low glucose and high lactose? a. P b. O c. PandO d. The repressor would not efficiently bind to the DNA under these conditions 12. Which parts of the DNA region shown in the diagram encode proteins? a. P b. Z,Y c. P,O,Z,Y d. I,Z,Y e. I,P,O,Z,Y 13. Which one of the following statements about mutations in the lactose operon is not correct? a. A lacI mutant would result in the loss of expression of repressor protein. b. A lacI mutant would allow continuous or constitutive expression of both β-galactosidase and lactose permease. c. A mutation in the lacO sequence would allow continuous or constitutive expression of both β- galactosidase and lactose permease. d. In cells containing one mutant and one normal copy of lacI, the repressor is still expressed and lacZ and lacY will be expressed only in the presence of lactose. e. In cells containing one mutant and one normal copy of lacO, lacZ and lacY, both β-galactosidase and lactose permease are expressed only in the absence of lactose.

d d e