BIO test 1
Recall what you know about isotopes. What differentiates isotopes of the same element? # of protons # of electrons # of neutrons charge
# of neutrons
During a laboratory experiment, you discover that an enzyme-catalyzed reaction has a ?G of -20 kcal/mol. If you double the amount of enzyme in the reaction, what will be the ?G for the new reaction? -20 kcal/mol0 kcal/mol+40 kcal/mol+20 kcal/mol-40 kcal/mol
-20 kcal/mol
Select the number for the location that represents the earliest time in this phylogenetic tree. 53421
1
How many hydrogen atoms are present in a hydrocarbon chain of five carbon atoms with one double bond and the rest single bonds? 10 Each carbon can have a total of 4 covalent bonds.8126
10
Betty chugs a liter of coke (pH = 3) and gets an upset stomach. She eats some TUMS (pH 10) to make it feel better. What is the difference in [H+] between the coke and the TUMS? 3.3 7 700 10,000,000
10,000,000
The concentration of [H+] in a solution is 1.35 x 10-11. The pH of the solution is ___ and it is ____. 10.9, basic -10.9, acidic -1.35, acidic 1.35, basic
10.9, basic
The concentration of [H+] in a solution is 1.35 x 10-11. The pH of the solution is ___ and it is ____. -10.9, acidic 10.9, basic1.35, basic1.35, acidic
10.9, basic
The number of neutrons in Pb (lead) is 82 125 207 cannot be determined
125
This figure describes an observational study. What was measured and observed in this study? Select all that apply. height of grasses over timephytoliths in the soiltemperature over time13C and 14C in mammal teeth
13C and 14C in mammal teeth phytoliths in the soil
In the DNA of certain bacterial cells, 16% of the nucleotides are adenine (A). What are the percentages of the other nucleotides in this DNA? 16% T, 34% G, 34% C 16% U, 34% G, 34% C 34% T, 34% G, 16% C 34% T, 16% G, 34% C
16% T, 34% G, 34% C
A template strand of DNA is read in the ___ direction in order to direct synthesis of RNA in the _____ direction. 3' --> 5', 3' --> 5' 5' --> 3', 3' --> 5' 3'--> 5', 5' -->3' 5' --> 3', 5'--> 3'
3' --> 5', 3' --> 5' (Orient yourself in terms of the growing RNA molecule. Remember, the new RNA strand begins synthesis at its 5' end! We say the RNA grows 5' --> 3'. Since nucleic acids always base pair with each other in the anti-parallel fashion, it means the template for RNA synthesis must be in the opposite direction. Therefore, the RNA polymerase reads ("moves along) the template strand in the 3' --> 5' direction.)
Select all. What is this DNA Sequence? TGAC CAGT 3' TGAC 5' 5' CAGT 3'
3' TGAC 5' 5' CAGT 3' (To correctly give a nucleic acid sequence, you must indicate the 3' and 5' ends.)
A double stranded DNA sequence is shown. The terminator sequence for the gene is on the left. The red base pairs indicates where transcription begins. What is the RNA sequence transcribed for this gene? 5' ACTTAGCCAATTA 3' 3' TGAATCGGTTAAT 5' 3' TGAATCGGTTA 5'5' ACUUAGCCAAUUA 3'3' UGAAUCGGUUA 5'3' UGAAUGCCUUAAU3'5' ACUUAGCCAAU 3'
3' UGAAUCGGUUA 5'
A diploid plant species has 16 chromosomes. How many chromosomes are in a tetraploid "version" of this plant? In the hexaploid? In the octoploid? 12 in the tetraploid, 18 in the hexaploid, and 24 in the octoploid32 in the tetraploid, 48 in the hexaploid, and 56 in the octoploid16 in the tetraploid, 24 in the hexaploid, and 32 in the octoploid32 in the tetraploid, 48 in the hexaploid, and 64 in the octoploid
32 in the tetraploid, 48 in the hexaploid, and 64 in the octoploid
In this figure, how many generations are shown? 32154
4
Select the number for the location that represents the earliest time in this phylogenetic tree. 1325 In a phylogenetic tree, time progresses from the root (base) of the tree to the tips (ends of the branches).4
5
The following sequence of nucleotides is found in the single-stranded DNA template for RNA transcription: ___ATTGCCAGATCATCCCAATAGAT_____ Imagine the RNA polymerase moves right to left. What is the direction of the shown DNA template? 3' ATTGCCAGATCATCCCAATAGAT 5' You are told this is the template, so this is the strand that the RNA polymerase uses for transcription. An RNA polymerase begins transcribing at the 3' end of the template because the RNA molecule it is synthesizing grows 5' --> 3'. If the RNA polymerase moves right to left, the 3' end of the template must be on the right and the 5' end on the left.cannot be determined from this information5' ATTGCCAGATCATCCCAATAGAT 3'
5' ATTGCCAGATCATCCCAATAGAT 3'
DNA is often described as having a shape like a spiral staircase. Which of the spiral staircases in the photos is the better analogous representation of a DNA molecule? B A Double-stranded DNA has two backbones on the outside.
A
In the DNA sequence, the top strand is the template strand. 5'-GTAGCCGATAAT-3'3'-CATCGGCTATTA-5'If the base G (in red and bold) is changed to T, what would the resulting nucleotide be in the mRNA? TGA RNA polymerase can add nucleotides only in 5'-3' direction.UC
A
Which statements about scientific hypotheses are true? Select all that apply. A hypothesis can only be based on observations.A hypothesis has already been proven correct.A hypothesis can be proven false.A hypothesis can be tested.
A hypothesis can be proven false. A hypothesis can be tested.
How is a hypothesis different from a hunch? A hypothesis is typically based on observations, experiments, or previous knowledge. A hypothesis is not a wild guess or hunch; it is based on earlier observations, other experiments, or previous knowledge. A hypothesis may or may not be correct.A hypothesis is always correct, but a hunch may be correct or incorrect.It isn't; a hunch and a hypothesis are essentially the same.A hunch is often based on observations, experiments, or previous knowledge.A hunch is always correct, but a hypothesis may be correct or incorrect.
A hypothesis is typically based on observations, experiments, or previous knowledge.
Which statements are true of an inhibitor that binds the active site of an enzyme? Select all that apply. These inhibitors are a kind of allosteric regulator that decreases enzyme activity.Adding more substrate can reduce the effect of these inhibitors.These inhibitors increase the rate of enzyme activity.These inhibitors are structurally similar to the normal substrate of an enzyme.These inhibitors compete with the substrate for the active site of the enzyme.
Adding more substrate can reduce the effect of these inhibitors. These inhibitors are structurally similar to the normal substrate of an enzyme. These inhibitors compete with the substrate for the active site of the enzyme.
An example of potential energy is: A ball sitting at the top of the stairs. A ball sitting at the bottom of the stairs. A ball sitting in the middle of the stairs. All are correct
All are correct
Only 2.5 percent of the human genome actually codes for proteins. The other 97.5 percent includes: All of other answer options are correct.introns.repetitive DNA.templates for noncoding RNA.
All of other answer options are correct.
What do all cells require? An archive of information A membrane to separate the inside of the cell from the outside The ability to gather materials and harness energy from the environment. All of the above.
All of the above.
Questions that lead to further scientific inquiry are often inspired by: All of the answer options are correct. Observations, experiments, collaborations, discussions, and research papers can all lead to questions, so all of the answer options are correct.experiments.the scientific literature.collaborations and discussions with colleagues.observations.
All of the answer options are correct.
You are carrying out an experiment that involves growing bacteria in various petri dishes. Unfortunately, you forgot about one of the petri dishes. When you discover it two weeks later, there is mold (a type of fungus) growing in the dish along with the bacteria. You observe that the bacteria aren't growing in the area where the fungus is growing. What question might you ask based on this observation? Do some of the bacteria grow better in the presence of the fungus than other bacteria?Why are the bacteria not growing near the fungus?Does the fungus kill the bacteria?All of the answer options are correct. All of the questions naturally follow from the observation that bacteria are not growing in the vicinity of the fungus.Does the fungus secrete a substance that inhibits the growth of bacteria?
All of the answer options are correct.
Homologous chromosomes are a pair of chromosomes that: match in appearance.have the same genes in the same order.All of these choices are correct.match in size.
All of these choices are correct.
Models help you: see structures and processes that are hard to visualize.provide a visual representation of a hypothesis.make predictions.communicate ideas with others.All of these choices are correct. A model isolates or simplifies an essential feature of the real world. In this way, it allows scientists to understand, analyze, visualize, or even make predictions about some aspect of the world. You can think of a model as a hypothesis—a physical, virtual, static, or dynamic depiction of something in the real world. Models help scientists visualize structures, such as molecules and cells; processes, such as chemical reactions and signaling pathways; and the passage of time.
All of these choices are correct.
Which molecule is made during the process of transcription? mRNA All of these choices are correct .tRNA rRNA
All of these choices are correct.
Which of the answer choices are models? animationsimagesphysical structuresphylogenetic treesAll of these choices are correct. A model is a copy or representation of a concept, structure, process, or system. In biology models take many forms, including physical structures, phylogenetic trees, images, and animations.
All of these choices are correct.
Why does ADP have less potential energy than ATP? Because ATP has ribose as a sugar. Because ADP has only one phosphate group. Because ADP has only two phosphate groups. Because ATP has adenine in it.
Because ADP has only two phosphate groups.
Sometimes the sequence of DNA gets mutated and an adenine is paired to a cytosine. Why is this interaction unstable? Because the negatively charge phosphate groups of the two bases repel each other. Because an ionic bond cannot be formed between the two bases. Because the chemical groups that form hydrogen bonds are in the wrong positions relative to each other. Because the charges on the bases repel each other.
Because the chemical groups that form hydrogen bonds are in the wrong positions relative to each other.
Because of hydrogen bonding, water is uniquely suited for its central role in life. Many hydrophilic molecules interact freely with water, but a number of hydrophobic molecules are important for life, too. How does the interaction between water and hydrophobic molecules help to organize biological systems?
Because water molecules preferentially associate with each other, they force hydrophobic molecules to associate with each other and not with water molecules.
Because of hydrogen bonding, water is uniquely suited for its central role in life. Many hydrophilic molecules interact freely with water, but a number of hydrophobic molecules are important for life, too. How does the interaction between water and hydrophobic molecules help to organize biological systems? Because water molecules preferentially associate with each other, they force hydrophobic molecules to associate with each other and not with water molecules. Because cells are not pure water (they have many substances dissolved within them), the hydrophilic/hydrophobic effect has a limited role in biological organization. The ionic bonds between water molecules cause hydrophobic molecules to associate with each other and not with water molecules. All of the above can be true.
Because water molecules preferentially associate with each other, they force hydrophobic molecules to associate with each other and not with water molecules.
NOTE: You can click on the figures to make them bigger. Strokes are leading cause of death in the United States. Facts about strokes include: 6,400,000 people in the U.S. have experienced a stroke. 795,000 people in the U.S. experience a stroke each year. 134,000 people in the U.S. die from a stroke each year. From 1996-2006, the number of people who died from strokes per year increased by 18.4%. 70% of people who have a stroke also have high blood pressure. Controlling high blood pressure is one precautionary method that is taken in the prevention of strokes. An important set of drugs called ACE inhibitors are used to treat high blood pressure. These drugs affect angiotensin converting enzyme (ACE), which is made by the kidney and increases blood pressure. It catalyzes the conversion of angiotensin I to angiotensin II (Fig. 1a). Drugs that act as ACE inhibitors are commonly prescribed to treat high blood pressure (Fig. 1b). However, patient response to the drugs can vary greatly. ACE inhibitors are non-competitive enzyme inhibitors. Two different ACE inhibitor drugs exist, Drug A & Drug B. It is possible to measure the effect of the drugs on the ACE enzyme when the concentration of substrate varies (Fig. 2). In a set of experiments, the concentration of substrate (angiotensin I) was manipulated between 0 and 200 µM, and the reaction rate was measured with or without drugs present. The figure shows the rate of reaction on Y-axis and the substrate concentration on the X-axis. Clearly, treating with drugs change the rate of reaction. The substrate, Angiotensin I is present in differing amounts in different patients. The effect of particular drugs can be sensitive to substrate concentration. For example, Drug A increases(!) the rate of reaction when the patient has a high substrate concentration, and drug B reduces the rate under those conditions (Fig. 2). The problem is that some patients have low substrate concentrations, and the drug effects are different when that occurs. If a patient comes in with high blood pressure is to be prescribed a drug to reduce the rate of the ACE reaction, which drug should the patient be prescribed? Both drugs could either work or make the patient worse Both drugs could make the patient worse Both drugs could work Drug B
Both drugs could either work or make the patient worse
tudies of the origin of life on Earth help us to consider what would be required for life elsewhere in the universe. What is most likely to be true of extraterrestrial life if it exists? Carbon will act as the backbone for organic molecules. Our knowledge of chemistry as well as the possible composition of other planets in the universe gives us confidence in predicting a carbon basis for extraterrestrial life and the probable essentiality of water. Other aspects of what extraterrestrial life could require are less clear.Light from a nearby star will make photosynthesis possible.Oxygen will be used to convert energy in cells.Water will not be required to sustain life.
Carbon will act as the backbone for organic molecules.
Which of the following statements is representative of the second law of thermodynamics? Conversion of energy from one form to another is always accompanied by some gain of free energy.Every energy transformation by a cell decreases the entropy of the universe. Heat represents a form of energy that can be used by most organisms to do work.Cells require a constant input of energy to maintain their high level of organization.
Cells require a constant input of energy to maintain their high level of organization.
Which of the following transformations would yield products with less entropy than the starting material? Conversion of monosaccharides to starch The conversion of a polypeptide into amino acids The digestion of mRNA into nucleotides NaCl crystals dissolving in a glass of water
Conversion of monosaccharides to starch
T Q Shu-ichi Nakano reported in Science in February 2000 that "The RNA enzyme (ribozyme (this enzyme is an RNA molecule) from hepatitis delta virus catalyzes self-cleavage of a . . . [chemical] . . . bond." This reaction is inherently slow due to the formation of an unfavorable negative charge on the ribozyme. The author goes on to show that this self-cleavage is made faster by joining it with an acid-base reaction that neutralizes the negative charge. Nakano's model describes a positively charged cytosine base on the ribozyme acting as the acid, and magnesium hydroxide acting as the base. Specifically, the cytosine donates its proton (H+) to neutralize the unstable negative charge that would have formed on the ribozyme. Which of the following chemical bonds do you think Nakano is referring to in his quote? hydrogen van der Waal's Covalent ionic
Covalent
What is the difference between covalent bonds and ionic bonds? Covalent bonds involve the sharing of electrons between atoms; ionic bonds involve the electrical attraction between charged atomsCovalent bonds require carbon while ionic bonds do not.Covalent bonds involve the sharing of pairs of electrons between atoms; ionic bonds involve the sharing of single electrons between atoms.Covalent bonds involve the transfer of electrons between charged atoms; ionic bonds involve the sharing of electrons between atoms.
Covalent bonds involve the sharing of electrons between atoms; ionic bonds involve the electrical attraction between charged atoms
What is the difference between covalent bonds and ionic bonds? Covalent bonds require carbon while ionic bonds do not. Covalent bonds involve the sharing of electrons between atoms; ionic bonds involve the electrical attraction between charged atoms. Covalent bonds involve the sharing of pairs of electrons between atoms; ionic bonds involve the sharing of single electrons between atoms. Covalent bonds involve the transfer of electrons between charged atoms; ionic bonds involve the sharing of electrons between atoms.
Covalent bonds involve the sharing of electrons between atoms; ionic bonds involve the electrical attraction between charged atoms.
Which choice ranks the elements hydrogen, carbon, nitrogen, and oxygen in order of decreasing dry mass in human cells? C→N→H→O C→N →O →H O→C→H→NO→H→C→NC→O→N→H
C→O→N→H
What type of molecule does this model illustrate? lipidcarbohydrateproteinRNADNA This is a model of a DNA molecule. You can see the backbones, colored bases, and double-helical structure.
DNA
What is the order of processes that support the central dogma? DNA replication, transcription, translationDNA replication, translation, protein synthesistranscription, DNA replication, translationDNA replication, translation, transcription
DNA replication, transcription, translation
One difference between eukaryotic and prokaryotic DNA packaging is Prokaryotic cells have different nucleotides that are smaller than those in eukaryotic cells. Eukaryotic cells have fewer genes than prokaryotic cells. DNA wraps around histones in eukaryotic packaging. Prokaryotic cells have smaller chromosomes and fit into the cell unaltered.
DNA wraps around histones in eukaryotic packaging.
Darwin collected finches during the voyage of the Beagle (Figure 21.9). He shared the specimens with other scientists back in England after his travels. Which question could the scientists who were not on the journey with Darwin ask and answer just from observing the specimens Darwin brought home? What do these birds eat on the islands?How long have birds lived on the islands?Do the birds all have similar beak sizes? The only question that can be answered simply by observing the bird specimens is the question about beak sizes. All of the other questions require observing live birds in their natural habitat or involve examining fossil birds.How do these birds interact with each other?
Do the birds all have similar beak sizes?
If the patient is tested and has 10 µM angiotensin, with drug should the patient be prescribed? Drug BDrug ABoth drugs could make the patient worseBoth drugs could work
Drug A
What is the First Law of Thermodynamics? The disorder of the universe is always increasing. Energy is neither created nor destroyed. As temperature approaches absolute zero, the entropy of the system approaches a constant minimum.
Energy is neither created nor destroyed.
Which of the following is true about exergonic reactions? The products of exergonic reactions have more free energy than the reactants Energy is released from the reactants There is a positive ΔG
Energy is released from the reactants
Which of the following statements is a logical consequence of the second law of thermodynamics? Every energy transfer requires activation energy for the environment.Every chemical reaction must increase the total entropy of the universe.If there is an increase in the energy of a system, there must be a corresponding decrease in the energy of the rest of the universe.If the entropy of a system increases, there must be a corresponding decrease in the entropy of the universe.
Every chemical reaction must increase the total entropy of the universe.
Splicing removes introns from prokaryotic primary transcripts.
False
Insulin is specifically transcribed in the pancreas and in no other cells. The promoter/RNA polymerase + General Transcription Factors is responsible for this precise expression pattern.
False (Every gene in the genome requires a promoter and RNA polymerase + General transcription factors to be transcribed. Therefore there is nothing tissue specific about these components. To get a cell/tissue specific expression, genes have additional sequences called enhancers. Enhancers are gene specific. But remember, the genome and genes are identical in every cell too! In order for transcription to occur, tissue specific activator proteins must bind to a gene's enhancer. In the case of insulin gene transcription, ONLY the pancreas makes the activator proteins bind to the insulin gene enhancer. Therefore, the insulin gene is transcribed in the pancreas where it is produced. Since no other tissues need to produce the insulin gene mRNA, they lack the insulin activator proteins, and insulin is NOT transcribed.)
The entropy of the products of a chemical reaction is always greater than the entropy of the reactants.
False (Remember, in anabolic metabolism more complex and ordered molecules are made from simpler building blocks. So entropy is less in the products. This type of chemical reaction occurs because energy is added to the reaction.)
It takes less energy to dissociate a G-C base pair than an A-T base pair. True False: It takes more energy False: It takes the same amount of energy
False: It takes more energy (Remember G-C base pairing has 3 H bonds while A-T base pairs have only 2 H bonds. Therefore, it takes more energy to dissociate ("break") G-C pairs.)
n a famous experiment, Anders Möller studied the effect of tail length of male barn swallows on mating success. In one test group, he shortened the tails by clipping the tail feathers. In another test group, he lengthened the tails by adding feathers to the tails. He also included two control groups. In one control group, he did not manipulate the tail feathers. In another control group, he clipped the tail and then added the feathers back onto the tail, so they ended up the same length as the unclipped control tails. Why did he include this second control group? He needed a positive control group.The second control group was not necessary for interpreting the results of his experiment.He needed a test group.He wanted to control for the effect of manipulating the tail (clipping and adding feathers). The two control groups include birds with tails of normal length. In one group, he did not manipulate the tail at all; in the other, he clipped the feathers and pasted them back on. This second group controlled for the act of clipping and pasting tail feathers, which he did with the two test groups.
He wanted to control for the effect of manipulating the tail (clipping and adding feathers).
Which statement is true about the chromatin packaging in eukaryotes? Histones H2A and H3 are removed before chromosomes can undergo condensation.Genes can be transcribed during chromatin condensation because the major groove of the DNA molecule is always accessible to RNA polymerase complex.Histones are fast-evolving proteins, and therefore, histones from one species cannot bind and pack DNA from another species.Histone proteins are positively charged, which allows them to bind to and pack negatively charged DNA.
Histone proteins are positively charged, which allows them to bind to and pack negatively charged DNA.
Membranes are composed of phospholipid bilayers. In order to increase the stability of a membrane at high temperatures, how might you modify the phospholipids? Increase the amount of unsaturated fatty acids Increase the amount of saturated fatty acids Decrease the overall tail lengths of the fatty acids Increase the amount of unsaturated fats & decrease their tail length
Increase the amount of saturated fatty acids
In this figure, what is the role of the hormone ecdysone? It inhibits the molting process.It activates the molting process. The model illustrates the hormone ecdysone triggering (activating) molting.It is not involved in the molting process.
It activates the molting process.
Which statement describes a theory? It is based on the results of one well-controlled experiment.It is based on what the majority of people think is correct.It is based on a strong opinion from a well-educated person.It is based on clear and convincing results of a single experiment.It is based on many pieces of data collected by many scientists over a long period of time. A theory is a well-supported set of hypotheses with wide explanatory value that is supported by multiple lines of evidence over a long period of time.
It is based on many pieces of data collected by many scientists over a long period of time.
You have isolated a previously unstudied protein, identified its complete structure in detail, and determined that it catalyzes the breakdown of a large substrate. You notice it has two binding sites. One of these is large, apparently the bonding site for the large substrate; the other is small, possibly a binding site for a regulatory molecule. What do these findings tell you about the mechanism of this protein? It is probably an enzyme that works through competitive inhibition.It is probably a structural protein that is involved in cell-to-cell adhesion.It is probably a structural protein found in cartilage or skeletal tissue.It is probably an enzyme that works through allosteric regulation.
It is probably an enzyme that works through allosteric regulation.
You know this molecule is specifically a deoxyribonucleotide because It has a base attached to the 1' Carbon of the Sugar. It lacks a hydroxyl (-OH) group on the 2' Carbon. It has a hydroxyl (-OH) group on its 3' Carbon It has a triphosphate group attached to its 5' Carbon.
It lacks a hydroxyl (-OH) group on the 2' Carbon.
You have an aqueous solution with a pH of 8.0. You add sodium chloride to a concentration of 1 gram per 100 milliliters. What happens to the pH? It goes up.It depends on the temperature.It goes down.It stays the same.
It stays the same.
What is the key difference between test and negative control groups in an experiment? Negative control groups always have a positive reaction to manipulation.Negative control groups are larger than test groups.Test groups are larger and more diverse than control groupsNegative control groups are not exposed to manipulation.Test groups are not exposed to manipulation.
Negative control groups are not exposed to manipulation.
Many salmon return to the place where they were born to lay eggs. You hypothesize that they use visual cues to find their way back. To test your hypothesis, you observe blind salmon and determine whether or not they are able to return to their birthplace. You find that they are unable to find their way back. Does your experiment prove a theory about the role of vision in salmon navigation? No; your results lead you to reject your hypothesis about the role of vision in salmon navigation, so this isn't a theory.No; there were no controls in your experiment, so the theory about the role of vision in salmon cannot be proven by your results.No; your hypothesis was supported by your results, but a theory must be supported by many pieces of data collected by many scientists over a long period of time. The results support your hypothesis, but a theory requires multiple experiments and observations, and it also must be able to explain many different phenomena.Yes; your hypothesis was supported by your results, and that means the theory about the role of vision in salmon is proven.
No; your hypothesis was supported by your results, but a theory must be supported by many pieces of data collected by many scientists over a long period of time.
Which statements are true about observational studies? Select all that apply. Observational studies can be used to test hypotheses.Observational studies do not have hypotheses.Observational studies do not have controls.Observational studies consider variables of interest without manipulating them in such a way as to affect outcomes.Observational studies can be used to prove hypotheses.
Observational studies do not have controls. Observational studies consider variables of interest without manipulating them in such a way as to affect outcomes. Observational studies can be used to prove hypotheses.Observational studies can be used to test hypotheses.
Stanley Miller's 1953 experiments supported the hypothesis that _________ Definition: *abiotically means not associated or derived from living organisms The conditions on early Earth were conducive to the origin of lifeLife on Earth arose from simple organic molecules, with energy from lightning and volcanoesThe conditions on early Earth were conducive to the abiotic* synthesis of organic moleculesOrganic molecules can be synthesized abiotically* under conditions that may have existed on early Earth. Using the best knowledge in 1953, Miller attempted to mimic the hypothesized conditions of early earth. With these conditions, organic molecules were synthesized.
Organic molecules can be synthesized abiotically* under conditions that may have existed on early Earth.
Which of these elements would MOST likely have bonding properties similar to Nitrogen (N)? Refer to the Periodic Table Carbon (C) Silicon (Si) Phosphorus (P) Oxygen (O) Sulfur (S)
Phosphorus (P)
Which one of the following elements is likely to form exactly three non-ionic interactions with hydrogen? Oxygen (O) Phosphorus (P) Sulfur (S) chlorine (Cl)
Phosphorus (P)
H2O Molecular Structure: Water is considered a good solvent What types of molecules do you think will dissolve most easily in water? Polar Molecules Nonpolar molecules Both Equally well No answer text provided.
Polar Molecules
What is the sign of the Change in Gibbs Free Energy (ΔG) for this reaction? Positive Negative Zero
Positive
What is the name of the enzyme complex that forms at the start of transcription? DNA gyraseRNA helicaseRNA polymeraseDNA polymerase
RNA polymerase
Carbon-12 is the most common isotope of carbon and has a mass number of 12. However, the average atomic mass of carbon found on a periodic table is slightly more than 12 daltons (1 dalton ~ mass of 1 H atom). Why? The atomic mass does not include the mass of electrons. Some carbon atoms in nature have more neutrons. Some carbon atoms in nature have an extra proton. Some carbon atoms in nature have a different valence electron distribution.
Some carbon atoms in nature have more neutrons.
Carbon-12 is the most common isotope of carbon and has a mass number of 12. However, the average atomic mass of carbon found on a periodic table is slightly more than 12 daltons (1 dalton ~ mass of 1 H atom). Why? Some carbon atoms in nature have a different valence electron distribution.The atomic mass does not include the mass of electrons.Some carbon atoms in nature have an extra proton.Some carbon atoms in nature have more neutrons.
Some carbon atoms in nature have more neutrons.
You perform the following experiment to test a compound's effect on an enzymatic reaction. In a test tube you mix an enzyme and its substrate, and the compound and monitor the rate of reaction at different substrate concentrates. The compound reduces the rate of reaction and high substrate levels do not overcome its effect. What does this suggest about the compound? The compound is a non-competitive activator. The compound is a non-competitive inhibitor. The compound is an inhibitor that binds the active site. The compound acts as a catalyst
The compound is a non-competitive inhibitor.
A biologist working in a lab adds a compound to a solution that contains an enzyme and substrate. This particular compound binds reversibly to the enzyme at the active site. Once the compound is bound to the enzyme, the catalysis of substrate to product stops. Which of the statements is true of the compound? The effect of the compound cannot be overcome by adding more substrate.The effect of the compound can be overcome by adding more substrate. Because this inhibitor binds reversibly to the active site, adding more substrate allows the substrate to better compete for binding.The compound is a catalyst for the reaction.The compound is an allosteric inhibitor.The compound is an allosteric activator.
The effect of the compound can be overcome by adding more substrate.
Which of the statements represent the laws of thermodynamics? Select all that apply. The amount of energy in the universe is constant.All cells arise from pre-existing cells.Matter cycles in the biosphere, but energy flows.Enzymes lower the activation energy requirement of reactions.The energy available to do work decreases as energy is transformed from one form to another.
The energy available to do work decreases as energy is transformed from one form to another. The amount of energy in the universe is constant.
Which of the statements are true? Select all that apply. The entropy of the products of a reaction is always greater than the entropy at the start of the reaction. The energy for a reaction equals the sum of the energy in the product plus energy released as heat and disorder. The entropy at the start of a reaction is always greater than the entropy of the products. The amount of usable energy resulting from a reaction is always less than the total energy available at the start of the reaction.
The energy for a reaction equals the sum of the energy in the product plus energy released as heat and disorder. The amount of usable energy resulting from a reaction is always less than the total energy available at the start of the reaction. Score: 1 of 1
In the Gibbs free-energy relationship, why is the T term necessary? The free-energy change caused by a change in entropy is a function of temperature.The free-energy change caused by a change in potential energy is a function of temperature.The free-energy change caused by a change in electrical charge is a function of temperature.
The free-energy change caused by a change in entropy is a function of temperature.
Duchenne muscular dystrophy is caused by a mutation in a gene that whose transcribed region is 2.5 million base pairs long. However, fewer than 2500 nucleotides specify the amino acids translated into the dystrophin protein. Consider what you know about gene structure, transcription, and RNA processing in eukaryotic cells, provide a possible explanation for the large size of the dystrophin gene. The gene has a large number of introns that were removed by splicingThe primary transcript was not poly-adenylated, and the mRNA degrades.The primary transcript was not capped, and the mRNA degrades.Only 2500 nucleotides of the gene was transcribed.
The gene has a large number of introns that were removed by splicing
You hypothesize that a new chemical compound will be effective in treating Ebola, a disease for which there is no known treatment beyond palliative care (treatment that relieves symptoms but does not deal with the cause of a condition). A null hypothesis is: The new chemical compound will be less effective than palliative care.The new chemical compound will be useful to treat Ebola.The new chemical compound will be only as effective as palliative care. The null hypothesis suggests that a treatment or intervention will have no effect, so in this case, the null hypothesis is that the new chemical will not be more effective than palliative care.The new chemical compound will be more effective than palliative care.The chemical structure of the new compound will inactivate the Ebola virus by binding.
The new chemical compound will be only as effective as palliative care.
The genome of a newly identified organism is discovered and genome sequencing shows it is a single continuous strand of DNA with no beginning or end. Which is more likely? The organism is a bacterium. The organism is a eukaryote Each option is equally possible.
The organism is a bacterium. (A circle has neither a beginning nor an end because it is one continuous structure. Bacteria have circular chromosomes while eukaryotes have linear chromosomes.)
For living organisms, which of the following is an important consequence of the first law of thermodynamics? Organisms grow by converting energy into organic matter. The energy content of an organism is constant.The organism ultimately must obtain all of the necessary energy for life from its environment.The entropy of an organism decreases with time as the organism grows in complexity.
The organism ultimately must obtain all of the necessary energy for life from its environment.
Which of the following always tends to make chemical reactions spontaneous? The temperature is low.The reactants have lower potential energy than the products.The reactants are more ordered than the products.The pressure is low.
The reactants are more ordered than the products.
Which of the following statements is true about enzyme-catalyzed reactions? The free energy change of the reaction is opposite from the reaction that occurs in the absence of the enzyme.An enzyme catalyzes a reaction by raising the activation energy.Enzyme-catalyzed reactions release more free energy than noncatalyzed reactions.The reaction is faster than the same reaction in the absence of the enzyme.Enzyme-catalyzed reactions require energy to activate the enzyme.
The reaction is faster than the same reaction in the absence of the enzyme.
Which of the following is true for all exergonic reactions? The products have more total energy than the reactants.The reaction goes only in a forward direction: all reactants will be converted to products, but no products will be converted to reactants.A net input of energy from the surroundings is required for the reactions to proceed.The reaction proceeds with a net release of free energy.The reactions are rapid.
The reaction proceeds with a net release of free energy.
In this figure, why is the Calvin cycle represented by three gray arrows? The three arrows represent transcription and translation.The three arrows don't carry any meaning.The three arrows represent cell signaling.The three arrows represent the steps of the cycle. In many models, arrows represent steps in the process.The three arrows represent inputs and outputs.
The three arrows represent the steps of the cycle.
Which are appropriate reasons to undertake an observational study? Select all that apply. There are ethical issues with manipulating a variable.The variable in the study cannot be manipulated.The subject of the study is an opinion.The sample number is very low.
There are ethical issues with manipulating a variable. The variable in the study cannot be manipulated.
Why aren't nucleosides incorporated into DNA? The bases are not fully assembled. The sugar is not in the correct form There are no phosphates to make the phosphodiester bonds. The peptide bonds don't form. BUT they are incorporated into DNA!
There are no phosphates to make the phosphodiester bonds.
A population of snakes includes solid-colored snakes and banded (striped) snakes. On the mainland, the snakes are mostly solid. On a nearby island, the snakes are mostly banded. You hypothesize that the reason for this observation is that the environments on the mainland and island are different, and banded snakes are favored in the island environment. Which of the answer choices are possible alternative hypotheses to explain why the snakes on the island are mostly banded? Select all that apply. There is a predator on the island that preferentially preys on solid snakes.The island was colonized by just a few snakes from the mainland, and those snakes were banded.All of the answer options are correct.The environments on the mainland and island are different, and banded snakes are favored on the mainland.
There is a predator on the island that preferentially preys on solid snakes. The island was colonized by just a few snakes from the mainland, and those snakes were banded
In order to test the effects of a new drug, you isolate the messenger RNA molecules from both treated and untreated eukaryotic cells and separate them according to size, using gel electrophoresis. In each lane of the gel, the shorter RNA molecules migrate more quickly through the gel and end up near the bottom of the gel, whereas the longer RNAs migrate more slowly and remain near the top.The samples that were loaded into each of the four lanes are: Lane 1: the primary RNA transcripts isolated from the nucleus of untreated cellsLane 2: the primary RNA transcripts isolated from the nucleus of cells treated with the drug being testedLane 3: RNA isolated from the cytosol of untreated cellsLane 4: RNA isolated from the cytosol of cells treated with the drug being tested Which conclusion is most likely to be correct? These results suggest that the drug digests DNA.These results suggest that the drug inhibits post-translational processing of this gene.These results suggest that the drug affects RNA processing. The only difference observed in this experiment is between RNA isolated from cytosol of treated and untreated cells. The primary transcript is transported from nucleus to cytosol after being processed. Therefore, the drug must affect RNA processing.These results suggest that the drug contains a protease that targets this gene product.These results suggest that the drug inhibits DNA replication.
These results suggest that the drug affects RNA processing.
Transcription and translation differ in prokaryotes versus eukaryotes in which of these ways? Prokaryotic ribosomes are located inside their nuclei, and eukaryotic ribosomes are located in the cytoplasm.None of these choices are correct.Translation of prokaryotic mRNA can occur as the mRNA is being transcribed, which is not possible in eukaryotes.Transcription of mRNA requires RNA polymerase in eukaryotes, but RNA polymerase is not required in prokaryotes.
Translation of prokaryotic mRNA can occur as the mRNA is being transcribed, which is not possible in eukaryotes.
Every time you have a cold, you drink orange juice and feel better within a day. This leads you to formulate the hypothesis that the vitamin C in orange juice reduces the duration and severity of the symptoms of the common cold. What is your null hypothesis? Vitamin C increases the duration and severity of the symptoms of the common cold.All of the answer options are correct.Consuming juice has no effect on the duration and severity of the symptoms of the common cold.Vitamin C has no effect on the duration and severity of the symptoms of the common cold. The null hypothesis suggests that a treatment or intervention will have no effect, so in this case, the null hypothesis is that vitamin C has no effect on the duration and severity of the symptoms of the common cold.Consuming juice of any kind decreases the duration and severity of the symptoms of the common cold.
Vitamin C has no effect on the duration and severity of the symptoms of the common cold.
Electrons have Energy ("electron volts")Using the diagram where the green circle is the nucleus and the red electrons are close to the nucleus while the yellow electrons are further from the nucleus, which electrons do you predict to be least stable and which electrons do you predict to have more energy? Yellow electrons are least stable but red have more energy. Yellow electrons are least stable & have more energy Red electrons are least stable & have more energy Red electrons are least stable but yellow have more energy
Yellow electrons are least stable & have more energy
Is the experiment described in the figure an observational study? No, because it has a control group, and observational studies are not controlled.Yes, because it involves observing, measuring, and collecting data. This study is observational because it involves collecting and measuring samples.No, because researchers manipulated variables in the study, and observational studies do not involve changing variables.No, because it tests a hypothesis, and observational studies cannot be used to test hypotheses.
Yes, because it involves observing, measuring, and collecting data.
Is the experiment described in the figure an observational study? No, it is not an observational study.Yes, it is an observational study. In this study, variables aren't manipulated in any way, so it's an observational study.It is both an observational study and a controlled experiment.There is not enough information provided in the figure to answer this question.
Yes, it is an observational study.
If introns are NOT removed, would it have an effect on the encoded polypeptide?
Yes.
Driving from Maine to Florida, you observe that squirrels living in the southeastern United States are much thinner than squirrels living in the northeastern part of the country. You tell your friend that you have a theory that squirrels living in the northeast have greater fat reserves for the winter months when food is scarce. Which of the statements are true? Select all that apply. Your statement is a hypothesis rather than a scientific theory.Your statement is a valid scientific theory.Your statement is not a theory but a fact.Your statement uses the word "theory" in a non-scientific, colloquial way.
Your statement is a hypothesis rather than a scientific theory. Your statement uses the word "theory" in a non-scientific, colloquial way. Score: 0 of 1
T Q Shu-ichi Nakano reported in Science in February 2000 that "The RNA enzyme (ribozyme (this enzyme is an RNA molecule) from hepatitis delta virus catalyzes self-cleavage* of a . . . [chemical] . . . bond." This reaction is inherently slow due to the formation of an unfavorable negative charge on the ribozyme. The author goes on to show that this self-cleavage is made faster by joining it with an acid-base reaction that neutralizes the negative charge. Nakano's model describes a positively charged cytosine base on the ribozyme acting as the acid, and magnesium hydroxide acting as the base. *self-cleavage means to break the bond Which of the following chemical bond do you think Nakano is referring to in his quote? a covalentan ionic The passage states: "The RNA enzyme (ribozyme (this enzyme is an RNA molecule) from hepatitis delta virus catalyzes self-cleavage of a . . . [chemical] . . . bond." In biological systems, COVALENT bonds require enzymes to break them.a van der waal'sa hydrogen
a covalent
One of the buffers that contribute to pH stability in human blood is carbonic acid (H2CO3). Carbonic acid is a weak acid that, when placed in an aqueous solution, dissociates into a bicarbonate ion (HCO3-) and a hydrogen ion (H+), as noted below. If the pH of blood increases, one would expect an increase in the concentration of H2CO3 and a decrease in the concentration of HCO3- a decrease in the concentration of HCO3- and an increase in the concentration of H+ a decrease in the concentration of H2CO3 and an increase in the concentration of HCO3- an increase in the concentration of HCO3- and a decrease in the concentration of H+
a decrease in the concentration of H2CO3 and an increase in the concentration of HCO3-
One of the buffers that contribute to pH stability in human blood is carbonic acid (H2CO3). Carbonic acid is a weak acid that, when placed in an aqueous solution, dissociates into a bicarbonate ion (HCO3-) and a hydrogen ion (H+), as noted below. The reaction can go either direction. The direction of the reaction is determined by the pH of the blood. H2CO3 HCO3- + H+ If the pH of blood increases, one would expect _____. an increase in the concentration of H2CO3 and a decrease in the concentration of HCO3-an increase in the concentration of HCO3- and a decrease in the concentration of H+a decrease in the concentration of H2CO3 and an increase in the concentration of HCO3- Remember, all chemical reactions are balanced. When blood pH increases, it means that the [H+] concentration has decreased. The blood must increase the concentration of [H+] to compensate for the increase in pH. Looking at the buffering equation, if the direction of the reaction is from left to right, then more H+ is produced. At the same time, HC03- must also increase while H2CO3 decreases.a decrease in the concentration of HCO3- and an increase in the concentration of H+
a decrease in the concentration of H2CO3 and an increase in the concentration of HCO3- Remember, all chemical reactions are balanced. When blood pH increases, it means that the [H+] concentration has decreased. The blood must increase the concentration of [H+] to compensate for the increase in pH. Looking at the buffering equation, if the direction of the reaction is from left to right, then more H+ is produced. At the same time, HC03- must also increase while H2CO3 decreases.
What type of model is shown here? a drawing This model is a drawing of the steps in cell signaling. Each step is illustrated with symbols and structures, and they are shown in sequence.an animationa physical structurea simulationa phylogenetic tree
a drawing
What does a phylogenetic tree represent? what actually occurred over timea hypothesis about what occurred over time Phylogenetic trees are models that serve as hypotheses about evolutionary relationships.a chemical reactiona signal transduction cascadean unfounded guess about what occurred over time
a hypothesis about what occurred over time
Which of the following lack a genome? nucleus chloroplast mitochondrion virus particle all of these have a genome.
all of these have a genome.
Certain meteorites have been examined and found to carry samples of which molecules? Select all that apply. nucleotides polypeptides lipids amino acids monosaccharides
amino acids nucleotides
Of the choices, which can be a product of a catabolic reaction? a lipid like cholesterola nucleic acid like RNAa motor protein like myosinan amino acid like tryptophan An amino acid would be the product of protein degradation by protease enzymes in a catabolic reaction.a complex carbohydrate like cellulose
an amino acid like tryptophan
Select all that apply. The two strands in a DNA molecule are: anti-parallel complementary identical covalently bonded to each other.
anti-parallel complementary (Remember, the two strands bond to each other through H bonds! Within a single strand, the nucleotides are linked to each other by covalent phosphodiester bonds.)
The reactions in the pathways of glycolysis and the citric acid cycle breakdown glucose into smaller molecules. Therefore, these pathways: are catabolic pathways are anabolic pathways take place in animal cells but not in plant cells take place in plant cells but not animal cells
are catabolic pathways
Order the models of the protein actin from most zoomed in to most zoomed out.A. B. C. D. b, d, c, a a, c, d, b d, c, b, a b, d, a, c a, b, c, d
b, d, a, c
The coding sequence for gene F is begins on left the figure above. The coding sequence for gene G begins on the right. The _____ strand serves as the template strand for gene F and the _______ strand serves as the template strand for gene G. top, toptop, bottombottom, bottombottom, top Remember, the coding strand is the same as the non-template strand. It also has the same direction as the RNA. For RNA and coding sequences, the first nucleotide is the 5' nucleotide. If for gene F the coding sequence begins on the left, it means the 5' nucleotide of the coding strand is on the left, and this is the same as the RNA. Therefore, the RNA polymerase must move down the antiparallel template strand 3'-->5' from left to right. Therefore, the bottom strand is the template. Using the same logic but the opposite orientation, the upper strand for Gene G must be the template strand.
bottom, top
Glycolysis is a series of chemical reactions that produces ATP and pyruvate. In this figure from the Respiration Box-and-Arrow Activity, which labeled arrow represents ATP? e a d b c
c
Imagine a eukaryotic protein coding gene that has a single intron. Imagine for this gene the RNA polymerase moves from left to right. List the following gene elements in order from left to right. Hint: it may be easiest to first draw an example of a gene and determine the location of each element.List the element order by letter.a. 3' UTR (untranslated region)b. Splice Donor Sitec. promoterd. poly-adenylation sitee. 5' UTRf. Splice Branch Siteg. Splice Acceptor Site c e b f g a d c a b g g e d e c b f g a d d a g g b e c
c e b f g a d
Human mitochondrial DNA does not have telomeres because it is: not in the nucleus.too small to need a telomere.circular.replicated without an RNA primer.
circular.
HIV is the virus that causes AIDS. In the mid-1990's, researchers discovered an enzyme in HIV called protease. Protease activity is absolutely required for the HIV virus to infect more cells. Once the enzyme's structure was known, researchers began looking for drugs that would fit into the active site and block it. If this strategy for stopping HIV infections were successful, it would be an example of what phenomenon? vaccinationnon-competitive inhibitordenaturationcompetitive inhibitor
competitive inhibitor
Which drawing best depicts the electron configuration of an element with chemical properties most similar to helium (2He)? d. a. b. c.
d.
Which drawing in the figure above depicts the electron configuration of an element with chemical properties most similar to helium (2He)? a. b. c. d.
d.
In the hierarchical packaging of eukaryotic DNA, the 30-nm fiber is formed from: None of the other answer options is correct.the coiled chromatin fiber.double-stranded DNA.the metaphase chromosome.double-stranded DNA packaged with nucleosomes.
double-stranded DNA packaged with nucleosomes.
Life on earth is carbon based. Carbon is a(n) ion element molecule isotope
element
In the context of scientific inquiry, the words "theory" and "hypothesis" can be used interchangeably. truefalse A hypothesis is a tentative answer to a question or a proposed explanation of an observation. A theory is a well-supported set of hypotheses with wide explanatory value that is supported by multiple lines of evidence over a long period of time. It provides a broad and well-substantiated explanation of diverse phenomena. A theory is different from a hypothesis, and the two terms cannot be used interchangeably.
false
The marbled lungfish has a genome size almost 50 times larger than that of the human genome. The most likely explanation is that the lungfish: genome has a lot more genes.has much bigger cells and therefore needs more DNA.genome is most likely polyploid.genome contains a lot of repetitive DNA.
genome contains a lot of repetitive DNA.
You are studying transcription in fruit flies. In order to study transcription initiation, you have isolated different mutant lines of flies that destroy the activity of different parts required for transcription initiation.In fly line 1, you have mutated TFIIB of the general transcription factors. In line 2, you have mutated the promoter for the red eye color pigment gene. You predict the mutation in line one will ____________ on fly viability than the mutation in line 2. have a less severe effect have the same effect have a more severe effect Cannot predict based on this information alone
have a less severe effect (Fly line 2 disrupts the promoter for a single gene. Therefore that gene and only that gene will not be transcribed. On the other hand, Fly line 1 disrupts a general transcription factor required by ALL genes for transcription. Therefore, no RNA of any kind will be made in these flies. Therefore, it is likely fly line 1 will have a more severe effect.)
In a cell, entropy is often increased by: heat order potential energy kinetic energy
heat
Which bonds rely on the attraction of positive and negative charges? Select all that apply. ionic bondscovalent bondshydrogen bonds
hydrogen bonds ionic bonds
A young girl is staring at the raindrops running down her window. She notices that the raindrops remain more or less intact, even as they cascade down the windowpane. This is a result of: covalent bonds between water molecules. oxygen bonds between water molecules. ionic bonds between water molecules. hydrogen bonds between water molecules.
hydrogen bonds between water molecules.
Consider the HIV enzyme called protease. The amino acid residues at the active site are highly hydrophobic. In designing a drug that would bind to the active site and jam it, researchers should use a molecule that is _____. hydrophobicacidicchargedpolar
hydrophobic
In a metabolic pathway, a series of enzymatic reactions catalyzes the conversion of molecule A to molecule E. Several intermediate steps are involved in which the product of one reaction becomes the substrate for the next. The graph illustrates the changes of free energy that occur at each step in the pathway.Overall, this _____, based on the changes in free energy that take place as A is converted to E. pathway has four exergonic reactionsis a catabolic pathwayis an anabolic pathway Anabolic reactions require input of energy. With the exception of C to D, each of the reactions required an input of energy.pathway has four endergonic reactions
is an anabolic pathway
In this figure from the Respiration Box-and-Arrow Activity, what do the boxes represent? signaling pathwaystranscription and translationmetabolic processes There is a key associated with the model that defines the symbols. A key translates symbols and/or colors into words to clearly indicate what a model represents. In this model, the boxes represent metabolic processes.inputs and outputsATP and NADH
metabolic processes
Is this timeline drawn to scale (that is, are equal amounts of time represented by equal amounts of space on the page)? no The timeline is not drawn to scale. For example, consider the time from the bottom of the timeline to the Cambrian Period. That is almost 90% of the time (approximately 4 billion or 4000 million years out of a total of 4.6 billion or 4600 million years). However, the section that represents this amount of time only takes up about 25% of the length of the timeline.You cannot determine the answer from these models.yes
no
What does one row in a human pedigree represent? ten generationsone generation In a pedigree, time runs vertically down the page. Each horizontal row of individuals represents one generation.one yearfive years
one generation
Refer to a periodic table. Which one of the following elements is likely to form exactly three non-ionic interactions with hydrogen? chlorine phosphorous sulfur oxygen
phosphorous
Based on your knowledge of the polarity of water molecules, the solute molecule (a solute is a substance dissolve in a solvent) depicted here is most likely _____. positively charged negatively charged without charge hydrophobic
positively charged
Based on your knowledge of the polarity of water molecules, the solute molecule (a solute is a substance dissolve in a solvent) depicted here is most likely _____. The large structures are H2O. negatively charged hydrophobic positively charged without charge
positively charged
What type of molecule does this model illustrate? DNA protein Proteins are made up of amino acids. RNA lipid
protein
Which RNA type is the most abundant in mammalian cells? snRNA tRNA mRNA rRNA miRNA
r
Gregor Mendel's experiments are among the most important in all of biology. Mendel studied traits in pea plants and made observations about the traits over successive generations. Review Figure 15.5 The first-generation hybrid (F1). What trait was Mendel observing? seed color Although Mendel studied many different traits of pea plants, Figure 15.5 specifically focuses on his study of seed color.seed sizeplant fertilitynumber of seeds
seed color
Refer to the periodic table. Using the periodic table provided, select the element that would be found in least abundance in a living cell. phosphorus (P)silicon (Si)hydrogen (H)zinc (Zn)sodium (Na)
silicon (Si)
Reactions in which there is a negative change in free energy (-ΔG) are: spontaneous and endergonic.nonspontaneous and endergonic.spontaneous and exergonic.nonspontaneous and exergonic.
spontaneous and exergonic.
A solution of a complex starch at room temperature does not readily break down in a catabolic reaction to form a solution of simple sugars because _________ the activation energy barrier for this reaction cannot easily be surmounted at room temperature.starch cannot be hydrolyzed the presence of so much water.the hydrolysis of starch to sugar is endergonic.the starch solution has less free energy than the sugar solution.
the activation energy barrier for this reaction cannot easily be surmounted at room temperature.
According to the induced fit hypothesis of enzyme catalysis, _____. the binding of the substrate depends on the shape of the active sitesome enzymes change their structure when activators bind to the enzymethe active site creates a microenvironment ideal for the reactionthe binding of the substrate changes the shape of the enzyme's active sitea competitive inhibitor can outcompete the substrate for the active site
the binding of the substrate changes the shape of the enzyme's active site
Refer to the image. Where does the energy come from to add a uracil to the 3' end of a transcript? the hydrolysis of a terminal phosphate from the incoming UTP moleculethe energy released by allowing the uracil to complementary base pair with an adjacent thyminethe cell's supply of ATPthe hydrolysis of pyrophosphate from the incoming UTP moleculethe hydrolysis of two phosphate groups from the incoming UTP molecule
the hydrolysis of two phosphate groups from the incoming UTP molecule
In a famous experiment, Anders Möller studied the effect of tail length of male barn swallows on mating success. In one test group, he shortened the tails by clipping the tail feathers. In another test group, he lengthened the tails by adding feathers to the tails. He also included two control groups. In one control group, he did not manipulate the tail feathers. In another control group, he clipped the tail and then added the feathers back onto the tail, so they ended up the same length as the unclipped control tails. What is the dependent variable in this experiment? the mating success of the female barn swallows, which can be measured by number of eggs, clutches, or offspringthe mating success of the male barn swallows, which can be measured by number of eggs, clutches, or offspring The dependent variable is what the researcher observes or measures, and it is expected to vary based on the independent variable. In this case, the dependent variable is the mating success of male barn swallows, which the researcher hypothesized might vary based on tail length (the independent variable).This experiment does not include a dependent variable.the tail length of female barn swallowsthe tail length of male barn swallows
the mating success of the male barn swallows, which can be measured by number of eggs, clutches, or offspring
Genes within the same DNA double helix can be transcribed in opposite directions. The direction is determined by the direction transcribed by the gene to its left. an alternating pattern, so that gene 1 transcribes upper strand, gene 2 transcribes the lower strand etc. the position of the promoter for each gene. the enhancers for each gene.
the position of the promoter for each gene.
What aspect of DNA does this model illustrate well? the base-pairing rulesthe size and shape of the major and minor grooves The outside contours of the twisted strands of the DNA double helix form an uneven pair of grooves, called the major groove and the minor groove.the hydrogen bonds between the basesthe antiparallel nature of the two DNA strandsthe components of the nucleotides
the size and shape of the major and minor grooves
In a famous experiment, Anders Möller studied the effect of tail length of male barn swallows on mating success. In one test group, he shortened the tails by clipping the tail feathers. In another test group, he lengthened the tails by adding feathers to the tails. He also included two control groups. In one control group, he did not manipulate the tail feathers. In another control group, he clipped the tail and then added the feathers back onto the tail, so they ended up the same length as the unclipped control tails. What is the independent variable in this experiment? the tail length of female barn swallowsthe tail length of male barn swallows The independent variable is the factor that is manipulated or changed by the researcher. In this case, the independent variable is the tail length of male barn swallows because the researcher made the tail longer, made the tail shorter, and kept it the same length in different groups of males.the mating success of the female barn swallows, which can be measured by number of eggs, clutches, or offspringThis experiment does not include an independent variable.the mating success of the male barn swallows, which can be measured by number of eggs, clutches, or offspring
the tail length of male barn swallows
In the laboratory, it is difficult to manipulate or visualize a sample containing just one or two copies of a DNA molecule. Instead, researchers typically work with many identical copies of the DNA molecule they are interested in studying. A common method for making copies of a piece of DNA is the polymerase chain reaction (PCR), which allows a targeted region of a DNA molecule to be replicated (or amplified) into as many copies as desired. The procedure takes place in a small plastic tube containing a solution that includes four essential components.A researcher is interested in amplifying an unknown segment of DNA using PCR. In one tube, she places a known sample of DNA along with the other PCR components; in a second tube, she includes PCR components but not DNA; and in a third tube she places her unknown sample of DNA with the other PCR components. Which is the test group? the tube without DNA but with the other PCR componentsNone of the answer options is correct.the tube with the unknown sample of DNA and the other PCR components The test group is the sample with the unknown sample of DNA, as this is the group in which the researcher doesn't know what the result will be. The tube without DNA is the negative control, and the tube with known DNA is the positive control.the tube with the known sample of DNA and the other PCR components
the tube with the unknown sample of DNA and the other PCR components
An explanation supported by a large body of observations and experimentation is a: hypothesis.null hypothesis.theory. A prediction is a statement that indicates what result you expect to see from a study. A hypothesis is a tentative answer to a question or a proposed explanation of an observation. In contrast, a theory is a well-supported set of hypotheses with wide explanatory value that is supported by multiple lines of evidence over a long period of time. It provides a broad and well-substantiated explanation of diverse phenomena.prediction.
theory
Which choice is a pyrimidine found in DNA? adenine uracil thymine guanine None of the other answer options are correct.
thymine
Enthalpy (H) is the __________ cell's energy equilibrium.system's entropy.total kinetic energy of a system.total energy in a system
total energy in a system.
The central dogma illustrates the flow of information from DNA to RNA by transcription and RNA to protein by translation. In this figure of the central dogma, which step is represented by the process arrow between the top and middle images? transcription The central dogma illustrates the flow of information from DNA to RNA by transcription. Labels indicate that the top molecule in this model is DNA and the middle molecule is RNA, so the process between them must be transcription.glycolysistranslationtranscription and translationsignal transduction
transcription
Samples of three different triacylglycerol types were tested to determine the melting point of each one. The results of the tests are shown in the graph.The length of the fatty acids A, B, and C is the same. Which of the three triacylglycerols is likely to have the most double bonds in the fatty acids? Type 3 Type 1 Type 2There is no way of knowing which of the three triacylglycerols would likely have the most double bonds based on the information available.
type 1
As part of their normal function, many proteins bind to DNA briefly and then release it again. Which types of interactions might be involved in these transient protein-DNA interactions? Select all that apply. covalent bondsvan der Waals forcesionic bondshydrogen bonds
van der Waals forcesionic bondshydrogen bonds
Models are based on data. If you collect more information and find it fits the model perfectly, then: you modify the model.you reject the model.you have more confidence in the model. As is the case with all hypotheses, as more information is collected that supports a given model, confidence in the model grows.
you have more confidence in the model.
What does the blue curved arrow represent in the figure? export from the nucleusrotate 180 degreesrotate 90 degreeszoom in The arrow indicates that the inset is a zoomed-in view of RNA polymerase.zoom out
zoom in
