BioChem for the Final 3
RH antigen
- If present >> + - If absent >> -
Which sequence is palindromic?
GGATCC CCTAGG
Fourth-order reactions
None of the above
This diagram refers to a (an)
Random bisubstrate reaction
All D and L aldohexoses ar?
diastereomers
Thermal denaturation
(melting) The reversible thermal denaturation and annealing form the basis for the polymerase chain reaction. • DNA denaturation is commonly monitored by UV spectrophotometry at 260 nm. *two strands reanneal when the temp is lowered*
Chartgraff's rules for DNA state that:
) A=T and G=C
What does Delta (G) equal at EQUILIBRIUM?
*It equals (0) at EQUILIBRIUM.
A blood
- red blood cells have A antigens - produces anti-B-antibodies
AB blood
- red blood cells have A antigens - red blood cells have B antigens - produces NO anti-A or B antibodies - universal recipient
O blood
- red blood cells have NO antigens - produces anti-A-antibodies - produces anti-B-antibodies - universal donor
What group is attached to the pyrimidine ring in thymine and is not present in uracil?
-CH3
In your own words, describe what Delta (G) Prime?
-Free energy in which all reactants are at a standard concentration; which has been set at 1 mole/liter.
List three different major components of eukaryotic membranes
1. Plasma membrane 2. cytoplasm 3. smooth and rough endoplasmic reticulum
Which choice CORRECTLY lists the molecular masses from smallest to largest?
1.8 mDa < 15,000 Da < 15,100 amu < 18 kDa < 1.8 MDa
General features of the Watson-Crick Model of B-DNA
1.DNA molecules consist of two chains of opposite directionality—one strand runs in the 5' to 3' direction and the other in the 3' to 5' direction- intertwined to form a right-hand double helix. 2.The sugar-phosphate backbones are on the outside of the helix, whereas the bases are inside the helix. 3.The bases are perpendicular to the axis of the helix with adjacent bases separated by 3.4 Å. 4.The helix is approximately 20 Å wide. *predominate in a double stranded DNA* *B form*
How many antigen-binding sites are present on an IgM molecule? 2 4 10 16 25
10
What are the common fold of transmembrane region of integral proteins?
10 fold
A 0.6M solution of a weak acid had a pH of 5.8. What is the pKa of the solution?
11.3
IgG is the most common immunoglobulin in the circulatory system and in the extravascular fluid. It is composed of two light chains and two heavy chains. What is the approximate molecular mass of an IgG molecule? 23 kDa 75 kDa 150 kDa 360 kDa 950 kDa
150 kDa
Glucose, with its four chiral carbon atoms, has ________ possible stereoisomers
16
For the graph below plotting data that was collected under steady state conditions, velocity on the y-axis in units of uM/s and substrate concentration of the x-axis in units of uM, what is the Km
18 uM
Find the initial velocity for an enzymatic reaction when Vmax = 6.5 * 10^-5, [S] = 3 * 10^-3, Km = 4.5 * 10^-3 and the enzymatic concentration at time zero is 1.5 * 10^-2 uM
2.6 * 10^-5 mol*sec-1
The shortest α helix segment in a protein that will span a membrane bilayer has about _____ amino acid residues.
20
The inner (plasma) membrane of E. coli is about 75% lipid and 25% protein by weight. How many molecules of membrane lipid are there for each molecule of protein? (Assume that the average protein is Mr 50,000 and the average lipid is 750.)
200
How many stereoisomers do monosaccharides have?
2^n where n = # of chiral C atoms
In one catalytic cycle, the Na+/K+ ATPase transporter transports:
3 Na+ out, 2 K+ in, and converts 1 ATP to ADP + Pi.
In Sanger dideoxy DNA sequencing, DNA polymerase I is used to add nucleotides to the ___ end of the growing polynucleotide chain.
3'
What is the approximate length of a DNA molecule (in the B form) containing 10,000 base pairs?
3.4 Å x 10,000 = 34,000 Å = 3.4 µm. (See p. 338.)
What is the velocity of a first-order reaction at 37C when the reactant concentration is 6 *10^-2 M and the rate constant is 8 * 10^3 sec-1
4.8 * 10^2 M*sec-1
What is a nucleoside?
5-carbon sugar and a nitrogenous base --adenosine
The difference between the standard-state free energy, ΔGº, and the biochemical standard-state free energy is that ΔGº′ refers to the standard free-energy change at pH________.
7
5. The 5'-CAP of an eukaryotic mRNA is a ____ links to 5'-end of mRNA via a ______ link.
7-methylguanosine 5/,5'-triphosphate
How many stereoisomers are possible for aldopentose, ribose?
8
A pyrimidine is joined covalently to the pentose sugar through the: A) N-1 of the base to the 1′ carbon of the pentose. B) N-9 of the base to the 1′ carbon of the pentose. C) N-1 of the base to the 5′ carbon of the pentose. D) N-9 of the base to the 5′ carbon of the pentose. E) None of the answers is correct.
A
Which molecule contains the GREATEST amount of stored chemical energy? A) dGTP B) GDP C) dGDP D) GMP E) cGMP
A
n the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share which property? A) The distance between the two glycosidic (base-sugar) bonds is the same in both base pairs, within a few tenths of an angstrom. B) The molecular weights of the two base pairs are identical. C) The number of hydrogen bonds formed between the two bases of the base pair is the same. D) The plane of neither base pair is perpendicular to the axis of the helix. E) The proton-binding groups in both base pairs are in their charged or ionized form.
A
What is energy coupling? (A) the use of energy released from an exergonic reaction to drive an endergonic reaction (B) the use of an enzyme to reduce EA (C) a description of the energetic relationship between the reactants and products in an exergonic reaction (D) the hydrolysis of ATP to ADP + P (E) a barrier to the initiation of a reaction
A REASON: Definition of energy coupling.
The following reaction A => B + C + heat is a(n) ____ reaction. (A) exergonic (B) anabolic (C) dehydration synthesis (D) exchange (E) endergonic
A REASON: Energy has been released.
A(n) reaction occurs spontaneously. (A) exergonic (B) endergonic (C) anabolic (D) chemical (E) kinetic
A REASON: In exergonic reactions, the products have less potential energy than the reactants.
Which arrow correctly identifies the atom that will become the anomeric carbon?
A (the carboxylic acid carbon)
The sialic acids A) are important constituents of glycoproteins and glycolipids. B) are N-acetyl glucosamine derivatives. C) incorporate a succinic acid derivative. D) all of the above E) none of the above
A - Are important constituents of glycoproteins and glycolipids
D-Allose is an aldohexose. Methylation of which hydroxyl group on B-D-allopyranose prevents the molecule from mutarotating to a-D-allopyranose? A) C1 B) C2 C) C3 D) C4 E) C5
A - C1
Which statement correctly describes the molecules shown in the figure?
A and D are entantiomers, and B and C are diastereomers
What must a buffer solution include in order to resist changes in pH on addition of acid or base?
A buffer must include a mix of weak acid, HA, and its conjugate base, A-, and can only resist small changes in pH +/- 1 of its pKa
A compound that distorts the active site, rendering the enzyme catalytically inactive is called
A competitive inhibitor
Which of these statements is generally true of integral membrane proteins?
A hydropathy plot reveals one or more regions with a high hydropathy index.
A ligand-gated ion channel (such as the nicotinic acetylcholine receptor) is: A) a charged lipid in the membrane bilayer that allows ions to pass through. B) a membrane protein that permits a ligand to pass through the membrane only when opened by the appropriate ion. C) a membrane protein that permits an ion to pass through the membrane only when opened by the appropriate ligand. D) a molecule that binds to the membrane thereby allowing ions to pass through. E) always requires a second ligand to close the channel once it is opened.
A ligand-gated ion channel (such as the nicotinic acetylcholine receptor) is: C) a membrane protein that permits an ion to pass through the membrane only when opened by the appropriate ligand.
A major component of RNA but not of DNA is: A) adenine. B) cytosine. C) guanine. D) thymine. E) uracil.
A major component of RNA but not of DNA is: E) uracil.
Explain why nonpolar compounds are generally able to diffuse across biological membranes without the aid of a specific transport system.
A nonpolar compound is more soluble in nonpolar solutes, such as benzene or chloroform, than in polar solvents such as water. They generally pass through biological membranes unaided because it is energetically favorable for them to move from the aqueous solvent into the nonpolar region of the bilayer interior.
What is a PCR?
A procedure for amplifying a segment of DNA by repeated rounds of replication centered between primers that hybridize with the two ends of the DNA segment of interest.
Which of these statements about facilitated diffusion across a membrane is true?
A specific membrane protein lowers the activation energy for movement of the solute through the membrane.
Sketch the principal components of a typical proteoglycan, showing their relationships and connections to one another.
A typical proteoglycan consists of a core protein with covalently attached glycosaminoglycan polysaccharides, such as chondroitin sulfate and keratin sulfate. The polysaccharides generally attach to a serine residue in the protein via a trisaccharide (gal-gal-xyl). (See Fig. 7-24, p. 253.)
Approximately how much of the human genome encodes the exons of protein-coding sequences? A) 1.5% B) 5% C) 30% D) 100% E) 80%
A) 1.5%
What is the abbreviated nomenclature for a 14-carbon omega-3 fatty acid that contains no other double bonds? A) 14:1(Delta 11) B) 17:1(Delta 14) C) 14:1(Delta 3) D) 13:1(Delta 11) E) 14:0(Delta 11)
A) 14:1(Delta 11)
Which of the following statements about membrane lipids is true?
A) Glycerophospholipids are found only in the membranes of plant cells. B) Glycerophospholipids contain fatty acids linked to glycerol through amide bonds. C) Lecithin (phosphatidylcholine), which is used as an emulsifier in margarine and chocolate, is a sphingolipid. D) Some sphingolipids include oligosaccharides in their structure. E) Triacylglycerols are the principal components of erythrocyte membranes D
Which term BEST describes the cholesterol molecule? A) amphipathic B) nonpolar, charged C) nonpolar, uncharged D) polar, charged E) polar, uncharged
A) amphipathic
An example of a glycerophospholipid that is involved in cell signaling is
A) arachidonic acid. B) ceramide. C) phosphatidylinositol. D) testosterone. E) vitamin A (retinol). C
Sphingosine is NOT a component of: A) cardiolipin. B) ceramide. C) cerebrosides. D) gangliosides. E) sphingomyelin.
A) cardiolipin.
Alterations in genetic information are caused by:
A) point mutations B) faulty recombination C) transposition of genes
In one sentence, identify the most obvious structural difference between A-form (Watson-Crick) DNA and Z-form DNA.
A-form DNA is a right-handed helix; Z-form DNA is a left-handed helix. (See Fig. 10-19, page 338.)
What is the correct terminology for reactions A and B in the diagram?
A= hydrolysis, B=condensation
Which of the following DNA sequences is considered palindromic?
AAGCTT
Which of the following DNA sequences is considered palindromic? - AAGCTT - GAACTT - GAACAA - AAGCAA - AAGTTC
AAGCTT
Which of the following DNA sequences (in which N is any nucleic acid residue) is palindromic? - ANAGCTT - AANGCTT - AAGNCTT - AAGCNTT - AAGCTNT
AAGNCTT
Which molecule does not contain an energy rich phosphoanhydride bond?
AMP
Which of the following molecules does not contain an energy rich phosphoanhydride bond?
AMP
Myosin moves relative to actin filaments by using energy derived from the hydrolysis of which molecule?
ATP
Which of the following nucleotides contain energy rich bonds?
ATP,TTP,GTP, CTP
According to the current model for HIV infection, which of the following is not involved in the process of membrane fusion? A) A cell surface co-receptor protein B) A cell surface receptor protein C) A viral glycoprotein complex D) The viral chromosome E) The viral envelope
According to the current model for HIV infection, which of the following is not involved in the process of membrane fusion? D) The viral chromosome
Which of the following statements about actin is not true? Actin is the most abundant cytoplasmic protein in many cell types. Actin forms microfilaments in many cell types. Actin plays an important role in endocytosis. Actin is present only as monomers in nonmuscle cells. Actin filaments are dynamic, they grow at one end and they lose subunits at the other end.
Actin is present only as monomers in nonmuscle cells.
1. Describe two process that allows a single gene to yield different peptides during RNA processing
Alternative splicing and Poly-A site choice
Which of the restriction enzymes listed in the table below produces blunt-end fragments? Enzyme Cleavage site AluI AG ↓↓ CT HindIII A ↓↓ AGCTT BamHI G ↓↓ GATCC EcoRI G ↓↓ AATTC BglII A ↓↓ GATCA
AluI
What is an amphipathic compound? Explain how such compounds contribute to the structure of biological membranes.
An amphipathic compound has one region or domain that is hydrophilic and another that is hydrophobic. When added to water, amphipathic compounds tend to arrange in a way that exposes their hydrophilic regions to the solvent and hides their hydrophobic domains. One structure that accomplishes this is the lipid bilayer, which forms spontaneously with phospholipids in water.
An electrogenic Na+ transporter: A) catalyzes facilitated diffusion of Na+ from a region of high Na+ concentration to one of lower Na+ concentration. B) must catalyze an electron transfer (oxidation-reduction) reaction simultaneously with Na+ transport. C) must transport both Na+ and a counterion (Cl-, for example). D) transports Na+ against its concentration gradient. E) transports Na+ without concurrent transport of any other charged species.
An electrogenic Na+ transporter: E) transports Na+ without concurrent transport of any other charged species.
An integral membrane protein can be extracted with: A) a buffer of alkaline or acid pH. B) a chelating agent that removes divalent cations. C) a solution containing detergent. D) a solution of high ionic strength. E) hot water.
An integral membrane protein can be extracted with: C) a solution containing detergent.
How can alsodes and ketoses from 6-membered (pyranose) and 5-membered (furanose) rings?
An intramolecular nucleophilic attack of hydroxyl O atom on carbonyl C atom froming a hemiacetal or heiketal group within the cyclic rings
What is the difference between an alpha and beta anomer on a Hawarth projection?
Anomers are a special class of epimers involving the stereochemical configuration only at the anomeric C atom (old carbonyl C). Alpha anomer lies below the plane opposite of CH2OH; Beta lies above on the same side of CH2OH a-D-glucopyranose and a-L-glucopyranose are enantiomers
Glycosphingolipids and cholesterol cluster together in membrane regions known as "__________". These microdomains are more __________ than the surrounding phospholipid-rich membrane due to a high content of __________ fatty acids. These regions are rich in proteins that are anchored to the membrane by covalently attached __________ and __________ groups and also those anchored by GPI linkage. Proteins aggregated in this fashion are often functionally related. Examples are (1) __________ proteins and (2) __________ proteins.
Ans: "rafts", ordered, saturated, myristoyl, palmitoyl, receptor, signaling.
You are presented with a gram of a newly isolated animal virus. Electron microscopy reveals the presence of a typical membrane surrounding the virus, and chemical analysis shows the presence of two membrane lipids, phosphatidylethanolamine and phosphatidylserine, as well as several membrane-associated proteins. Describe briefly a simple experimental approach to answering each of the following questions: (a) Which proteins are exposed at the outer surface and which traverse the membrane, with parts of their structure in the cytoplasm and parts outside the cell? (b) Are the phosphatidylethanolamine and phosphatidylserine symmetrically disposed in the two faces of the bilayer?
Ans: (a) Briefly, two radiolabeled reagents, each of which reacts with primary amines, are used to label proteins in the intact cell. One of the reagents penetrates the plasma membrane readily and is therefore able to label intracellular domains of membrane proteins as well as their extracellular domains. The other reagent is impermeant and can label only domains on the outer face. By carefully assessing which membrane proteins are labeled by which reagent, one can determine which of them has extracellular domains and which has intracellular domains. (b) The same basic procedure can be used to label lipids, such as phosphatidylserine and phosphatidylethanolamine, which contain primary amino groups, and thus to determine their location in the membrane.
Lipids as signals, cofactors, and pigments Pages: 373-375 Difficulty: 1 Which of the following is not a fat-soluble vitamin? A) A B) C C) D D) E E) K
Ans: B B) C
Select the statement that best matches the following: Monoclonal antibodies Fragments of proteolyzed IgG that have antigen-binding sites. Cells that mediate humoral immunity. Antibodies produced by hybridoma cells. Diverse group of proteins also known as antibodies. Cells that mediate cellular immunity.
Antibodies produced by hybridoma cells.
Write a double-stranded DNA sequence containing a six-nucleotide palindrome.
Any double-stranded sequence that has the form: 1-2-3-4-5-6-6'-5'-4'-3'-2'-1' 1'-2'-3'-4'-5'-6'-6-5-4-3-2-1 where each number and its prime represent correctly paired bases (A with T, C with G) all along the double-stranded molecule.
What term describes an enzyme without its required cofactor?
Apoenzyme
Which statement describes a distinct difference between membrane lipids in archaea and membrane lipids in eukarya?
Archaeal membrane lipids have alkyl acids that are ether-linked to glycerol at both ends.
In an alpha helix, the R groups on the amino acid residues:
Are found on the outside of the helix spiral
N-linked oligosaccharides can be covalently linked to proteins at which amino acid? A) Gly B) Ser C) Glu D) Tyr E) Asn
Asn
N-linked glycosylation recognition sequence
Asn-X-Ser or Asn-X-Thr X= any a.a except Pro
Briefly describe the experimental evidence of Avery, MacLeod, and McCarty that DNA is the genetic material.
Avery et al. showed that DNA isolated from a virulent (disease-causing) bacterium (Streptococcus pneumoniae), when mixed with living cells of a nonvirulent strain of this bacterium, provided the genetic instructions for transforming the nonvirulent strain to a virulent strain.
A compound containing N-acetylneuraminic acid (sialic acid) is: A) cardiolipin. B) ganglioside GM2. C) phosphatidylcholine. D) platelet-activating factor. E) sphingomyelin.
B
A compound containing N-acetylneuraminic acid (sialic acid) is: A) cardiolipin. B) ganglioside GM2. C) phosphatidylcholine. D) platelet-activating factor. E) sphingomyelin.
B
Which of the structures below represents a glucoside?
B
Which vitamin is NOT fat soluble? A) A B) C C) D D) E E) K
B
An enzyme ______. (A) increases the EA of a reaction (B) is an organic catalyst (C) is a source of energy for endergonic reactions (D) is a inorganic catalyst (E) can bind to nearly any molecule
B REASON: Enzymes are proteins that behave as catalysts. Organic because it's a protein.
Choose the pair of terms that correctly completes this sentence: Catabolism is to anabolism as _________ is to _________. (A) exergonic; spontaneous (B) exergonic; endergonic (C) free energy; entropy (D) work; energy
B REASON: Exergonic reactions release energy, similar to catabolism. On the other hand, endergonic reactions require energy, just like anabolism.
The primary structure of mammalian hemoglobin, an 22 tetramer, is approximately _____ identical to myoglobin. A) 2% B) 18% C) 50% D) 78% E) 98%
B - 18%
Based on the figure in the questions above, which of the following expressions would correctly define Km
B = Km
Which diagram correctly represents a hydrogen bond?
B and C (between O-H and N and between N-H and O)
Which statement BEST describes why lipids typically float on water? A) Lipids are nonpolar, while water is polar. B) Lipids have lower specific gravities than water does. C) Lipids have higher melting temperature than water does. D) Lipids store more energy than water does. E) Lipids contain carbon, while water does not.
B) Lipids have lower specific gravities than water does.
For what reason is the mitochondrial genome and the Y chromosome the easiest portions of human DNA to use to trace human evolutionary lineages? A) All human cells have mitochondria and Y chromosomes. B) Mitochondrial DNA and the Y chromosome do not undergo significant meiotic recombination. C) The size of the mitochondrial genome and the Y chromosome is small. D) Mitochondrial DNA and the Y chromosome exhibit very unstable haplotypes. E) Mitochondrial DNA is inherited along both the male and female human evolutionary. lineages
B) Mitochondrial DNA and the Y chromosome do not undergo significant meiotic recombination.
Which statement is TRUE of lipids? A) Many contain fatty acids in ester or amide linkage. B) Most are simply polymers of isoprene. C) Testosterone is an important sphingolipid found in myelin. D) They are more soluble in water than in chloroform. E) They play only passive roles as energy-storage molecules.
B) Most are simply polymers of isoprene.
Genes that have sequence and functional relationships to each other within a single species are called: A) orthologs. B) paralogs. C) analogs. D) homologs. E) lincolnlogs.
B) paralogs.
Nonsteroidal anti-inflammatory drugs (NSAIDS) like aspirin and ibuprofen act by blocking production of: A) biological waxes B) prostaglandins C) sphingolipids D) vitamin D E) None of the answers is correct.
B) prostaglandins
How many stereoisomers are possible for a ketopentose such as ribulose? A. 2 B. 4 C. 8 D. 16
B. 4
Based on Chargaff's rules, which of the following are possible base compositions for double-stranded DNA? %A %G %C %T %U A) 5 45 45 5 0 B) 20 20 20 20 20 C) 35 15 35 15 0 D) all of the above E) none of the above
Based on Chargaff's rules, which of the following are possible base compositions for double-stranded DNA? %A %G %C %T %U A) 5 45 45 5 0
Why is this statement false. The lipid composition (type and percent) of all membranes of eukaryotic cells is essentially the same.
Because it cannot be the same for tissues, organisms and organelles
On the molecule below, the arrow is pointing to the ____ carbon.
Beta
red blood cells
Blood cells that carry oxygen to body cells and take away carbon dioxide. Contain a lot of iron that make blood red/orange and allow blood to be seen and respond to indicator tests.
Triacylglycerols are composed of:
Both glycerol backbone and three fatty acids
Hemoglobin is a heterotetramer. How many protomers are present in hemoglobin? A) 0 B) 1 C) 2 D) 3 E) 4
C - 2 protomers
48. Which of the following polysaccharides cannot be digested by mammalian salivary, gastric, or pancreatic enzymes? A) amylopectin B) amylose C) chitin D) glycogen E) starch
C) chitin
Which types of membrane lipids make up 70% to 80% of the total membrane lipids in a vascular plant? A) phosphatidylserines B) glycosphingolipids C) galactolipids D) plasmalogens E) sphingomyelins
C) galactolipids
Carbon dioxide, produced by glucose oxidation, is not very soluble. How does the body transport this molecule through the blood to be exhaled from the lungs?
CO2 can be converted to the more soluble HCO3- for transport.
If you want to study the effects of iactivating a specific gene on development of a mouse, which technique or system would you use to inactivate that gene?
CRISPR/Cas 9
Select the statement that best matches the following: Troponin C Calcium binding protein. Functional unit of the myofibril. Chemical energy source for muscle contraction. Major component of the thick filament of the myofibril. Major component of the thin filament of the myofibril.
Calcium binding protein.
Which reason is most probable for why carbon is used in living organisms but not silicon?
Carbon is lighter, and therefore its bonds are stronger.
Select the statement that best matches the following: T lymphocytes, or T cells Fragments of proteolyzed IgG that have antigen-binding sites. Cells that mediate cellular immunity. Antibodies produced by hybridoma cells. Cells that mediate humoral immunity. Diverse group of proteins also known as antibodies.
Cells that mediate cellular immunity.
Select the statement that best matches the following: B lymphocytes, or B cells Cells that mediate humoral immunity. Fragments of proteolyzed IgG that have antigen-binding sites. Cells that mediate cellular immunity. Antibodies produced by hybridoma cells. Diverse group of proteins also known as antibodie
Cells that mediate humoral immunity.
Which statement is TRUE of sphingolipids?
Cerebrosides and gangliosides are sphingolipids.
Chargaff's rules state that in typical DNA: A) A = G. B) A = C. C) A = U. D) A + T = G + C. E) A + G = T + C.
Chargaff's rules state that in typical DNA: E) A + G = T + C. (Chargaff's rule states that the amount of adenine is equal to thymine while the amount of guanine is equal to cytosine; 1:1 ratio of purine and pyrimidine bases.)
Define chemical potential of a substance. How is it related to its concentration?
Chemical potential (u) of a substance is a physical property related to its concentration (proportional to the concentration difference across membrane) that describes the amount of potential energy stored that can be used to do useful work aka, concentration difference creates chemical potential difference delta{u} = RTln([A]cyt/[A]ext)
___ is a homopolymer composed of β(1-4) linked N-acetyl-D-glucosamine residues that is the principle structural component of the exoskeleton of various groups of invertebrates
Chitin
Organic cofactors are referred to as __________________.
Coenzymes
Which statement is false?
Collagen is a protein in which the polypeptides are mainly in the alpha helix conformation.
A __________________ inhibitor often has a structure similar to the substrate and often reversibly binds to the active site of the enzyme but can be displaced by substrate.
Competitive
In ______, the inhibitor binds to a site involved in both substrate binding & catalysis
Competitive Inhibition
The type of enzyme inhibition in which Vmax is unaffected is
Competitive Inhibition
As humans age, the connective tissue, rich in collagen, becomes more rigid and brittle. What is the molecular cause of this change?
Crosslinks between collagen fibrils accumulate over time.
Chitin differs from cellulose due to A) inversion of configuration at the anomeric carbon. B) sulfonation of the C2 OH group. C) a much greater prevalence of branching. D) replacement of the C2 OH group by an acetamido group. E) replacement of the C6 OH group by an amino group.
D
Which diagram illustrates an amphipathic molecule?
D (the fatty acid chain)
Which drug is NOT lipid based? A) prednisone B) warfarin C) erythromycin D) aspirin E) lovastatin
D) aspirin
To possess optical activity, a chemical compound must be A. a hexose B. aromatic C. symmetric D. asymmetric
D. asymmetric
Mutations leading to beneficial alterations and potentially the evolution of an organism have their beginning at the _______ level.
DNA
Deamination vs Depurination
Deamination - removal of an amine group from a molecule,slow reaction, large number of residues Depruination-N-glycosidic bond is hydrolyzed •Significant for purines: 10,000 purines lost/day in a mammalian cell BOTH VIA HYDROLYSIS
Organisms composed of cells with two sets of chromosomes are called ______ organisms.
Diploid
Select the statement that best matches the following: Immunoglobulins Fragments of proteolyzed IgG that have antigen-binding sites. Antibodies produced by hybridoma cells. Cells that mediate humoral immunity. Cells that mediate cellular immunity. Diverse group of proteins also known as antibodies.
Diverse group of proteins also known as antibodies.
Which of the statements about muscle contraction is not true? During muscle contraction the sarcomere becomes shorter. During muscle contraction the I band becomes shorter. During muscle contraction the H zone becomes shorter. During muscle contraction the A band becomes shorter. During muscle contraction the distance between the Z disk and the M disk becomes shorter.
During muscle contraction the A band becomes shorter.
Identify the molecule(s) derived from sterols. A) arachidonic acid B) gangliosides C) phosphatidylglycerol D) prostaglandins E) cortisol
E
In the Watson-Crick model of DNA structure (now called B-form DNA): A) a purine in one strand always hydrogen bonds with a purine in the other strand. B) A-T pairs share three hydrogen bonds. C) G-C pairs share two hydrogen bonds. D) the 5' ends of both strands are at one end of the helix. E) the bases occupy the interior of the helix
E
Which of the following is not a reducing sugar? A) Fructose B) Glucose C) Glyceraldehyde D) Ribose E) Sucrose
E) Sucrose is NOT a reducing sugar. (Sucrose does not have a reducing end, as it is made of the anomeric C of glucose and hydroxyl group of fructose via a alpha1-->beta4 linkage.)
Which bond or functional group is NOT found in a GPI anchor? A) a phosphodiester bond B) a glycosidic bond C) a hydroxyl group D) an ester bond E) a thioester bond
E) a thioester bond
As the temperature for a membrane lipid preparation is raised, what would be the order of states that would be adopted? A) liquid-ordered, gel phase, liquid-disordered B) liquid-disordered, liquid-ordered, gel phase C) liquid-disordered, gel phase, liquid-ordered D) gel phase, liquid-disordered, liquid-ordered E) gel phase, liquid-ordered, liquid-disordered
E) gel phase, liquid-ordered, liquid-disordered
A good cloning vector should NOT have: A) an origin of replication. B) an antibiotic resistance gene. C) several unique restriction sites. D) a small size. E) genes allowing its insertion into the host chromosome.
E) genes allowing its insertion into the host chromosome.
For the reaction, the steady state assumption
ES breakdown occurs at the same rate as ES formation
In uncompetitive inhibition, the inhibitor binds only to the
ES complex
Which of the following is true?
Enzymes force reactions to proceed in only one direction. Enzymes alter the equilibrium of the reaction. Enzymes alter the standard free energy of the reaction. All of the answers are correct. NONE OF THE ANSWERS ARE CORRECT
The KM is
Equal to the substrate concentration when the reaction rate is half its maximal value.
Riboflavin is a water-soluble organic substance that is not synthesized by humans. Metabolically, it is chemically converted into a substance called flavin adenine dinucleotide, which is required by succinate dehydrogenase. Which of the following statements is most correct?
Flavin adenine dinucleotide is a coenzyme.
Summarize the steps of signal transduction from a GCPR to phosphorylation or target proteins by PKA
G protein binded to GCPR tail (inactive) -> ligand binds to GCPR head -> GTP, GDP exhange -> alpha and beta subunits break apart -> alpha unit catalyzes AC beta catalyzes PLC-> cAMP formation from AC and ATP -> cAMP targets PKA
Glucose transport into erythrocytes is an example of: A) active transport. B) antiport. C) electrogenic uniport D) facilitated diffusion. E) symport.
Glucose transport into erythrocytes is an example of: D) facilitated diffusion.
The smallest aldose is
Glyceraldehyde
an example of homopolysaccharide in liver and muscle is ___
Glycogen
_____ is the determination of the full components and function of sugar-containing molecules in a cell or tissue.
Glycomics
6._____ introns are self-splicing (Ribozymes).
Group I and group II
Phosphoric acid is tribasic, with pKa's of 2.14, 6.86, and 12.4. The ionic form that predominates at pH 3.2 is:
H2PO4-
Which of the following statements is not true about IgG? The antigen-binding site is located at the tip of each Fab fragment in a crevice between its VL and VH domains Has a Y-shaped general structure. The heavy chain of an IgG molecule is composed of four similar domains made of beta sheets. Has two antigen binding sites that can recognize and bind different antigens. The antigen binding sites have an immunoglobulin fold motif (a sandwich composed of three- and four-stranded antiparallel sheets that are linked by a disulfide bond).
Has two antigen binding sites that can recognize and bind different antigens.
A significant contribution to the change in hemoglobin affinity for oxygen from pH 7.2 to pH 7.6 is due to a change in the protonation state of which amino acid side chain?
His
Which of the following is not a ligand to the porphyrin ring Fe(II) ion in oxymyoglobin? His E7. His F8. Nitrogen atoms in the porphyrin ring. Oxygen. All are ligands.
His E7.
During the T to R conformational shift, Fe(II) drags the F helix via a bond to the side chain of ________. Leu F7 Leu F4 His F8 Leu FG3 Val FG5
His F8
Which amino acids in chymotrypsin are found in the active site and are participants in substrate cleavage?
His, Ser, Asp
A Lineweaver-Burk plot is also referred to as
II, IV II - a linear plot IV - a double reciprocal plot
The pitch of an alpha helix is 5.4 A per turn, and there are 3.6 amino acid residues per turn. If the thickness of the lipid bilayer is 30 A, how many amino acid residues are required in an alpha helix that is just long enough to span the lipid bilayer?
If the pitch is 5.4 A/turn and there are 3.6 residues per turn, then each residue lengthens the helix by 5.4/ 3.6 = 1.5 A/residue. Dividing 30 A by 1.5 A/residue gives a value of 20 residues necessary to span the lipid bilayer.
Which class of antibodies has been implicated in allergic reactions? IgA IgD IgE IgG IgM
IgE
Hyaluronic Acid
Important glycoasaminoglycan component of synovial fluid B(1-->3) linked of D-glucuronate and N-acetyl-d-glucosamine(GlcNAc) Used as a biological shock absorber
Chargaff's rules state that:
In DNA the number of adenine residues is identical to the number of thymine residues and the number of guanine residues is identical to the number of cytosine residues.
Chargaff's rules state that:
In DNA the number of adenine residues is identical to the number of thymine residues and the number of guanine residues is identical to the number of cytosine residues.
In a double-stranded nucleic acid, cytosine typically base-pairs with: A) adenosine. B) guanine. C) inosine. D) thymine. E) uracil.
In a double-stranded nucleic acid, cytosine typically base-pairs with: B) guanine.
Which of these statements about the composition of biological membranes is false?
In a given eukaryotic cell type (e.g., a hepatocyte), all intracellular membranes have essentially the same complement of lipids and proteins
In the laboratory, several factors are known to cause alteration of the chemical structure of DNA. The factor(s) likely to be important in a living cell is (are): A) heat. B) low pH. C) oxygen. D) UV light. E) both C and D.
In the laboratory, several factors are known to cause alteration of the chemical structure of DNA. The factor(s) likely to be important in a living cell is (are): E) both C and D.
Explain how nucleoside triphosphates (such as ATP) act as carriers of chemical energy.
In these molecules, there is a phosphoric anhydride linkage between the phosphates. Hydrolysis of this linkage (i.e., of ATP to ADP and phosphate) is a highly exergonic reaction that results in the release of a large amount of free energy. Conversely, the input of a large amount of free energy is required for the synthesis of the linkage; i.e., for the phosphorylation of ADP to form ATP. Thus, synthesis of ATP results in the storage of energy that can be released upon hydrolysis.
Irreversible enzyme inhibitors
Inactivate the enzyme
Which of these is a general feature of the lipid bilayer in all biological membranes?
Individual lipid molecules are free to diffuse laterally in the surface of the bilayer.
_____ is NOT a biological use of waxes.
Insulation
Eukaryotic genes often contain regions that are transcribed and later excised from the RNA, called ______.
Introns
Which term best describes the histidine F8 residue in myoglobin and hemoglobin? Variable residue. Conservatively substituted residue. Catalytic residue. Invariant residue. Homologous residue.
Invariant residue.
Reaction that is first order with respect to A and B
Is dependent on the concentration of A and B
The catalytic efficiency of an enzyme can never exceed
K1*
A lead compound would be most promising if it had
K1= 1.5 x10 -8 M
Proteins that bind to specific carbohydrates are called ______.
Lectins
The straight-line kinetic plot of 1/ V0 versus 1/S is called a ________________________.
Lineweaver-Burk plot
What are the principle features of the fluid mosaic model of membranes?
Lipid bilayer integral membrane proteins peripheral membrane proteins
Which statement about living systems in not true?
Living systems are in equillibrium with their surroundings
Which of the following would have the GREATEST affect on osmotic pressure?
M CaCl2 (MW = 111 g/mol)
Membrane fusion leading to neurotransmitter release requires the action of: A) cadherins. B) selectins. C) flipases. D) tSNARE and vSNARE. E) none of the above.
Membrane fusion leading to neurotransmitter release requires the action of: D) tSNARE and vSNARE.
Free nucleotides are almost always associated with ______ in cells.
Mg2+ counter ions
Inside our cells, free nucleotides are almost always associated with
Mg2+ counterions
Inside our cells, free nucleotides are almost always associated with ______.
Mg2+ counterions
A reaction can occur spontaneously only if ΔG is __________________.
Negative
Which statement about biologically important gases is true?
O2 and CO2 are both nonpolar molecules and are therefore both poorly soluble in water.
Which of the following conclusions about the human genome project are true?
Only about 28% of the genome is transcribed to RNA, and only about 1-2% codes for protein. Nearly half of the human genome consists of repetitive DNA sequences.
How does osmosis differ from diffusion? Which process occurs during dialysis?
Osmosis is the diffusion of only water; in dialysis, both osmosis and the diffusion of solutes diffuse across a semipermeable membrane until solute concentration reaches equilibrium on both sides osmotic pressure = pressure needed to prevent influx of water (osmosis)
Patients with chronic hypoxia (low O2 levels)due to decreased lung function may adapt by increasing their circulating BPG levels. Predict which outcome will be true for such a patient.
P50 for O2 will be increased
What are the three forms of passive transport?
POF = passive diffusion, osmosis, and filtration
Why is the HbS mutation so prevalent in Africa and other tropical regions?
People with sickle-cell trait are resistant to malaria, increasing prevalence of the HbS allele.
The main component of a bacterial cell wall is a ___
Peptidoglycan
Bacterial cell walls are composed of _____.
Peptidoglycans
A two-substrate enzymatic reaction in which one product is produced before the second substrate binds to the enzyme has a ______ mechanism
Ping Pong
The high degree of cohesion of water molecules influences which processes?
Plants can transport dissolved nutrients from roots to leaves.
_____ contains an ether linked alkyl group.
Platelet activating factor.
Discuss differences between prokaryotes and eukaryotes
Prokaryotes: unicellular, smaller, lack nucleus and most membrane-bound organelles Eukaryotes: both unicellular and multicellular, larger, have nucleus and membrane-bound organelles; compartmentalization promotes efficiency
What is the function of cholesterol in the cell plasma membrane? Allow movement of charged particles through the membrane Provide ATP Promote membrane fluidity Transport molecules across the membrane
Promote membrane fluidity
For a reaction A + B --> C, if the concentration of B is much larger than A so that [B] remains constant during the reaction while [A] is varied, the kinetics will be
Pseudo-first-order
4. ___ : Process in which introns are removed from pre-mRNA.
RNA splicing
In comparison with DNA-DNA double helices, the stability of DNA-RNA and RNA-RNA helices is:
RNA-RNA> DNA-RNA > DNA-DNA
Describe the structure & stereochemistry of saturated and unsaturated fatty acids
Saturated: conformational flexibility due to free rotation about each C-C bond, but pack close together Unsaturated: kinks in chain at double bonds make looser packing; can adopt 2^n cis/trans stereoisomers where n is the # of double bonds
Name and draw the 5 nitrogenous bases.
See your notes
A lead compound for a new drug should bind to its target protein with a very
Small Ks
Which statement about membrane lipids is TRUE?
Some sphingolipids include oligosaccharides in their structure.
9. ____ facilitate hybridization with electrophoretically separated DNA molecules to identify a DNA fragment.
Southern blotting
The biochemical property of lectins that is the basis for most of their biological effects is their ability to bind to:
Specific oligosaccharides
Compare and contrast the structures and functions of cellulose, chitin, starch, and glycogen
Starch: composed of linear and branched polymers, principal fuel storage/ energy reservoir of plants deposited in the chloroplasts Glycogen: more highly branched, principal fuel storage/energy reservoir in animals deposited in the liver produced via glycogenesis Cellulose: linear biopolymer; structural component of plant cell walls and secreted as biofilm by bacteria Chitin: linear biopolymer; structural component of exoskeletons in invertebrates (crustaceans and insects), also prominent in fungi and algae cell walls
Which one of the following statements about membranes is true?
Sterol lipids are common in human cell plasma membranes.
What term describes the substance that is bound by an enzyme and converted to product?
Substrate
The Gibbs-free energy of activation is the difference between the
Substrate and the transition state.
How do biochemists define the standard state of a solution?
Temperature = 25 degrees Celsius Pressure = 1atm pH = 7.0
Which of the following statements about hemoglobin is TRUE? The affinity of fetal hemoglobin for oxygen is higher than that of maternal hemoglobin. Hemoglobin differs from myoglobin because it contains more β-pleated sheet structure. In the Bohr effect the binding of oxygen to hemoglobin is increased by the presence of H+ ions and CO2. Variations in the primary structure of hemoglobin always result in genetic diseases.
The affinity of fetal hemoglobin for oxygen is higher than that of maternal hemoglobin.
The basic structure of a proteoglycan consists of a core protein and a: A) glycolipid. B) glycosaminoglycan. C) lectin. D) lipopolysaccharide. E) peptidoglycan.
The basic structure of a proteoglycan consists of a core protein and a: B) glycosaminoglycan.
Advantages to using triacylglycerols, rather than polysaccharaides, to store energy include which reason(s)?
The carbon atoms of triacylglycerols are more reduced, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them.
The composition (mole fraction) of one of the strands of a double-helical DNA is [A] = 0.3, and [G] = 0.24. Calculate the following, if possible. If impossible, write "I." For the same strand: [T] = (a) ____ [C] = (b) ____ [T] + [C] = (c) ____ For the other strand: [A] = (d) ____ [T] = (e) ____ [A] + [T] = (f) ____ [G] = (g) ____ [C] = (h) ____ [G] + [C] = (i) ____
The composition (mole fraction) of one of the strands of a double-helical DNA is [A] = 0.3, and [G] = 0.24. Calculate the following, if possible. If impossible, write "I." For the same strand: [T] = (a) I [C] = (b) I [T] + [C] = (c) 0.46 For the other strand: [A] = (d) I [T] = (e) 0.3 [A] + [T] = (f) I [G] = (g) I [C] = (h) 0.24 [G] + [C] = (i) I
In what direction does an increase in BPG push the binding curve of oxygen to hemoglobin?
The curve is shifted to the right Red blood cells will produce more BPG so that they can release more oxygen at higher partial pressures of oxygen.
If the hydrophobic interior of a membrane were about 3 nm thick, what would be the minimum number of amino acids in a stretch of transmembrane alpha helix?
The dimensions of an alpha helix are about 5.4 Å/turn, and there are 3.6 residues/turn, so each residue extends the helix by about 1.5 Å or 0.15 nm. To span 3 nm of lipid bilayer will therefore require a minimum of 20 residues.
Which of the following is true under the following conditions: the enzyme concentration is 5 nM, the substrate concentration is 5 mM, and the KM is 5 mM?
The enzyme is saturated with substrate.
The formula K'eq = 10-DG°¢/1.36 indicates the relationship between
The equilibrium constant and standard free energy.
5. Briefly describe the role of recombination in the generation of antibody (immunoglobin) diversity.
The genes for immunoglobin polypeptide chains are divided into segments, with multiple versions of each segment (V, J, C in Kappa chain: which code for slightly different amino 6 acid sequences). Recombination results in the joining of individual versions of each segment to generate a complete gene. Antibody diversity results from the very large number of different combinations that are possible.
A double reciprocal plot of 1/Vo versus 1/[S] for an enzyme in the presence of increasing concentration of an uncompetitive inhibitor will have lines corresponding to the different inhibitor concentrations that are best described by which statement?
The lines will cross the y-axis and will be parallel to each other.
Which statement BEST describes how the volatility of lipids is increased for analysis by gas chromatography?
The lipids are transesterified to convert fatty acids into fatty acid methyl esters.
The nucleic acid bases: A) absorb ultraviolet light maximally at 280 nm. B) are all about the same size. C) are relatively hydrophilic. D) are roughly planar. E) can all stably base-pair with one another.
The nucleic acid bases: D) are roughly planar.
Describe briefly what is meant by saying that two DNA strands are complementary.
The nucleotide sequences of complementary strands are such that wherever an A occurs in one strand, there is a T in the other strand with which it can form a hydrogen-bonded base pair. Wherever a C occurs in one strand, a G occurs in the other. A is the base complementary to T, and C is the base complementary to G.
Protein kinases are involved in
The phosphorylation of a wide variety of proteins
Which of these reactions requires a net input of energy from its surroundings? (A) ATP => ADP + P (B) catabolic (C) hydrolysis (D) exergonic (E) endergonic
The products of endergonic reactions have more potential energy than the reactants.
If A --> B is a zero-order reaction, the rate is dependent on
The rate constant (Km)
In what direction does the sigmoidal curve shift due to an increase in pH?
The sigmoidal curve is shifted to the left.
8 2
This sequence has a palindrome, an inverted repeat with twofold symmetry: (5′)GCGCAATATTTCTCAAAATATTGCGC(3′) (3′)CGCGTTATAAAGAGTTTTATAACGCG(5′) Because this sequence is self-complementary, the individual strands have the potential to form hairpin structures. The two strands together may also form a cruciform.
platelets
Tiny, disk-shaped bodies in the blood, important in blood clot formation. Makes blood thick and viscous so it resists breaking apart when projected.
Triple-helical DNA structures can result from Hoogsteen (non Watson-Crick) interactions. These interactions are primarily: A) covalent bonds involving deoxyribose. B) covalent bonds involving the bases. C) hydrogen bonds involving deoxyribose. D) hydrogen bonds involving the bases. E) hydrophobic interactions involving the bases.
Triple-helical DNA structures can result from Hoogsteen (non Watson-Crick) interactions. These interactions are primarily: D) hydrogen bonds involving the bases.
What is the column buffer?
Tris-HCl, pH 7.5
A pyrimidine in one strand of DNA always pairs with a purine in the other strand
True
The kcat is often referred to as the _____.
Turnover number
Double stranded DNA molecules can be cleaved at specific recognition sites by...?
Type II restriction endonucleases
What is the principal effect of ultraviolet radiation on DNA?
UV radiation causes the formation of a dimer between adjacent thymine bases on the same DNA strand. This results in a kink in the double helix at that site.
The image below plots the denaturation of ribonuclease A as a function of guanidine hydrochloride (GdnHCl) concentration, monitored by circular dichroism. The shape of the curve in the figure supports which statement?
Unfolding of this protein is a cooperative process.
When substrate concentration is much greater than KM, the rate of catalysis is almost equal to
Vmax
Which of these statements about the composition of membranes is true? A) All biological membranes contain cholesterol. B) Free fatty acids are major components of all membranes. C) The inner and outer membranes of mitochondria have different protein compositions. D) The lipid composition of all membranes of eukaryotic cells is essentially the same. E) The lipid:protein ratio varies from about 1:4 to 4:1
Which of these statements about the composition of membranes is true? C) The inner and outer membranes of mitochondria have different protein compositions.
Which of the following is correct in regards to the diagram above
X = B, Y = A, Z = Q
The Watson and Crick model of a double-helical structure for DNA was based, in part, on evidence from
X-ray diffraction
What is a polylinker?
a DNA fragment with multiple recognition sequences for restriction endonucleases
A compound that distorts the active site, rendering the enzyme catalytically inactive is called
a competitive inhibitor
A gene knockout is...?
a gene that has been inactivated or removed from an organism
A gene knockout is:
a gene that has been inactivated or removed from an organism.
The Ig fold can be described as a globular fold composed of helices. a globular fold composed of a four helix bundle. a globular fold composed of a sandwich. a globular fold composed of barrel. a coiled-coil.
a globular fold composed of a sandwich.
A lineweaver-burk plot is also referred to as
a linear plot, a double reciprocal plot
A ligand-gated ion channel (such as the nicotinic acetylcholine receptor) is:
a membrane protein that permits an ion to pass through the membrane only when opened by the appropriate ligand.
Which solvent is a commonly used to extract all the lipids from homogenized tissue samples and subsequent separation of the lipids from the proteins and sugars present in those samples?
a mixture of chloroform, methanol, and water
For amino acids with neutral R groups, at any pH below the pI of the amino acid, the population of amino acids in solution will have:
a net positivecharge
The oxygen binding by hemocyanins is mediated by an iron ion a pair of iron ions a heme group a copper atom a pair of copper atoms
a pair of copper atoms
GFC can also be used to measure
a protein's native weight
An integral membrane protein can be extracted with:
a solution containing detergent.
Define acid and base
acid = compound that can donate a proton base = compound that can accept a proton
Amino acids are ampholytes because they can function as either a(n):
acid or base
AMP' is used to refer to?
adenylic acid
What are the reaction schemes that generate adonic acids, uronic acids, alditols, deoxy sugars, and amino sugars
adonic acids = HCO -> COOH uronic acids = H2COH -> COOH alditols = HCO -> H2COH deoxy sugars = OH -> H amino sugars = OH -> NH2
A small molecule that decreases the activity of an enzyme by binding to a site other than the catalytic site is termed a(n):
allosteric inhibitor
List the functions of biological membranes
allow import and export retain metabolites and ions provide compartmentalization produce and transmit nerve signals store energy support synthesis of ATP
Which glycosidic bond distinguishes glycogen from amylose?
alpha (1,6)
All of the 20 common amino acids contain an R-group that is attache to the:
alpha carbon
Proline residues are infrequently found in _____ due to their ____.
alpha helices; decreased ability to serve as hydrogen-bond donors.
Starch and glycogen are both polymers of:
alpha-D-glucose
The fluidity of the lipid side chains in the interior of a bilayer is generally increased by:
an increase in the number of double bonds in fatty acids.
Energy requiring metabolic pathways that yield complex molecules from simpler precursors are:
anabolic
For the process of solute transport, the constant Kt is:
analogous to Km for an enzyme-catalyzed reaction.
Allosteric activators/effectors bind to enzymes
and stabilize the 'R-state', which has an enhanced substrate affinity.
Humoral immunity refers to that part of the immune response that is mediated by T lymphocytes. antibodies. antigens. the thymus. the skin.
antibodies.
The secondary structure shown below is an example of a(n):
antiparallel beta sheet.
Peripheral membrane proteins:
are generally noncovalently bound to membrane lipids.
Which drug is NOT lipid based?
aspirin
After hybridization, the fragment of interest can be detected by
autoradiography
What is the correct name for the linkage between these monosaccharide derivatives?
beta 1->4
Which compound can be cleaved in half to generate a molecule important in vision?
beta-carotene
a good transition-state analog:
bind to the enzyme more tightly than the substrate
In competitive inhibition, an inhibitor:
binds reversibly at the active site.
what is the standard solute used to measure void volume?
blue dextran
Describe the nature and relative strengths of covalent bonds, ionic interactions, and van der Waals forces
bond strength: covalent > ionic interactions > van der Waals forces (incl. hydrogen bonding > all other dipole-dipole > dipole-induced > LDFs)
Which of the following contains alpha-1,6-glycosidic bonds?
both amylopectin and glycogen
Humans make which omega-3 polyunsaturated fatty acid from alpha-linolenic acid (ALA)?
both eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA)
Chymotrypsin catalyzes the cleavage of proteins at peptide bonds adjacent to aromatic amino acid residues by using which catalytic mechanisms?
both general acid-base catalysis and covalent catalysis
Double stranded regions of RNA:
can form between two self-complementary regions of the same single strand of RNA.
What is formed when carbon dioxide reacts with the amino terminal group of deoxyhemoglobin?
carbamate
Prosthetic groups in the class of proteins known as glycoproteins are composed of:
carbohydrates
Conversion of CO2 in the blood into the more soluble form of HCO3- is catalyzed by which enzyme?
carbonic anhydrase
Sphingosine is NOT a component of:
cardiolipin
the reaction pathways that transform fuels into cellular energy are:
catabolic
Which of the following polysaccharides cannot be digested by mammalian salivary, gastric, or pancreatic enzymes?
cellulose
Which method is most useful when fractionating cellular organelles?
centrifugation
Which compound is NOT a glycerophospholipid?
ceramide
Fatty acids are a component of:
cerebrosides
The method that Sanger developed for DNA sequencing using dideoxy nucleotides is called the _____________ method
chain - terminator
The method that Sanger developed for DNA sequencing using dideoxy nucleotides is called the ______ method.
chain terminating
Bile acids are derived from which lipid?
cholesterol
The steroid hormones testosterone and beta-estradiol are derived from which lipid molecule?
cholesterol
Which types of signaling lipids are produced by platelets to aid in the formation of blood clots?
cholesterol
Which method would be best to use to monitor protein secondary structure during the titration of a denaturing agent?
circular dichroism
8. During the poly-A tail adding process, the RNA Pol II synthesizes RNA until it encounters a _____ sequence that leads to the cleavage of the RNA several nucleotides down stream.
cleavage signal .
Plasmids are small, circular DNA molecules that are used in
cloning
Plasmids are small, circular DNA molecules that are used in ______
cloning
The production of multiple identical organisms from a single ancestor is called ________.
cloning
What type of binding is indicated by a sigmoidal binding curve?
cooperative
Identify the molecule(s) derived from sterols.
cortisol
Which list correctly shows bond/interaction strength in decreasing order (strongest to weakest)?
covalent bond > ionic bond > hydrogen bond >van der Waals interactio
What is the name of the molecule composed of cytosine linked to ribose?
cytidine
In living organisms, genetic information is most often stored in the form of
deoxyribonucleic acid
Proteins often have regions that can fold and function as an independent entity from the whole protein. These regions are called:
domains
Alpha monomers have their anomerica hydroxyl go which way?
down
Facilitated diffusion through a biological membrane is:
driven by a difference of solute concentration.
Describe the fluid mosaic model
dynamic arrangement and interactions of membrane lipids (x-axis lateral diffusion) and proteins (also decorated with oligosaccharides with y-axis lateral diffusion)
Other functions of nucleotides
energy sources, regulatory molecules, coenzymes
A process not involving the fusion of two membranes or two regions of the same membrane is:
entry of glucose into cells.
The Km is:
equal to the substrate concentration when the reaction rate is half its maximal value.
Waxes are BEST described as:
esters of one long-chain fatty acid and one long-chain alcohol.
Biological waxes are all:
esters of single fatty acids with long-chain alcohols
Within the sequence of steps in the Perutz mechanism explaining Hb's cooperative binding of O2, listed following in no particular order, select the position in the order in which the step "Oxygen binds to deoxyhemoglobin" occurs: - His F8 is pulled towards the heme. - Residues at the - interfaces move, and ion pairs involving the C-terminal residues are broken. - Oxygen binds to deoxyhemoglobin. - Helix F tilts and is translated by about 1 Angstrom. - Fe(II) is pulled into the plane of the porphyrin. Entry field with correct answer second third fourth fifth first
first
If the half-life of a given reaction is constant (not dependent upon the initial conditions), the reaction must be:
first order
The type of motion least common in biological membranes is:
flip-flop diffusion of phospholipid from one monolayer to the other.
The peptide alanylglutamylglycylalanylleucine has:
four peptide bonds.
The experiments of Avery, Macleod, and McCarty in which nonvirulent bacteria were made virulent by transformation was significant because it showed that:
genes are composed of DNA only.
when the linear form of glucose cyclizes, the product is a:
hemiacetal
Explain the difference between a hemiacetal and a glycoside.
hemiacetal is formed when an aldose or ketose condenses with an alcohol; a glyco-side is formed when a hemiacetal condenses with an alcohol
Alcohols react with aldehydes to form
hemiacetals
Nucleoside triphosphates are useful for energy transfer because the phosphoanhydride bonds are relatively ______.
high energy
Nucleoside triphosphates are useful for energy transfer because the phosphoanhydrife bonds are relatively
high energy
Which of the following amino acids has the most significant role in the molecular mechanisms of hemoglobin's function? glycine tyrosine histidine lysine glutamate
histidine Histidine residues play several critical roles in hemoglobin function. For example, think of the proximal histidine, the distal histidine, and the histidine residues involved in the binding of 2,3-bisphosphoglycerate (BPG).
Why do only certain cells respond to hormones even though all cells in the body are exposed to the hormone?
hormones must bind to specific hormone receptors that vary in different types of cells in order for the cell to respond
Describe/draw a ribosome engaged in translation.
http://edugen.wileyplus.com/edugen/player/references/index.uni?xlinkobject=ucd1400500000000c03_guided_explorations-section-0001&xlinkdbfile=xlinks_db.xml
Draw a purine
https://commons.wikimedia.org/wiki/File:Purine.png
Draw a pyrimidine
https://en.wikipedia.org/wiki/Pyrimidinedione
Which compound is a heteropolysaccharide?
hyaluronate
While the binding of O2 to myoglobin as a function of pO2 is described by a simple __________ curve, the binding to hemoglobin is described by a more complex ______ curve. sigmoidal; hyperbolic hyperbolic; sigmoidal exponential; hyperbolic sigmoidal; bell-shaped hyperbolic; concave
hyperbolic; sigmoidal
In a mixture of the five proteins listed below, which should elute second in a size-exclusion (gel-filtration)chromatography?
immunoglobulin G (Mr = 145000)
What are examples of substances that can readily diffuse across biological membranes?
in general, only apolar substances ie. steroid hormones, fat-soluble vitamins K/A/D/E, and gases O2 and CO2
Irreversible enzyme inhibitors are also called:
inactivators.
Which health effect is NOT associated with consumption of trans fats?
increased joint flexibility due to additional membrane fluidity
The fluidity of a lipid bilayer will be increased by:
increasing the temperature.
Phospholipase C hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP2) to form which signaling molecule that triggers Ca2+ release from the endoplasmic reticulum?
inositol 1,4,5-triphosphate (IP3)
Explain the differences between integral and peripheral membrane proteins.
integral 6 types,alpha-helixes,span entire membrane peripheral loosely attached, associate w/ polar heads
In a plot of 1/V against 1/[S] for an enzyme-catalyzed reaction, the presence of a competitive inhibitor will alter the:
intercept on the 1/[S] axis
Eukaryotic genes often contain regions that are transcribed and later excised from the RNA, called
introns
proteins pass through the column in a manner
inversely related to their diameters
The rearrangement of T state hemoglobin to the R state occurs in each protein subunit independently when its heme binds oxygen. requires the binding of at least three oxygen molecules. increases the ion pairing interactions of the C-terminal amino acids. involves the movement of the Fe(II) into the heme plane. opens a central cavity for BPG binding.
involves the movement of the Fe(II) into the heme plane.
Which method can be used to visualize lipids that have been separated by thin-layer chromatography by reversibly reacting with double bonds in fatty acids?
iodine fumes
A genomic library...?
is a collection of cloned DNA fragments representing all of an organism's DNA.
Platelet-activating factor is much more water soluble than most other glycerophospholipids due to which feature?
its ester-linked acetic acid at the C-2 of glycerol
Explain the movement of proteins through the column
large proteins don't get trapped within the pores of the matrix, so they move through the mobile phase easily and quickly; smaller proteins enter the pores of the spongy bead matrix and are trapped, so take longer to move through the column
Proteins that bind specific carbohydrates are called ______.
lectins
Fab fragments can be generated by reduction of IgG molecules. oxidation of IgG molecules. limited digestion of IgG molecules with papain. combining two light chains. combining two heavy chains.
limited digestion of IgG molecules with papain.
Human adipocytes contain which enzyme that catalyzes the breakdown of triacylglycerols?
lipase
In an oxidation-reduction reaction, the oxidized reagent ____, and the reduced reagent ____.
loses electrons; gains electrons
Which factor is NOT a consequence of partial hydrogenation of vegetable oils?
lower melting temperature
3. ___: RNA molecule that specifies the amino acid sequence of a protein.
mRNA
How to determine molecular weight
make standard curve with Ve/Vo on x-axis and log of MW on y-axis (then you can use Ve/Vo to estimate MW)
Which of these is not an artificial sweetener
maltose
What is blue dextran?
massive polysaccharide (approx. weight is 2,000 kDa)
A BLANK of a solution of DNA is determined by measuring UV light absorption as a function of temperature
melting point
Integrins are:
membrane proteins that mediate cell adhesion.
Alterations in genetic information cannot be caused by
mistakes made during translation.
other names for GFC
molecular sieving, gel permeation chromatography, size exclusion chromatography, Sephadex chromatography
DNA is _____ chemicallystable than RNA due to the ___ on ____
more, 2' hydroxyl group; RNA
Spontaneous mutation of nucleotides - why doesn't DNA use Uracil as a base?
mostly due to the deamination of cytosine to uracil via hydrolysis-which releases ammonia. When thymine is used the cell can easily recognize that the uracil doesn't belong there and can repair it by substituting it by a cytosine again. The inability to repair such damage doesn't matter for RNA as the mRNA is comparatively short-lived and any potential errors don't lead to any lasting damage. It matters a lot for DNA as the errors are continued through every replication.
The double-reciprocal transformation of the Michaelis-Menten equation, also called the Lineweaver-Burk plot, is given by 1/V0 = Km /(Vmax[S]) + 1/Vmax. To determine Km from a double-reciprocal plot, you would:
multiply the reciprocal of the x-axis intercept by -1.
The energy needed to drive muscle contraction comes from ATP hydrolysis that is carried out by G-actin. F-actin. myosin heads. myosin tails. tropomyosin.
myosin heads.
During muscle contraction myosin pulls actin filaments toward the M disk. myosin pushes actin filaments toward the Z disk. actin pulls myosin toward the Z disk. actin pushes myosin toward the M disk. All of the answers above are correct.
myosin pulls actin filaments toward the M disk.
Noncooperative binding is characterized by a Hill coefficient of what value? Entry field with correct answer n = 0 n = 1 n > 1 0 < n < 1
n = 1
Amino acids without ionizable R groups can act as a zwitterion in a(n) _____ solution.
neutral
In high-performance liquid chromatography of lipid mixtures using a column packed with a silica gel, which types of lipids will elute first?
neutral lipids
Why is this statement false. Peripheral membrane proteins are generally covalently bound to membrane lipids
non-covalently attached
An enzyme had a Vmax of 45 umol min -1 in the absence of an inhibitor and 9.5 umol min -1 in the presence of an inhibitor. The Km was 1.1 x 10 -5 M regardless of the inhibitor. What type of inhibition is this?
noncompetitive
Fourth-order reactions
none of the above
Unlike proteins and oligonucleotides, polysaccharides
often have branched structures.
If you wanted to create specific DNA sequence changes to a plasmid in the coding sequence for a protein you are researching, but there are no suitably located restriction sites nearby, which technique would you use?
oligonucleotide-directed mutagenesis
When oxygen binds to a heme-containing protein, the two open coordination bonds of Fe2+ are occupied by:
one O2 molecule and one amino acid atom.
In hemoglobin, the transition from T state to R state (low to high affinity) is triggered by:
oxygen binding
How do you calculate pH from the concentration of H+ or OH-?
pH = -log[H+] = measure of acidity pOH = -log[OH-] = measure of alkalinity/basicity pH + pOH = 14
Commercial vegetable oils can be converted from liquid forms to solid forms and have their shelf lives increased due to which process?
partial hydrogenation
Distinguish between passive transport, facilitated transport and active transport
passive = apolar molecules, no energy, with gradient facilitated = small polar molecules, no energy, with gradient, through conduits/vehicles active = energy required; against gradient; protein pumps/transporters
Pauling and Corey's studies of the peptide bond showed that:
peptide bonds are essentially planar, with no rotation about the C-N axis.
A hydropathy plot is used to:
predict whether a given protein sequence contains membrane-spanning segments.
DNA polymerase requires a short stretch of RNA or DNA, called a
primer
Nonsteroidal anti-inflammatory drugs (NSAIDS) like aspirin and ibuprofen act by blocking production of:
prostaglandins
Name the building blocks of proteins, carbohydrates, and nucleic acids
proteins = amino acids; dominated by amino and carboxylate groups carbs = monosaccharides; dominated by hydroxyl and carbonyl groups nucleic acids = nitrogenous bases
The catalog of all proteins functioning in a cell is the:
proteome
A repeating structural unit in a multimeric protein is known as a(n):
protomer
A saccharide that has free aldehyde group is called a
reducing sugar
A saccharide that has free aldehyde group is called a(n) _____________.
reducing sugar
What are the biological effects of insulin and glucagon?
regulates blood glucose level @ 1mg/mL insulin is released to lower glucose levels, RTK receptor glucagon is released to raise glucose levels, GPCR receptor
Which event triggers a power stroke in myosin?
release of Pi
annealing
reversible denaturation
Examples of artificial sweeteners
saccharine, aspartame, acesulfame, alitame
The type of membrane transport that uses ion gradients as the energy source is:
secondary active transport.
Which type of structure refers to particularly stable arrangements of amino acid residues in a protein that give recurring patterns?
secondary structure
The structural classification of proteins (based on motifs) is primarily based on their:
secondary structure content and arrangement
RNA occurs primarily as single stranded molecules that can give rise to _______ structures.
stem-loop
Which nucleic acid provides the key to decoding genetic information?
tRNA
what does the peak tell you?
the elution volume
The formula K'eq=10^-delta G whatever indicates the relationship between:
the equillibrium constant and standard free energy.
in a double reciprocal plot of 1/V versus 1/[S] for an enzyme in the presence of increasing concentrations of an uncompetitive inhibitor will have lines corresponding to the different inhibitor concentration described by what:
the lines will cross the y-axis and will be parallel to each other
A patient you are treating appears to be deficient in citamin D. You have previously prescribed vit D but they do not appear to be working. which organs and/or tissues should you check to make sure that the enzymes they produce are functioning appropriately?
the liver and the kidneys
How does GFC differ from other forms of column chromatography?
the proteins never bind to the immobile phase (they are delayed by differing degrees as they pass through the column)
At substrate concentrations much lower than the enzyme concentration
the rate of reaction is expected to be directly proportional to substrate concentration
The repeating functional unit in a myofibril is called the A band. the I band. the sarcomere. the H zone. the M disk.
the sarcomere.
Cloning DNA is often necessary in order to sequence it because:
the small amounts of DNA available from most organisms cannot be easily sequenced
Void volume
the volume that lies outside the beads (also the volume of fluid needed to elute a solute that doesn't enter the gel pores at all)
Fatty acids in aqueous solution form micelles and not vesicles because: they are not amphipathic. they are too hydrophobic to form vesicles. their overall surface is cone shaped rather than cylindrical. they do form vesicles if there are no bile salts available.
their overall surface is cone shaped rather than cylindrical.
which commonality does NOT exist between peptides, nucleic acids, and poly- and oligosaccharides?
they all are synthesized from a template
Why is this statement false. The inner and outer membranes of mitochondria should have same protein compositions
they are asymetric
The value of n, the Hill constant (coefficient), for hemoglobin is about ______ as great as the value for myoglobin. half twice three times five times ten times
three times
O-linked oligosaccharides are commonly attached to the -OH group of
threonine
RNA Structural Diversity
through ability to form hairpins, loops, non-Watson-Crick base pairing
Which base does adenine base-pair (H-bond) with in DNA?
thymine
Genomic DNA is ______, resulting in the production of _________.
transcribed, mRNA
an enzyme that can convert glucose into glucose-6-phosphate is a member of which class of enzymes?
transferase
Specific hydrolysis of phosphatidylcholine can be achieved by which technique?
treatment of the lipid with both phospholipase C and mild acid
Which compound is NOT a type of membrane lipid?
triacylglycerolipid
Which pair of amino acids can be used to measure the concentration of proteins based on absorption of UV light?
tyrosine and tryptophan
In this type of inhibition, the inhibitor can only bind to the ES complex to form an ESI complex.
uncompetitive
Parallel lines on a Lineweaver-Burk plot are diagnostic of:
uncompetitive inhibition.
Carbon monoxide binds to heme: with a higher affinity than oxygen. resulting in the oxidation of the Fe(II) to Fe(III). in a manner that displaces carbon dioxide, causing CO2 poisoning. from the side opposite oxygen, resulting in a brown colored heme. with a lower affinity than oxygen.
with a higher affinity than oxygen.
The steroid hormones testosterone and beta-estradiol are derived from which lipid molecule? A) phosphatidylcholine B) cholesterol C) lipoxin A D) arachidonic acid E) geraniol
B) cholesterol
What feature do Tay-Sachs disease, Fabry disease, and Niemann-Pick disease have in common? A) defects in enzymes responsible for synthesizing membrane lipids B) defects in enzymes responsible for breaking down membrane lipids in the lysosomes C) hyperactive membrane lipid degradation enzymes D) defects in enzymes responsible for cholesterol synthesis E) All of the answers are correct.
B) defects in enzymes responsible for breaking down membrane lipids in the lysosomes
The biological role of restriction enzymes is to: A) aid recombinant DNA research. B) degrade foreign DNA that enters a bacterium. C) make bacteria resistant to antibiotics. D) restrict the damage to DNA by ultraviolet light. E) restrict the size of DNA in certain bacteria.
B) degrade foreign DNA that enters a bacterium.
The biological role of restriction enzymes is to: A) aid recombinant DNA research. B) degrade foreign DNA that enters a bacterium. C) make bacteria resistant to antibiotics. D) restrict the damage to DNA by ultraviolet light. E) restrict the size of DNA in certain bacteria.
B) degrade foreign DNA that enters a bacterium.
To make an DNA copy of a RNA sequence, you need the reverse transcriptase enzyme and an oligonucleotide primer made of which nucleotide? A) deoxyadenosine B) deoxythymine C) deoxycytosine D) deoxyuridine E) deoxyguanosine
B) deoxythymine
Which statement is TRUE about fatty acids?
Fatty acids with longer chains have higher melting points and lower solubility in water.
Which statement is true about fatty acids?
Fatty acids with longer chains have higher melting points and lower solubility in water.
In order to perform PCR, which of the following describes the reagents that must be included in the reaction mixture?
DNA fragment, primers flanking the region of interest, dNTPs, DNA polymerase
In order to perform PCR, which reagents must be included in the reaction mixture?
DNA fragment, primers flanking the region of interest, dNTPs, DNA polymerase
The glycosaminoglycans are negatively charged at neutral pH. What components of these polymers confer the negative charge?
Uronic acids such as glucuronic acid, and sulfated hydroxyl groups, such as GalNAc4SO3- and GlcNAc6SO3-. (See Fig. 7-22, p. 250.)
In molecular cloning, transformed organisms must be identified. One common method for accomplishing this involves the inclusion of ________ in the plasmid.
an antibiotic resistance gene
Which type of chemical linkage is used to join fatty acids to glycerol?
an ester linkage
A new drug has been discovered which inhibits the reaction catalyzed by enzyme A. Based on the information shown below what it this drug?
competitive inhibitor
Describe condensation and hydrolysis reactions
condensation = two functional groups (commonly carboxylate and amino) combine to form a larger molecule usually resulting in the loss of water; basis of polymerization of amino acids into polypeptide hydrolysis = cleavage of a chemical bond to split up larger molecules into constituents, with the addition of water; ie. ATP hydrolysis releases free energy
The major reason that antiparallel beta stranded protein structures are more stable than parallel beta stranded structures is that the latter?
have weaker hydrogen bonds laterally between adjacent strands
phenyl-methane-sulfonyl-fluoride (PMSF) inactivates serine proteases by binding covalently to the catalytic serine residue at the active site; this enzyme-inhibitor bond is not cleaved by the enzyme. This is an example of what kind of inhibition?
irreversible
What is a nucleotide?
phosphate group, 5 -carbon sugar, and a nitrogenous base --AMP (adenosine monophosphate)
Which glycerophospholipid has a net charge of zero at pH 7?
phosphatidylcholine
Which lipid compound is NOT at least partially made from the condensation of isoprene units?
phosphatidylinositol
Nucleoside triphosphates carry energy in the form of
phosphoanhydride bonds
Nucleoside triphosphates carry energy in the form of...?
phosphoanhydride bonds --they are relatively high energy
Nucleic acids are composed of nucleotides that are linked by _________ linkages
phosphodiester
Nucleic acids are composed of nucleotides that are linked by what kind of linkages?
phosphodiester
Nucleotides in a DNA molecule are linked together through
phosphodiester bonds
Nucleotides in a DNA molecule are linked together through..?
phosphodiester bonds.
Covalent bonds that link the individual nucleotide residues in DNA and RNA
phosphodiester linkages
What kind of columns are used?
"full-sized" columns, the longer the column, the better separation (resolution)
Small circular DNA molecules used to carry foreign DNA are called ________.
) plasmids
The Hill plot shows that the fourth oxygen binds to hemoglobin with a ______-fold greater affinity than the first. 2 5 10 20 100
100
What is the volume of each fraction?
2 mL
Humans typically recycle approximately _____ of ATP each day.
50kg
Tay-Sachs disease is the result of a genetic defect in the metabolism of: A) gangliosides. B) phosphatidyl ethanolamine. C) sterols. D) triacylglycerols. E) vitamin D.
A
A good expression vector for protein expression in E. coli should have which feature(s)?
All of the answers are correct
What is a hydropathy plot? Sketch if you like, but label the axes.
Ans: A hydropathy plot is a graphical representation of the average "hydropathy" values (tendancy to prefer organic solvents over water) of contiguous groups of amino acid R-groups in a protein. Long hydrophobic sequences are characteristic of integral membrane proteins. Y-axis: "hydropathy index," values between +3 and -3. X-axis: residue number, values between 0 and total number of aa's in the protein.
Match each of these vitamins with its biological role: Vitamins A, D, E, K. ____ blood clotting ____ vision ____ Ca2+ and phosphate metabolism ____ prevention of oxidative damage
Ans: K; A; D; E
What are the principle features of the fluid mosaic model of membranes?
Ans: The principle features of the fluid mosaic model of membranes include: (1) a lipid bilayer in which individual lipids are free to move laterally but not across the bilayer; (2) integral membrane proteins, which penetrate or span the bilayer, associating with lipid acyl chains by hydrophobic interactions and exhibiting lateral mobility; (3) peripheral membrane proteins, which associate noncovalently with the lipid head groups and protruding domains of integral membrane proteins, and which are sometimes tethered to the membrane by a covalent lipid anchor.
Show the structure of isoprene; explain what is meant by isoprenoid compounds and give an example.
Ans: The structure is shown on page 361. Isoprenoid compounds contain chains that consist of multiple isoprene units. (See Fig. 10-22, p. 362, for examples.)
Describe the differences between the glycosphingolipids corresponding to the A, B and O human blood group antigens.
Ans: The type O structure is found in all three glycosphingolipids. In both type A and type B, there is an added sugar; this sugar differs between type A and B.
Describe two ways a plant can adjust the components of its cell membranes to keep them as fluid as possible on a cold winter morning.
Ans: To compensate for the solidifying effect of low temperature on membrane lipids, it can synthesize and place in the membrane (1) a greater proportion of unsaturated fatty acids and (2) shorter-chain fatty acids. Both increase the fluidity of the lipid bilayer.
Double stranded regions of RNA typically take on a(n): A) A-form left-handed helix. B) A-form right-handed helix. C) B-form left-handed helix. D) B-form right-handed helix. E) Z-form left-handed helix.
B
Fatty acids are a component of: A) carotenes. B) cerebrosides. C) sterols. D) vitamin D. E) vitamin K.
B
Fatty acids are a component of: A) carotenes. B) cerebrosides. C) sterols. D) vitamin D. E) vitamin K.
B
Fatty acids are attached to sphingosine by what type of chemical linkage? A) an ether linkage B) an amide linkage C) an ester linkage D) a peroxide linkage E) a alkyl linkage
B
For the process of solute transport, the constant Kt is: A) analogous to Ka for ionization of a weak acid. B) analogous to Km for an enzyme-catalyzed reaction. C) analogous to Vmax for an enzyme reaction D) proportional to the number of molecules of glucose transporter per cell. E) the maximum rate of glucose transport.
B
Non-steroidal anti-inflammatory drugs (NSAIDS) like aspirin and ibuprofen act by blocking production of: A) biological waxes B) prostaglandins C) sphingolipids D) vitamin D E) none of the above
B
The experiment of Avery, MacLeod, and McCarty in which nonvirulent bacteria were made virulent by transformation was significant because it showed that: A) bacteria can undergo transformation. B) genes are composed of DNA only. C) mice are more susceptible to pneumonia than are humans. D) pneumonia can be cured by transformation. E) virulence is determine genetically.
B
Which compound can be cleaved in half to generate a molecule important in vision? A) calcitol B) beta-carotene C) arachidonic acid D) tocopherol E) isoprene
B
Which factor is NOT a consequence of partial hydrogenation of vegetable oils? A) longer shelf life B) lower melting temperature C) reduction of some cis double bonds to single bonds D) conversion of some cis double bonds to trans double bonds E) increased risk of cardiovascular disease upon consumption by humans
B
Which molecule is MOST commonly used as a backbone the linkage of three fatty acids to form fats? A) glycogen B) glycerol C) sphingosine D) glucose E) phosphoglycerol
B
Which of the following is not true of sterols? A) Cholesterol is a sterol that is commonly found in mammals. B) They are commonly found in bacterial membranes. C) They are more common in plasma membranes than in intracellular membranes (mitochondria, lysosomes, etc.). D) They are precursors of steroid hormones. E) They have a structure that includes four fused rings.
B
Which solvent is NOT used to dissolve lipids? A) ethyl ether B) water C) benzene D) methanol E) chloroform
B
Which of the following metabolic processes can occur without a net influx of energy from some other process? (A) ADP + Pi => ATP + H2O (B) C6H12O6 + 6 O2 > 6 CO2 + 6 H2O (C) 6 CO2 + 6 H2O => C6H12O6 + 6 O2 (D) Amino acids => Protein
B REASON:
The shortest a helix segment in a protein that will span a membrane bilayer has about _____ amino acid residues. A) 5 B) 20 C) 50 D) 100 E) 200
B) 20
In one catalytic cycle, the Na+/K+ ATPase transporter transports: A) 2 Na+ out, 3 K+ in, and converts 1 ATP to ADP + Pi. B) 3 Na+ out, 2 K+ in, and converts 1 ATP to ADP + Pi. C) 3 Na+ in, 2 K+ out, and converts 1 ATP to ADP + Pi. D) 1 Na+ out, 1 K+ in, and converts 1 ATP to ADP + Pi. E) 2 Na+ out, 3 K+ in, and converts 1 ADP + Pi to ATP.
B) 3 Na+ out, 2 K+ in, and converts 1 ATP to ADP + Pi.
Which statement about caveolin is FALSE? A) Caveolin is an integral membrane protein. B) Caveolin induces outward membrane curvature. C) Caveolin is palmitoylated. D) Caveolin associates with cholesterol rich regions. E) Caveolin is involved in membrane trafficking and cellular signaling.
B) Caveolin induces outward membrane curvature.
Which statement is NOT true? A) Phospholipase A1 hydrolyzes the fatty acid from the 1-position on the glycerol backbone. B) Phospholipase B1 hydrolyzes the fatty acid from the 2-position on the glycerol backbone. C) Phospholipase C hydrolyzes the complete phospho-head group from the glycerol backbone. D) Phospholipase D hydrolyzes just the head group from the phospho-glycerol backbone.
B) Phospholipase B1 hydrolyzes the fatty acid from the 2-position on the glycerol backbone.
What common protein tertiary structure does green fluorescent protein contain? A) an a helix B) a B barrel C) a coiled coil D) a Greek key E) a four-helix bundle
B) a B barrel
In nucleotides and nucleic acids, syn and anti conformations relate to: A) base stereoisomers. B) rotation around the phosphodiester bond. C) rotation around the sugar-base bond. D) sugar pucker. E) sugar stereoisomers.
C
The 5′ → 3′ orientation of a DNA or RNA chain refers to the: A) linkage of the phosphodiester bonds between the nucleotides. B) location of the attachment of the nitrogenous base on the pentose sugar. C) positions of the chain that do not have a nucleotide attached. D) positions of the chain that do not have a phosphate group attached. E) respective net charges found at each end of the chain.
C
The chemical moiety of nucleotides that allows quantification of concentration via UV absorbance is the: A) phosphate group(s). B) pentose sugar. C) nitrogenous base. D) hydroxyl group(s) on the pentose sugar. E) None of the answers is correct.
C
Which of these is not an artificial sweetener? A) saccharine B) aspartame C) maltose D) acesulfame E) alitame
C
Which solvent is a commonly used to extract all the lipids from homogenized tissue samples and subsequent separation of the lipids from the proteins and sugars present in those samples? A) ethanol B) benzene C) a mixture of chloroform, methanol, and water D) water E) a mixture of chloroform and benzene
C
Which vitamin is NOT fat soluble?
C
Which vitamin is derived from cholesterol? A) A B) B12 C) D D) E E) K
C
Which vitamin is derived from cholesterol? A) A B) B12 C) D D) E E) K
C
You are working in a laboratory trying to design a drug that specifically binds to the surface of certain cells. To which membrane lipid constituents should your drug bind in order to achieve this specificity? A) sphingomyelins B) phosphatidylcholines C) gangliosides D) triacylglycerols E) sterols
C
The energy for an endergonic reaction comes from a(n) _____ reaction. (A) synthesis (B) glucose + glucose --> maltose (C) exergonic (D) anabolic (E) ADP + P --> ATP
C REASON: The energy released by an exergonic reaction can be used to drive an endergonic reaction.
Which of the following sugars is not a reducing sugar? A) glucose B) ribose C) sucrose D) starch E) galactose
C - Sucrose
The bonding of alcohols to the anomeric center of a carbohydrate results in the formation of a(n) __________ bond. A) anomeric B) amide C) glycosidic D) ester E) hydrogen
C - glycosidic
What is the abbreviated nomenclature for octadecanoic acid with two double bonds? A) 16:1 B) 14:2 C) 18:2 D) 18:0 E) 18:1
C) 18:2
Current estimates indicate that humans have about ________ genes. A) 3,000 B) 10,000 C) 30,000 D) 100,000 E) 300,000
C) 30,000
12. How many stereoisomers are possible for an aldopentose such as ribose? A) 2 B) 4 C) 8 D) 16 E) 32
C) 8
Which list ranks the organisms in order from smallest genome (number of base pairs of DNA) to largest genome? A) Human, fruit fly, E. coli bacterium B) E. coli bacterium, human, fruit fly C) E. coli bacterium, fruit fly, human D) fruit fly, E. coli bacterium, human E) fruit fly, human, E. coli bacterium
C) E. coli bacterium, fruit fly, human
51. Cellulose is A) a linear copolymer of glucose and galactose. B) a branched polymer of glucose. C) a linear polymer of glucose with β(1→4) linkages. D) a linear polymer of glucose with α(1→4) linkages. E) sometimes called starch.
C) a linear polymer of glucose with β(1→4) linkages.
Which solvent is a commonly used to extract all the lipids from homogenized tissue samples and subsequent separation of the lipids from the proteins and sugars present in those samples? A) ethanol B) benzene C) a mixture of chloroform, methanol, and water D) water E) a mixture of chloroform and benzene
C) a mixture of chloroform, methanol, and water
You have discovered a protein that transports Ca2+ up a concentration gradient, from the cytoplasm into the endoplasmic reticulum. No other ions move during this transport. What type of transport protein does this appear to be? A) a Ca2+ channel B) a Ca2+ ion porin C) a primary active uniporter D) a secondary active uniporter E) an ionophore
C) a primary active uniporter
You are working in a laboratory trying to design a drug that specifically binds to the surface of certain cells. To which membrane lipid constituents should your drug bind in order to achieve this specificity? A) sphingomyelins B) phosphatidylcholines C) gangliosides D) triacylglycerols E) sterols
C) gangliosides
In genetic engineering, in vitro packaging is used to: A) cut a desired region out of the host bacterium's chromosome. B) ensure that genetically engineered bacteria are not accidentally released into the environment. C) incorporate recombinant DNA into infectious bacteriophage particles. D) place an antibiotic resistance gene in a plasmid. E) splice a desired gene into a plasmid.
C) incorporate recombinant DNA into infectious bacteriophage particles.
Certain restriction enzymes produce cohesive (sticky) ends. This means that they: A) cut both DNA strands at the same base pair. B) cut in regions of high GC content, leaving ends that can form more hydrogen bonds than ends of high AT content. C) make a staggered double-strand cut, leaving ends with a few nucleotides of single-stranded DNA protruding. D) make ends that can anneal to cohesive ends generated by any other restriction enzyme. E) stick tightly to the ends of the DNA they have cut.
C) make a staggered double-strand cut, leaving ends with a few nucleotides of single-stranded DNA protruding.
57. Bacterial cell walls are composed of _____. A) pectin B) chondroitin sulfate chains C) peptidoglycans D) heparin E) proteoglycans
C) peptidoglycans
41. A saccharide that has free aldehyde group is called a(n) _____________. A) ketose B) nonreducing sugar C) reducing sugar D) aldohexose E) alditol
C) reducing sugar
34. Which of the following sugars is not a reducing sugar? A) glucose B) ribose C) sucrose D) starch E) galactose
C) sucrose
The alkaline hydrolysis of RNA does NOT produce: A) 2'- AMP. B) 2',3'-cGMP. C) 2'-CMP. D) 3',5'-cAMP. E) 3'-UMP.
D
The alkaline hydrolysis of RNA does not produce: A) 2'- AMP. B) 2',3'-cGMP. C) 2'-CMP. D) 3',5'-cAMP. E) 3'-UMP
D
The double helix of DNA in the B-form is stabilized by: A) covalent bonds between the 3' end of one strand and the 5' end of the other. B) hydrogen bonding between the phosphate groups of two side-by-side strands. C) hydrogen bonds between the riboses of each strand. D) nonspecific base-stacking interaction between two adjacent bases in the same strand. E) ribose interactions with the planar base pairs.
D
What is the only monosaccharide that is achiral? A) glyceraldehyde B) ribose C) galactose D) dihydroxyacetone E) fructose
D
Which of the following statements applies to all artificial sweeteners? A) Artificial sweeteners cannot be readily metabolized. B) Artificial sweeteners are peptides and provide important amino acids. C) Artificial sweeteners have fewer calories than sucrose. D) Artificial sweeteners are much sweeter than sucrose. E) all of the above
D
Which of the following would be positively charged at physiological pH? A) glucuronic acid B) fructose-6-phosphate C) xylitol D) glucosamine E) all of the above
D
Why are hydropathy plots NOT usually used to detect transmembrane b strands in porins? A) The length of a transmembrane b strand is typically shorter than that of an a helix. B) Amino acids in transmembrane b strands in porins may not be exclusively hydrophobic. C) Amino acid side chains project away from the polypeptide in a b sheet D) Answers A and B are both correct. E) All of the answers are correct.
D) Answers A and B are both correct. (the length of transmembrane b amino acid side chains project)
If you want to clone a gene by using E. coli and then transfer that cloned gene into yeast to express the protein the gene encodes, what type of self-replicating DNA should you use for your cloning process? A) a bacmid B) a plasmid C) a yeast artificial chromosome D) a shuttle vector E) a bacterial artificial chromosome
D) a shuttle vector
If you wanted to clone a large fragment of DNA into a unicellular eukaryotic host, what would you use? A) a bacmid B) a plasmid C) a bacterial artificial chromosome D) a yeast artificial chromosome E) a virus
D) a yeast artificial chromosome
Humans make which omega-3 polyunsaturated fatty acid from alpha-linolenic acid (ALA)? A) eicosapentaenoic acid (EPA) B) arachidonic acid (ARA) C) docosahexaenoic acid (DHA) D) both eicosapentaenoic acid (EPA) and arachidonic acid (ARA) E) both eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA)
E
Identify the molecule(s) derived from sterols. A) Arachidonic acid B) Gangliosides C) Phosphatidylglycerol D) Prostaglandins E) Vitamin D
E
Which compound is NOT a glycerophospholipid? A) phosphatidylcholine B) phosphatidylethanolamine C) phosphatidylserine D) cardiolipin E) ceramide
E) ceramide
Overproduction of which types of signaling lipids causes asthmatic attacks? A) prostaglandins B) thromboxanes C) arachidonates D) lipoxins E) leukotrienes
E) leukotrienes
The conjugate base of H2PO4- is:
HPO42-
What typer of binding curve is represented by oxygen binding to Myoglobin?
Hyperbolic curve
The disaccharide commonly found in dairy products is ___
Lactose
Yes, because Rh antibody could have been shared from 1st child and would attack 2nd child's immune system
Mrs. Chase is pregnant for the second time. Her first child's birth was normal and uneventful and she has no significant medical history except for the fact she was out of the country during the birth of her first child. As part of her pre-natal exam, a blood screen was done on Mrs. Chase, her husband, and her first child. The results of the blood type screen show Mrs. Chase if A-, Mr. Chase is B+, and their first child is B+. If Mrs. Chase's second child was Rh positive, would it be at risk for hemolytic disease of the newborn (HDN)? Why?
All blood types aka universal recipient
Mrs. Jones, a 24-year-old female, and her husband, Mr. Jones, a 30-year-old male, were in a car accident. Mrs. Jones has lost about a liter of blood on the scene. She is taken into emergency surgery and requires blood. Her blood type screening revealed she is AB+ Which blood types she is able to accept.
Explain how it is possible that a polysaccharide molecule, such as glycogen, may have only one reducing end, and yet have many nonreducing ends.
The molecule is branched, with each branch ending in a nonreducing end. (See Fig. 7-14c, p. 5.)
What are the principle features of the fluid mosaic model of membranes?
The principle features of the fluid mosaic model of membranes include: (1) a lipid bilayer in which individual lipids are free to move laterally but not across the bilayer; (2) integral membrane proteins, which penetrate or span the bilayer, associating with lipid acyl chains by hydrophobic interactions and exhibiting lateral mobility; (3) peripheral membrane proteins, which associate noncovalently with the lipid head groups and protruding domains of integral membrane proteins, and which are sometimes tethered to the membrane by a covalent lipid anchor.
In DNA sequencing by the Sanger (dideoxy)method:
The role of dideoxy CTP is to occasionally terminate enzymatic synthesis of DNA where Gs occur in the template strands.
Explain in molecular terms why humans cannot use cellulose as a nutrient, but goats and cattle can.
The ruminant animals have in their rumens microorganisms that produce the enzyme cellulase, which splits the (beta1 --> 4) linkages in cellulose, releasing glucose. Humans do not produce an enzyme with this activity; the human digestive enzyme alpha-amylase can split only (alpha1 --> 4) linkages (such as those in glycogen and starch).
The dideoxy method of DNA sequencing uses modified nucleotides lacking an OH at C-3'
True
Which one of the following statements about membranes is true? A) Most plasma membranes contain more than 70% proteins. B) Sterol lipids are common in bacterial plasma membranes. C) Sterol lipids are common in human cell plasma membranes. D) Sterol lipids are common in plant cell plasma membranes. E) The plasma membranes of all cell types within a particular organism have basically the same lipid and protein composition.
Which one of the following statements about membranes is true? C) Sterol lipids are common in human cell plasma membranes.
The energy that is released by the hydrolysis of ATP by actin is used for:
actin filament assembly
Treadmilling refers to myosin heads walking along actin microfilaments. actin and myosin filaments sliding along each other. actin monomers moving through a microfilament from the (+) end to the (-) end. synthesis and degradation of actin monomers. the interactions between actin and tropomyosin
actin monomers moving through a microfilament from the (+) end to the (-) end.
What are the names of the bases that are found in DNA?
adenine cytosine guanine thymine
The compound that consists of ribose linked by an N-glycosidic bond to N-9 of adenine is:
adenosine
which pair is interconverted in the process of mutarotation?
alpha-D-Glucose and beta-D-glucose
Which of the following correctly matches the amino acid name with its one letter abbreviation?
aspartic acid, D
After hybridization, the fragment of interest can be detected by ______
autoradiography
A genomic library
contains all of an organism's DNA
Which proteins will exit the column more quickly?
larger proteins
Beta monomers have their anomeric hydroxyl go which way?
up
What does a more negative free energy change mean?
* A more negative free energy change means that the reaction will go strongly in the direction of: Y -> X
antibody
- something your body produces to fight glycoproteins that aren't yours - attach to antigens
A DNA features
-shorter and wider than the B form with the bases at an angle rather than perpendicular to the helix axis. -seen in RNA double helices and in RNA-DNA hybrid helices, structures observed in transcription and RNA processing.
When the partial pressure of O2 in venous blood is 30 torr, the saturation of myoglobin with O2 is ______ while the saturation of hemoglobin with O2 is ______. 0.55, 0.91 0.91, 0.55 2.8 torr, 26 torr 0.91, 0.97 none of the above
0.91, 0.55
What are the first and second laws of thermodynamics?
1) Energy is neither created nor destroyed, only conserved/exchanged; expressed as deltaU = q - w 2) Natural processes are spontaneous (deltaS > 0) leading to an increase in disorder/entropy; expressed as deltaSuni = deltaSsys + deltaSsur > 0
Five Km values are given for the binding of substrates to a particular enzyme. Which has the strongest affinity when k-1 is greater than k-2?
1.5 nM
The Hill plot shows that the fourth oxygen binds to hemoglobin with a ______-fold greater affinity than the first. A) 2 B) 5 C) 10 D) 20 E) 100
100
What is the abbreviated nomenclature for a 14-carbon omega-3 fatty acid that contains no other double bonds?
14:1(11)
What is the abbreviated nomenclature for a 14-carbon omega-3 fatty acid that contains no other double bonds?
14:1(Delta 11)
For an enzyme that follows simple Michaelis-Menten kinetics, what is the value of Vmax if Vo is equal to 3 umol at 0.2 Km?
18 umol minute -1
What is the abbreviated nomenclature for octadecanoic acid with two double bonds?
18:2
A double stranded DNA fragment contains 12% adenine residues. Calculate the percentage cytosine residues
38%
A double stranded DNA fragment contains 12% adenine residues. Calculate the percentage cytosine residues.
38%
How many stereoisomers are possible for a ketopentose, ribulose?
4
Radioactively labeled, single-stranded oligonucleotides are often used in in situ hybridization. Which probe would work best, when probing for a RNA molecule containing the sequence 5'-AGCTAACGGG-3'?
5'-CCCGTTAGCT-3'
Humans typically recycle approximately _____ of ATP each day.
50 kg
How many stereoisomers are possible for an aldopentose such as ribose?
8
Find Kcat for a reaction in which Vmax is 4 *10^-4 mol*min-1 and the reaction mixture contains one microgram of enzyme (The molecular weight of the enzyme is 200,000 D)
8 * 10^7 min-1
Sphingosine is NOT a component of: A) cardiolipin. B) ceramide. C) cerebrosides. D) gangliosides. E) sphingomyelin.
A
Which statement concerning fatty acids is CORRECT?
A fatty acid is the precursor of prostaglandins.
What is a hydropathy plot? Sketch if you like, but label the axes.
A hydropathy plot is a graphical representation of the average "hydropathy" values (tendancy to prefer organic solvents over water) of contiguous groups of amino acid R-groups in a protein. Long hydrophobic sequences are characteristic of integral membrane proteins. Y-axis: "hydropathy index," values between +3 and -3. X-axis: residue number, values between 0 and total number of aa's in the protein.
A process not involving the fusion of two membranes or two regions of the same membrane is: A) endocytosis. B) entry of enveloped viruses into cells. C) entry of glucose into cells. D) exocytosis. E) reproductive budding in yeast
A process not involving the fusion of two membranes or two regions of the same membrane is: C) entry of glucose into cells.
Which of the following best describes the cholesterol molecule?
A) Amphipathic B) Nonpolar, charged C) Nonpolar, uncharged D) Polar, charged E) Polar, uncharged A
The site on an enzyme where the reaction that is catalyzed by the enzyme occurs is the _____.
Active Site
Which of the statements about muscle contraction is correct? During muscle contraction the sarcomere becomes shorter. During muscle contraction the I band becomes shorter. During muscle contraction the H zone becomes shorter. During muscle contraction the distance between the Z disk and the M disk becomes shorter. All of the answers above are correct.
All of the answers above are correct.
The E + S --> E + P reaction is
Bimolecular
The Circe effect enhances what aspect of enzyme catalysis?
Binding of substrate
45. Which of these is not an artificial sweetener? A) saccharine B) aspartame C) maltose D) acesulfame E) alitame
C) maltose
Which four elements occur virtually in all biological molecules?
C,H,O,N - carbon, hydrogen, oxygen, nitrogen
How is muscle contraction stimulated by calcium ions? Calcium ions are released from the sarcoplasmic reticulum and bind to actin, promoting its binding to myosin. Calcium ions are released from the sarcoplasmic reticulum and bind to tropomyosin, stimulating its ATPase activity. Calcium ions are released from the sarcoplasmic reticulum and bind to myosin, stimulating ATPase activity. Calcium ions are released from the sarcoplasmic reticulum and bind to troponin C, promoting the binding of myosin to actin
Calcium ions are released from the sarcoplasmic reticulum and bind to troponin C, promoting the binding of myosin to actin
Which protein forms a complex with a guide RNA to target DNA for cleavage and destruction?
Cas9
Which vitamin is derived from cholesterol?
D
Which of these polysaccharides is a branched polymer? A) chitin B) amylose C) cellulose D) amylopectin E) hyaluronic acid
D - amylopectin
The PCR reaction mixture does NOT include:
DNA ligase
A major component of RNA but not of DNA is: A) adenine. B) cytosine. C) guanine. D) thymine. E) uracil.
E
A major component of RNA but not of DNA is: A) adenine. B) cytosine. C) guanine. D) thymine. E) uracil
E
One of the MOST common regulatory second messengers in cells is: A) FAD. B) NAD+. C) coenzyme A. D) ATP. E) cAMP.
E
In the laboratory, recombinant plasmids are commonly introduced into bacterial cells by: A) electrophoresis - a gentle low-voltage gradient draws the DNA into the cell. B) infection with a bacteriophage that carries the plasmid. C) microinjection. D) mixing plasmids with an extract of broken cells. E) transformation - heat shock of the cells incubated with plasmid DNA in the presence of CaCl2.
E) transformation - heat shock of the cells incubated with plasmid DNA in the presence of CaCl2.
Which compound is NOT a type of membrane lipid? A) sphingolipid B) glycerophospholipid C) sulfolipid D) sterol E) triacylglycerolipid
E) triacylglycerolipid
RFLP is a: A) bacteriophage vector for cloning DNA. B) genetic disease. C) plasmid vector for cloning DNA. D) protein. E) variation in DNA base sequence.
E) variation in DNA base sequence.
A(n) _____ requires an input of energy to proceed.
Endergonic reaction
Facilitated diffusion through a biological membrane is: A) driven by a difference of solute concentration. B) driven by ATP. C) endergonic. D) generally irreversible. E) not specific with respect to the substrate
Facilitated diffusion through a biological membrane is: A) driven by a difference of solute concentration.
All the monosaccharide units have OH at C-2'
False
Phosphate groups project towards the middle of the double helix
False
DNA with a high G+C content will have a lower melting temperature than DNA with a high A+T content
False-G-C has higher melting point..more H+ bonding
Select the statement that best matches the following: Fab fragments Antibodies produced by hybridoma cells. Diverse group of proteins also known as antibodies. Fragments of proteolyzed IgG that have antigen-binding sites. Cells that mediate cellular immunity. Cells that mediate humoral immunity.
Fragments of proteolyzed IgG that have antigen-binding sites.
Asked about cyclic conformation of an aldehyde such as mannose, would be -hemiacetal -hemiketal -replacement of aldehyde with carboxylic acid -oxidation of aldehyde
Hemiacetal
Which of the following statements is correct concerning the difference between hemoglobin and myoglobin?
Hemoglobin exhibits cooperative binding of O2 while myoglobin does not.
Which statement comparing hemoglobin and myoglobin is NOT correct?
Hemoglobin has a stronger binding affinity for O2 that myoglobin does.
Which of the following diseases is not caused by a mutation in hemoglobin? Polycythemia Sickle-cell anemia Hemolytic anemia Hemophilia
Hemophilia
___ is a heteropolymer composed of D-glucoronate and N-acetly-D-glucosamine that acts as shock absorber and lubricant
Hyaluronic Acid
Which statement about hydrogen bonds is NOT true?
Hydrogen bonds are strongest when the oxygen atom is perpendicular to the hydrogen donor.
The Michaelis constant Km is defined as
I I = (K-1 + K2) / K1
Phospholipase C hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP2) to form which signalling molecule that triggers Ca2+ release from the endoplasmic reticulum?
IP3
What term is used to describe the dynamic recognition of the substrate when binding to an enzyme occurs?
Induced fit
Explain the differences between integral and peripheral membrane proteins.
Integral membrane proteins are very firmly associated with the membrane; their hydrophobic domains are associated with the fatty acyl groups in the interior in hydrophobic interactions. Peripheral membrane proteins are more loosely associated and usually do not penetrate the hydrophobic interior of the bilayer. Conditions that reduce ionic interactions and hydrogen bonds commonly release them.
The Km can be considered to be the same as the dissociation constant Ks for E + S binding is
K2 << K-1
An enzyme is near maximum efficiency when
Kcat/Km is near 10^8 M-1s-1
What are lectins? What are some biological processes which involve lectins?
Lectins are proteins that bind to specific oligosaccharides. They interact with specific cell-surface glycoproteins thus mediating cell-cell recognition and adhesion. Several microbial toxins and viral capsid proteins, which interact with cell surface receptors, are lectins.
Which statement BEST describes why lipids typically float on water?
Lipids have lower specific gravities than water does.
Inside our cells, free nucleotides are almost always associated with ______.
Mg2+ counterions --because free nucleotides are anionic
What are the similarities and differences between carriers, channels, and transporters involved in facilitated transport?
No energy required, entropically favored by electrochemical gradient, hydrophillic
Cells that become infected by pathogens will present antigens on their surface. Antigens are proteins from pathogens the infected cell has degraded. This presentation occurs via a cell structure called the major histocompatibility complex (MHC). MHC is a transmembrane protein that presents the antigen to T-cells, telling the T-cell to kill the infected cell. What kinds of amino acids would you expect to find in the MHC molecule where it spans the cell membrane? Non-polar amino acids Polar amino acids Negatively charge amino acids positively charged amino acids
Non-polar amino acids
Pseudo-first-order reaction kinetics would be observed for the reaction A + B --> C
None of the above
A common type of covalent modification of regulatory enzymes involves ______ of serine
Phosphorylation
_____ contain(s) an ether-linked alkyl group.
Platelet-activating factor
2. __ : Nucleotides sequence in DNA to which RNA polymerase binds to begin transcription.
Promoter
Which of the following is correct concerning the oxygenation plot of proteins X and Y shown below?
Protein Y would function as a better oxygen transport protein than protein X.
Most known enzymes are proteins; however, some ___________ molecules have been shown to possess catalytic activity.
RNA
Multiple substrate enzyme reactions are divided into two classes which are called
Sequential displacement and double displacement.
7. Most of mRNA Introns are removed via a large protein-RNA complex called a ____
Spliceosome
DELTA (G) REACTION EXAMPLE:
Take for example the simple reaction of: * X-->Y The following equation relates DELTA (G) to the CONCENTRATION of the REACTANTS: *DELTA (G) = DELTA (G) PRIME + RT ln [(X)/(Y)]
Why must the systematic name of an oligosaccharide include more than just the component monosaccharides?
The name must include the location and stereochemistry of the links because that can distinguish different polymers made up of the same units, ie. starch and cellulose
The phosphodiester bond that joins adjacent nucleotides in DNA: A) associates ionically with metal ions, polyamines, and proteins. B) is positively charged. C) is susceptible to alkaline hydrolysis. D) Links C-2 of one base to C-3 of the next. E) links C-3 of deoxyribose to N-1 of thymine or cytosine
The phosphodiester bond that joins adjacent nucleotides in DNA: A) associates ionically with metal ions, polyamines, and proteins.
The gel below illustrates the purification of the RecA protein from E. coli. This gel was loaded from the top. Which statement best describes how proteins "run" in an SDS gel?
The proteins are separated primarily by molecular weight: the smallest MW proteins are on the bottom, and the largest are on the top.
If hemoglobin is in the 'T' state, what is the first component of the peptide chain that moves in response to oxygen binding? The heme group The Fe2+ ion The proximal histidine The distal histidine
The proximal histidine
According to the current model for HIV infection, which of the following is not involved in the process of membrane fusion?
The viral chromosome
Why are allosteric enzymes necessary in the regulation or control of the Metabolic pathways?
They allow for binding of activator or inhibitor molecules to give the enzyme the necessary conformation to either activate (continue) or stop a metabolic reaction.
Where are disulfide bonds found in immunoglobulins? They are found between the beta sheets in many of the domains. They link the light chains to the heavy chains. They link the heavy chains to each other. They are found in all of the places listed above.
They are found in all of the places listed above.
Which statement does NOT describe a reason that water can act as a heat buffer for cells and organelles?
Water can auto-ionize.
Examples of cofactors include
Zn2+, Mg2+, and Ni2+. biotin and thiamine pyrophosphate. pyridoxal phosphate and coenzyme A. biotin and thiamine pyrophosphate and pyridoxal phosphate and coenzyme A ALL OF THE ANSWERS ARE CORRECT
A compound that reduces the concentration of enzyme available for substrate binding is called:
a competitive inhibitor
A Lineweaver-Burk plot is also called:
a double reciprocal plot
An integral membrane protein can be extracted with: a buffer of alkaline or acid pH. a chelating agent that removes divalent cations. a solution containing detergent. a solution of high ionic strength. (high salt
a solution containing detergent.
If you want to determine what other proteins might be interacting with the protein you have been studying, what type of fusion tag would you add to your protein to aid in purification of both the protein you have been studying and the proteins interacting with it?
a tandem affinity purification tag
sucrose monomers
a-Glucose + B-Fructose via a Glucose a-1 bond and a Fructose B-2 bond due to the flip that fructose does
(a) Explain why phosphoglycerides (or glycerophospholipids) are capable of spontaneously assembling into the bilayer structure found in biological membranes but triacylglycerols are not. (b) What are the forces that drive bilayer formation?
a. has both polar and non-polar regins b. hydrophobic chain in water forces the formaiton of a cage and when the water molecules in the cage are released a gain in entropy happens driving the formation of the bilayer
(a)When relatively high concentrations of fatty acids are suspended in water, they form structures known as ________. (b) When relatively high concentrations of membrane phospholipids are dissolved in water, they form structures known as ________. (c) Why are the structures listed in your answers to (a) and (b) above favored on each type of lipid?
a. micelles b. bilayers c. Helps with formation
What is the name of the molecule that is composed of adenine linked to the C1' of ribose?
adenosine
AMP' is used to refer to
adenosine monophosphate.
The major carrier of chemical energy in all cells is:
adenosine triphosphate
The major carrier of energy in the cell is:
adenosine triphosphate
Yeast two hybrid analysis functions due to which reason?
all of the above
The nutritional storage forms of glucose in plants is/are:
amylose and amylopectin
Fatty acids are attached to sphingosine by what type of chemical linkage?
an amide linkage
The sialic acids
are important constituents of glycoproteins and glycolipids
Glycoproteins
are relatively heterogeneous.
The uncommon amino acid selenocysteine has an R group with the structure -CH2-SeH (pka=5). In an aqueous solution ph=7, selenocysteine would:
be a fully ionized zwitterion with no net charge.
When a tissue sample is homogenized in a extractant composed of chloroform, methanol, and water, followed by addition of more water to separate the liquid phases, which molecules will remain in the methanol/water phase?
both proteins and sugars
A patient you are treating appears to be deficient in vitamin D. You have previously prescribed vitamin D supplements, but they do not appear to be working. Which organs and/or tissues should you check to make sure that the enzymes they produce are functioning appropriately?
both the liver and the kidneys
Which technique separates lipids based on their affinity for a silica gel material?
both thin-layer and absorption chromatography
How is the DNA helix stabilized?
by hydrogen bonds between base pairs as well as by hydrophobic interactions, called stacking forces, between adjacent bases. -Stacking bases interact with each other through the Van der Waals forces
The most rapid way that erythrocytes adapt to high altitudes is by producing genetically altered hemoglobins that have higher O2-binding affinities. by adopting the symmetry model of allosterism. by increasing the concentration of hemoglobin. by relying upon the simpler protein myoglobin. by increasing the intracellular concentration of BPG.
by increasing the intracellular concentration of BPG.
Cellulose is A) a linear copolymer of glucose and galactose. B) a branched polymer of glucose. C) a linear polymer of glucose with β(1-4) linkages. D) a linear polymer of glucose with α(1-4) linkages. E) sometimes called starch.
c
A lack of ascorbic acid (vitamin C) will result in reduced stability of:
collagen
What type(s) of inhibition can be reversed?
competitive noncompetitive mixed ALL OF THE ANSWERS ARE CORRECT None of the answers is correct.
treatment of methanol poisoning by using ethanol is an example of what type of enzyme inhibition:
competitive inhibition
Compounds that generate nitrous acid (such as nitrites, nitrates, and nitrosamines) change DNA molecules by:
deamination of bases
What feature do Tay-Sachs disease, Fabry disease, and Niemann-Pick disease have in common?
defects in enzymes responsible for breaking down membrane lipids in the lysosomes
What is the free energy change for a reaction at equillibrium?
deltaG = 0 at equilibrium = death rather than reach equilibrium, living organisms are thermodynamically open systems that tend to maintain a "steady-state" in which the rates of synthesis and degradation are more or less equal and concentrations change little over time
What is the relationship (equation) between deltaG* and Keq? *=STP
deltaG* = -RTlnKeq and at equilibrium when deltaG = 0
Which technique would not be used to make a cDNA library?
extraction of DNA from the organism you are studying
If a protein enters the pores its elution volume will be
greater than the void volume (V0)
Give the name and the one letter abbreviation of the base cytosine base-pairs (H-bonds) with in DNA?
guanine, G
A tetraplex of DNA is most likely to form with which residue?
guanosine
Which of the following is an example of a heteropolysacchide?
hyaluronic acid
Triple-helical DNA structures can result from Hoogsteen (non Watson-Crick) interactions. These interactions are primarily:
hydrogen bonds involving the bases
The amino acid substitution of Val for Glu in Hemoglobin S results in aggregation of the protein because of _____ interactions between molecules.
hydrophobic
What are the main bonds or forces that stabilize the dimer formed by two myosin heavy chains? hydrophobic interactions hydrogen-bonds ionic interactions disulfide bonds isopeptide bonds
hydrophobic interactions
Which method would not increase the strength of a fibrous protein?
increasing the number of Pro residues in the polypeptide
What are similarities and differences between ionophore channels and ion channels?
ion channels = protein equivalents of pores; tightly gated and coupled to only open and close when needed ionophore channels drill a tunnel/pore through the membrane to increase permeability both move ions to discharge membrane potential
A genomic library
is a collection of cloned DNA fragments representing all of an organism's DNA.
Km
is the concentration of substrate where the enzyme achieves 1/2 Vmax
Overproduction of which types of signaling lipids causes asthmatic attacks?
leukotrienes
Which organelle probably originate as an endosymbiotic engulfing og an aerobic bacterium by a eukaryotic cell?
mitochondrion
The molecule shown in the diagram is a
none of the above
Which of the following statements about the symmetry model of allosterism is not true? the protein is an oligomer of symmetrically (or pseudosymmetrically) related subunits. the oligomer can exist in two conformational states, which are in equilibrium. the ligand can bind to a subunit in either conformation. the molecular symmetry of the protein is conserved during the conformational change. none of the above.
none of the above.
Non-Watson-Crick Base-Pair Interactions
nontraditional base pairing that results in introns, hammerheads and three-dimensional structures. *wobble-base pairs*
Why is this statement false. Free fatty acids are major components of all membranes
not in high amounts
List major eukaryotic organelles and their functions
nucleolous = RNA synthesis lysosome = digestive enzymes golgi apparatus = secretory pathway mitochodrion = power plant smooth ER = lipid metabolism rough ER = protein synthesis
What are the biological effects of steroid hormones?
overall help maintain homeostasis; 5 major classes 1)Progesterones - ie. progesterone - menstration, pregnancy, embryogenesis 2)Estrogens - ie. estradiol - female sexual development 3)Androgens - ie. testosterone - male sexual development 4)Glucocorticoids - ie. cortisol - metabolism, and inflammation 5)Mineralcorticoids - ie. aldosterone - osmoregulation (salt and water balance)
Which of the following triggers the transition from T state to R state (low to high affinity) in hemoglobin? oxygen binding. oxygen dissociation. subunit dissociation. movement of the proximal histidine. heme binding.
oxygen binding. When oxygen binds to the Fe(II) ion in the heme ring, at its 6th coordination position, the Fe(II) ion is pulled into the plane of the heme ring. It is this binding interaction that initiates the transition from T to R state.
The ionization of water is due to the strongly electronegative element:
oxygen receiving an electron from hydrogen.
A prosthetic group of a protein is a nonprotein structure that is:
permanently associated with the protein
Which membrane lipid serves as a reservoir of messenger molecules for signal transduction?
phosphatidylinositol 4,5-bisphosphate (PIP2)
An example of a glycerophospholipid that is involved in cell signaling is:
phosphatidylinositol.
If a patient you are treating has asthmatic attacks due to the overproduction of leukotrienes, which drug would you prescribe to help treat that condition?
prednisone
A small fragment of labeled DNA or RNA used in a hybridization experiment is called a
probe
A small fragment of labeled DNA or RNA used in a hybridization experiment is called a ______.
probe
What are the products of ionization of water? How are their concentrations related?
products are H+ and OH- ions; H+ largely exists as H3O+; concentrations are inversely related - more of one=less of the other
Which eicosanoids contains a five-carbon ring as part of its structure?
prostaglandins
If protein A has a pI of 3.1, protein B has a pI of 6.8, and protein C has a pI of 8.9, which protein would elute first from a cation exchangecolumn at pH 7?
protein A
According to the table, ion-exchange chromatography would be the LEAST effective method to separate which protein mixture?
protein B, E, and F
what is a drawback of long columns and high fluid volumes?
protein peaks spread as they move through the column,
For the study of a protein in detail, an effort is usually made to first:
purify the protein
Is adenine a purine or a pyrimidine?
purine
Cytosine, uracil, and thymine are derivatives of
pyrimidine
The fluidity of a lipid bilayer will be increased by: decreasing the number of unsaturated fatty acids. decreasing the temperature. increasing the length of the alkyl chains. replacing 18:0 (stearic acid) with 18:2 (linoleic acid).
replacing 18:0 (stearic acid) with 18:2 (linoleic acid).
The "energy carrier" ATP is an example of a(n):
ribonucleoside triphosphate
When two atoms are joined together covalently, the van der Waals radius of the atom in the covalent bond are ____ than the radius of aroms alone because the joined atoms are ___
shorter; pulled together bu the shared electron pair
. Gel electrophoresis generally separates nucleic acids on the basis of:
size
Which of the following nucleic acids provides the key to decoding genetic information?
tRNA
Membrane fusion leading to neurotransmitter release requires the action of:
tSNARE and vSNARE
DNA sequencing using the Sanger method requires
template, primer, DNA polymerase, dNTPs, ddNTPs.
The steady state assumption, as applied to enzyme kinetics, implies:
the ES complex is formed at broken down at equivalent rates.
The reaction of carbonic anhydrase catalyzes the formation of carbamates with the concomitant release of protons. the hydration of bicarbonate, resulting in the formation of carbonic acid. the reduction of carbon dioxide with the concomitant consumption of protons. the hydration of carbon dioxide, forming bicarbonate and protons. the hydrolysis of carbamates with the concomitant consumption of protons.
the hydration of carbon dioxide, forming bicarbonate and protons.
Why do cells contain an array of protein phosphatases as well as protein kinases?
they maintain homeostasis by turning proteins on and off, molecular switch - post translational regulation
Knowledge about the tautomeric forms of the bases of nucleic acids is needed
to understand H-bonding between the complementary bases
Genomic DNA is ______, producing _________.
transcribed; mRNA
In sickle-cell anemia, the negatively charged glutamic acid residue is replaced by the neutral amino acid ____________. tyrosine lysine valine adenosine glycine
valine
What are the functions of steroid hormones?
variety of functions central to homeostasis; highly hydrophobic and diffuse easily through cell membrane to bind to their receptor; five major classes = PGAME
During muscle contraction myosin heads walk along thick filaments toward the M disk. walk along thick filaments toward the Z disk. walk along thin filaments toward the M disk. walk along the thin filaments toward the H zone. walk along the thin filaments toward the Z disk.
walk along the thin filaments toward the Z disk.
Which solvent is NOT used to dissolve lipids?
water
Explain the trend in melting point with increasing fatty acid chain length and number of double bonds
x:m symbol -> x= # of C atoms, m = # of CC double bonds mp increases with increasing x mp decreases with increasing m
A method of determining if proteins are interacting in vivo that makes use of a transcription factor involved in regulating galactose metabolism genes is:
yeast two-hybrid analysis
Membrane proteins:
have all of the properties listed above.
Glycosphingolipids and cholesterol cluster together in membrane regions known as "__________". These microdomains are more __________ than the surrounding phospholipid-rich membrane due to a high content of __________ fatty acids. These regions are rich in proteins that are anchored to the membrane by covalently attached __________ and __________ groups and also those anchored by GPI linkage. Proteins aggregated in this fashion are often functionally related. Examples are (1) __________ proteins and (2) __________ proteins.
"rafts", ordered, saturated, myristoyl, palmitoyl, receptor, signaling.
In situ hybridization often uses radioactively labeled probes. When probing for a gene containing the sequence 'AGCTAACGGG' (standard notation), the probe should have a sequence containing
'CCCGTTAGCT', in order to very selectively bind the target in an antiparallel fashion
What are three differences between ion channels and ion transporters?
(1) The rate of ion movement through channels is much greater; (2) ion transporters exhibit saturation, whereas ion channels do not; (3) ion channels open and close in response to external stimuli or events such as ligand-binding or changes in electrical potential across the membrane.
[S] = Km for a simple enzymatic reaction. When [S] is doubled the initial velocity is
(1/3) Vmax
(a) Define "reducing sugar." (b) Sucrose is a disaccharide composed of glucose and fructose (Glc(alpha1-->2)Fru). Explain why sucrose is not a reducing sugar, even though both glucose and fructose are.
(a) A reducing sugar is one with a free carbonyl carbon that can be oxidized by Cu2+ or Fe3+. (b) The carbonyl carbon is C-1 of glucose and C-2 of fructose. When the carbonyl carbon is involved in a glycosidic linkage, it is no longer accessible to oxidizing agents. In sucrose (Glc(alpha-->2)Fru), both oxidizable carbons are involved in the glycosidic linkage.
Distinguish between simple diffusion (SD), facilitated diffusion (FD), and active transport (AT) across a membrane for the following questions (more than one may be true). (a) Which processes are energy dependent? (b) Which processes need some kind of carrier protein(s)? (c) Which processes can be saturated by substrate? (d) Which processes can establish a concentration gradient? (e) How much energy does it take to transport an uncharged substrate in, if its starting inside concentration is 10-fold greater than outside?
(a) AT only; (b) FD and AT; (c) FD and AT; (d) AT only; (e) 5.7 kJoules/mole
(a) Define the term amphipathic. (b) Diagram two types of assemblies that amphipathic molecules form in water. (c) What are the forces that contribute to the formation of the structures diagrammed in (b)?
(a) Amphipathic means having one region that is polar and another that is nonpolar. (b) The two common structures formed by lipids in water are micelles and bilayers. (See Fig. 11-4, p. 374.) (c) These lipid aggregates in water are stabilized by the energy gain from burying hydrophobic groups out of contact with water. When a hydrophobic chain is surrounded by water, it forces the formation of a cage of immobilized water molecules around it. When several hydrophobic regions cluster, the surface area exposed to water decreases, and the water molecules in the cage are released, with a gain in entropy that drives the formation of the lipid aggregates.
(a) Draw the structure of any aldohexose in the pyranose ring form. (b) Draw the structure of the anomer of the aldohexose you drew above. (c) How many asymmetric carbons (chiral centers) does each of these structures have? (d) How many stereoisomers of the aldohexoses you drew are theoretically possible?
(a) Any of the hexoses drawn with a six-membered ring, as shown in Fig. 7-7 on p. 239, is correct. The hydroxyls at C-2, C-3, and C-4 can point either up or down. (b) For the anomer, the structure should be identical to the first, except that the hydroxyl group at C-1 should point up if it pointed down in your first structure, and vice versa. (c) The number of chiral centers is 5; all are carbons except C-6. (d) The number of possible stereoisomers for a compound with n chiral centers is 2n; in this case, 25, or 32 possible isomers.
Fatty acids are a component of: A) carotenes. B) cerebrosides. C) sterols. D) vitamin D. E) vitamin K.
B) cerebrosides.
Draw the structure of the repeating basic unit of: (a) amylose (b) cellulose.
(a) For the structure of amylose, see Fig. 7-14a, p. 245. The repeating unit is alpha-D-glucose linked to alpha-D-glucose; the glycosidic bond is therefore (alpha1 --> 4). (b) Cellulose has the same structure as amylose, except that the repeating units are beta-D-glucose and the glycosidic bond is (beta1--> 4). (See Fig. 7-15a, p. 246.)
Define each in 20 words or less: (a) anomeric carbon; (b) enantiomers; (c) furanose and pyranose; (d) glycoside; (e) epimers; (f) aldose and ketose.
(a) The anomeric carbon is the carbonyl carbon atom of a sugar, which is involved in ring formation. (b) Enantiomers are stereoisomers that are nonsuperimposable mirror images of each other. (c) Furanose is a sugar with a five-membered ring; pyranose is a sugar with a six-membered ring. (d) A glycoside is an acetal formed between a sugar anomeric carbon hemi-acetal and an alcohol, which may be part of a second sugar. (e) Epimers are stereoisomers differing in configuration at only one asymmetric carbon. (f) An aldose is a sugar with an aldehyde carbonyl group; a ketose is a sugar with a ketone carbonyl group.
(a) What kinds of forces or bonds anchor an integral membrane protein in a biological membrane? (b) What forces hold a peripheral membrane protein to the membrane? (c) What might one do to solubilize each of the two types of membrane proteins?
(a) The forces that hold integral membrane proteins in the membrane are hydrophobic interactions between hydrophobic domains of the protein and the fatty acyl chains of the bilayer interior. (b) Peripheral membrane proteins associate with membranes primarily through ionic interactions and hydrogen bonds between charged and polar side chains of the protein and polar head groups of membrane lipids. Some peripheral membrane proteins contain a covalently bound lipid that anchors them to the bilayer. (c) To remove integral membrane proteins, it is generally necessary to use detergents, which convert membranes into "soluble" micelles. Peripheral membrane proteins can often be released by extraction with buffers of high or low salt concentration, high or low pH, or low concentrations of divalent cations.
(a) When relatively high concentrations of fatty acids are suspended in water, they form structures known as ________. (b) When relatively high concentrations of membrane phospholipids are dissolved in water, they form structures known as ________. (c) Why are the structures listed in your answers to (a) and (b) above energetically favored?
(a) micelles. (b) bilayers. (c) Micelles are favored when the polar head group has a greater cross-sectional area than the nonpolar acyl chain, making the molecule wedge-shaped; bilayers are favored when the cross-sectional area of head group and acyl chain(s) are about the same, so that the molecule is cylindrical.
(a) List the major components of membranes. (b) When a preparation of mitochondrial membranes was treated with high salt (0.5 M NaCl), it was observed that 40% of the total protein in this preparation was solubilized. What kind of membrane proteins are in this soluble extract, and what forces normally hold them to the membrane? (c) What kind of proteins constitute the insoluble 60%, and what forces hold these proteins in the membrane?
(a) phospholipids, sterols, proteins (integral and peripheral); (b) peripheral membrane proteins, which are associated with the membrane through ionic and hydrogen bonds between their charged and polar side chains and the charged head groups of phospholipids; (c) integral membrane proteins (which are held to the membrane by hydrophobic interactions between their nonpolar side chains and the hydrophobic fatty acyl chains of phospholipids), and those peripheral membrane proteins that are held to the membrane by a covalent lipid anchor.
a) What is meant by the transition temperature of a membrane? List the two characteristics of the fatty acids in a biological membrane that affect the transition temperature. Using up arrow or down arrow, show in which direction an increase in these characteristics would change the transition temperature.
(a) the transition temperature of a membrane is the temperature at which its structure changes from a paracyrstalline solid to a liquid state. (b) The two characteristics of of fatty acids that directly affect Tt are degree of unsaturation (up arrow) and chain length (down arrow).
(a) Explain why phosphoglycerides are capable of spontaneously assembling into the bilayer structure found in biological membranes but triacylglycerols are not. (b) What are the forces that drive bilayer formation?
(a): Triacylglycerols have three fatty acyl groups in ester linkage with glycerol; they are very hydrophobic because the carboxyl groups, which are involved in the ester linkages, cannot ionize. Phosphoglycerides have a polar region at their head group, where a phosphate in a phosphodiester linkage bears a full negative charge. The head group itself (serine, ethanolamine, choline, etc.) may also be charged and is polar in any case. Thus, the phospholipid is amphipathic, having both polar and nonpolar regions, and it forms lipid bilayers spontaneously in water. (b) These lipid bilayers are stabilized by the energy gained from burying hydrophobic groups out of contact with water. A hydrophobic chain in water forces the formation of a cage of immobilized water molecules around it. When several hydrophobic regions cluster in a bilayer, the surface area exposed to water decreases, and the water molecules in the cage are released, accompanied by a gain in entropy that drives the formation of the bilayer.
O-linked oligosaccharides are commonly attached to the —OH group of _____. A) ribose B) tyrosine C) lysine D) threonine E) glycine
D
THE REVERSIBLE REACTION EXAMPLE: THERMODYNAMICS
* Consider a reversible reaction in which molecules X and Y interconvert: X <-> Y *If there is a very high excess of Y, It will drive the reaction in the direction of X. * Under these conditions, the Delta (G) for the reaction: Y->X (will be negative) *However, if there was a very high concentration of X, the Delta (G) for the reaction would be POSITIVE.
What is the equation for DELTA (G)?
*DELTA (G) = DELTA (G) PRIME + RT ln [(X)/(Y)]
What conclusion can be drawn when combining the equilibrium ratio of the two reactants? DELTA (G) = DELTA (G) PRIME + RT ln[(X)/(Y)] and K=[(X)/(Y)]
*DELTA (G) PRIME = -RT ln[(X)/(Y)] = -RT ln (K) IF we convert to log(10) we will get: DELTA (G) PRIME = -5.94 log(K) -The equilibrium constant is determined by the change in free energy between the reactants and products.
It is possible for RNA to store genetic information, because...?
--RNA does base pair and therefore can be replicated. --enzymes can process genetic information in the form of RNA. --RNA forms simple structures. --RNA is very stable.
What are some facts about PCR?
--Small amounts of DNA can be easily amplified to millions of copies. --PCR is often used in forensics laboratories. --PCR reaction products can be used in molecular cloning. --PCR is used in clinical laboratories.
Recombinant DNA technology can be used for...?
--constructing mutant proteins. --the industrial production of useful proteins. --producing transgenic organisms. --correcting genetic defects.
Alterations in genetic information can be caused by...?
--mistakes made during replication. --faulty recombination. --transposition of genes. --damage caused by chemicals or radiation.
Nucleotides play a central role in living organisms because...?
--they mediate transport of energy within the cell. --they are involved in oxidation-reduction reactions. --they are involved in intracellular signaling. --they function as building blocks for nucleic acids.
The pka of lysine's carboxyl group, amino group, and side chain are 2.2, 9.0, and 10.5, respectively. If lysine is in a pH 13 solution, what is the net charge on each lysine molecule?
-1
Fructose-1-phosphate can by hydrolyzed into fructose + inorganic phosphate with a delta G of -16.0 kJ/ mol. If ATP can be hydrolyzed into ADP + Pi with a delta G of -30.5 kJ/mol, what is the free energy change for thereaction of fructose + ATP ---> fructose 1-phosphate + ADP?
-14.5 kJ/mol
THE REVERSIBLE REACTION EXAMPLE: THE BOX OF PENNIES THERMODYNAMICS *WHAT WILL HAPPEN TO THE PENNIES AT EQUILIBRIUM?
-Afters lots of shaking of the pennies, there will be an equal number of pennies in each orientation.
The structures seen below would MOST likely be formed by: A) W: RNA / X: RNA / Y: DNA B) W: RNA / X: DNA / Y: DNA C) W: DNA / X: DNA / Y: RNA D) W: DNA / X: RNA / Y: RNA E) W: RNA / X: RNA / Y: RNA
A
THE REVERSIBLE REACTION EXAMPLE: THE BOX OF PENNIES THERMODYNAMICS
-Consider the box of pennies: *Now imagine that that same box of pennies starts with 900 pennies with HEADS UP, and 100 pennies TAILS UP. *When the box is shaken the number of pennies with tails up will increase. *SO....the HIGHER the concentration of heads, the GREATER the probability that the pennies will go from heads to tails.
GFC results in
dilution of the sample (so its best to use it early on in a protein isolation scheme)
Chargaffs Rules
-states that DNA from any cell of all organisms should have a 1:1 ratio (base Pair Rule) of pyrimidine and purine bases and, more specifically, that the amount of guanine is equal to cytosine and the amount of adenine is equal to thymine.
Tay-Sachs disease is the result of a genetic defect in the metabolism of
A) gangliosides. B) phosphatidyl ethanolamine. C) sterols. D) triacylglycerols. E) vitamin D. A
Lipids as signals, cofactors, and pigments Pages: 373-375 Difficulty: 2 Which vitamin is derived from cholesterol? A) A B) B12 C) D D) E E) K
Ans: C C) D
Which of these polysaccharides is a branched polymer? A) chitin B) amylose C) cellulose D) amylopectin E) hyaluronic acid
D
Outline the mechanism of action of GLUT1 transporter
1) extracellular glucose binds to GLUT1 transporter protein 2)protein changes conformation 3)glucose disassociates inside the cell 4) GLUT1 protein returns to original conformation *broad substrate specificity
What are the characteristics of Allosteric enzymes?
-Have an Active site and an Allosteric Site - Normally composed of multiple sub-units - Do not obey M-M Kinetics (Sigmoidal curve instead of hyperbolic) - 2 Conformational forms: Inactive T (Tight) or Active R (Relaxed).
What does Delta (G) of a reaction depend on?
-It depends not only on energy stored in chemical bonds, but also upon the concentrations of the reactants.
What is Delta (G) prime?
-It is the free energy change in which all reactants are at a standard concentration (which has been set at 1 mole/liter).
Titration of valine by a strong base, for example NaOH, reveals two pK's. The titration reaction occurring at pK2 (pK2 = 9.62) is:
-NH3+ + OH- ----> -NH2 + H2O
What is Delta (G) Prime?
-Standard free energy change.
What is the equilibrium constant for the reaction: (Y)->(X)
-The equilibrium constant for this reaction is defined as: K= [(X)/(Y)] *In this equation, (X) and (Y) are the concentrations of reactants at equilibrium.
What will the EQUILIBRIUM CONSTANT be for a reaction that has multiple reactants and products?: A + B -> C + D
-The equilibrium constant will be: K= [(C)(D)/(A)(B)]
What will the FREE ENERGY EQUATION be for a reaction that has multiple reactants and products?:
-The free energy equation will be: DELTA (G) = -5.94 log [(C)(D)/(A)(B)]
What factors influence the fluidity of a bilayer?
1) temperature- highly dependent on chain length (x) and degree of saturation (m) 2) lipid composition cholesterol serves as fluidity buffer
Five KM values are given for the binding of substrates to a particular enzyme. Which has the strongest affinity when k-1 is greater than k2?
1.5 nM
B DNA Features
-has a major groove and a minor groove. -The presence of the grooves allows access to the hydrogen-bonding capabilities of the exposed bases. -The hydrogen bonding capability provides a means of sequence-specific interactions between DNA and the molecules it must interact with in the processes of replication and transcription.
DNA fragments are usually inserted into a plasmid vector and cloned before they are analyzed by chain termination sequencing because
- DNA fragments need to be pure in order to obtain an unambiguous sequence. - a large number of identical fragments is needed in a sequencing reaction in order to generate detectable amounts of products. - plasmid vectors have known sequences that can be used for design and annealing of the primer oligonucleotides, which are used to initiate the sequencing reaction.
Which of the following conclusions about the human genome is (are) true? - Only about 80% of the human genome is transcribed to RNA. - Only about 1-2% of the human genome encodes protein. - Most of the proteins found in humans are also found in many other animals. - Nearly half of the human genome consists of repetitive DNA sequences.
- Only about 80% of the human genome is transcribed to RNA. - Only about 1-2% of the human genome encodes protein. - Most of the proteins found in humans are also found in many other animals. - Nearly half of the human genome consists of repetitive DNA sequences.
Which of the following statements about PCR is (are) true? - Small amounts of DNA can be easily amplified to millions of copies. - PCR is often used in forensics laboratories. - PCR reaction products can be used in molecular cloning. - PCR is used in clinical laboratories.
- Small amounts of DNA can be easily amplified to millions of copies. - PCR is often used in forensics laboratories. - PCR reaction products can be used in molecular cloning. - PCR is used in clinical laboratories.
Recombinant DNA technology can be used for
- constructing mutant proteins. - the industrial production of useful proteins. -producing transgenic organisms. - correcting genetic defects.
Alterations in genetic information can be caused by
- mistakes made during replication. - faulty recombination. - transposition of genes. - damage caused by chemicals or radiation.
B blood
- red blood cells have B antigens - produces anti-A-antibodies
antigen
- specific glycoprotein located on the surface of the cells - helps to identify cells
Nucleotides play a central role in living organisms because
- they mediate transport of energy within the cell. - they are involved in oxidation-reduction reactions. - they are involved in intracellular signaling. - they function as building blocks for nucleic acids.
DNA fragments are usually inserted into a plasmid vector and cloned before they are analyzed by chain termination sequencing because...?
--DNA fragments need to be pure in order to obtain an unambiguous sequence. --a large number of identical fragments is needed in a sequencing reaction in order to generate detectable amounts of products. --plasmid vectors have known sequences that can be used for design and annealing of the primer oligonucleotides, which are used to initiate the sequencing reaction
What are some facts about the human genome?
--Only about 80% of the human genome is transcribed to RNA. --Only about 1-2% of the human genome codes for proteins. --Most of the proteins found in humans are also found in many other animals. --Nearly half of the human genome consists of repetitive DNA sequences.
Draw the structure of either an adenine-thymine or a guanine-cytosine base pair as found in the Watson-Crick double-helical structure of DNA. Include all hydrogen bonds.
...
Draw the structures of hydrogen-bonded adenine and thymine.
...
What is the fractional saturation of myoglobin at pO2 = 7.2 torr, if P50 = 2.8 torr? 0.28 0.50 1.00 0.72
.72
The aqueous solution with the LOWEST pH is:
0.1 M HCl
From the graph below plotting data that was collected under steady state conditions, velocity on the y-axis in units of uM/s and substrate concentration of the x-axis in units of uM, what is the Vmax
0.24 uM/s
When [S] = Km, Vo = (______) * (Vmax)
0.5
What is the fractional saturation of myoglobin at pO2 = 2.8 torr, if p50 = 2.8 torr? 0.28 0.50 1.00 2.80
0.50 Y = pO2 / (p50 + pO2) = 2.8 / (2.8 + 2.8) = 0.5
An enzyme has velocities of 0.11 nmol/min at a substrate conc of 1 um, 0.34 nmol.min at a conc of 5 um, and 0.45 nmol/min at conc 10 um. What is Vmax for the enzyme if Km is 5x10^-6?
0.68 nmol.min
List 3 Allosteric Enzymes and their functions
1) Aspartate transcarbamolyase (ATCase): Functions to catalyze the first step of Pyrimidine nucleotide biosynthesis. 2) Phosphofructokinase I (PFK-I): Functions to regulate the pathway for Glucose breakdown to Pyruvate. 3) Glycogen Phosphorylase a: Functions to catalyze a key regulatory step of gycogenolysis. 4) Protein Kinase A: Functions to regulate glycogen, lipid and sugar metabolism.
4. Outline the four key features of the current model for homologous recombination during meiosis in a eukaryotic cell.
1) Homologous chromosomes are aligned. (2) A double-strand break is enlarged by an exonuclease, leaving a single-strand extension with a 2) free 3' hydroxyl end. (3) The exposed 3' ends invade the homologous intact duplex DNA, followed by branch migration to create a Holliday junction. (4) Cleavage of the two crossover products creates the two recombinant products.
Based on the figure below, which of the following expressions would be correct
D = 1/Vmax
What are the two forms of active transport? What is the direct and ultimate source of energy for each form?
1)primary = energy directly from ATP hydrolysis 2)secondary = energy from gradient discharge
If you wanted to analyze membrane lipids from a biological sample, which solvent would MOST effectively extract those lipids? A) benzene B) methanol C) water D) chloroform E) ethyl ether
B
According to the diagram, how many titratable groups does this amino acid have?
2
Hemoglobin is a heterotetramer. How many protomers are present in hemoglobin? 0 1 2 3 4
2
How many antigen-binding sites are present on an IgG molecule? 1 2 3 4 5
2
IgG is one of five classes of antibodies that can be produced by our immune system. IgGs have a molecular mass of approximately 150 kDa, what is their subunit composition? 2 light chains and 2 heavy chains 2 light chains, 2 heavy chains, and a J chain 4 light chains, 4 heavy chains, and a J chain 6 light chains, 6 heavy chains, and a J chain 10 light chains, 10 heavy chains , and a J chain.
2 light chains and 2 heavy chains
In Sanger dideoxy DNA sequencing, DNA polymerase I is used to add nucleotides to the ___ end of the growing polynucleotide chain.
3ʹ
Which ranking correctly describes the rigidity of the red bond (the central bond) shown in the figure?
4 = most rigid (C-C triple bond); 3= least rigid (C-C single bond)
How many different classes of antibodies are produced by the human immune system? 1 2 3 4 5
5
______of the world's human population carries an inherited variant hemoglobin gene. 5% 25% 50% 75% 90%
5%
Organisms composed of cells with two sets of chromosomes are called ________ organisms
diploid
15. In homologous genetic recombination, RecA protein is involved in: A) formation of Holliday intermediates and branch migration. B) introduction of negative supercoils into the recombination products. C) nicking the two duplex DNA molecules to initiate the reaction. D) pairing a DNA strand from one duplex DNA molecule with sequences in another duplex, regardless of complementarity. E) resolution of the Holliday intermediate
A
Km
Is the concentration of substrate where the enzyme achieves 1/2 Vmax
8. Which of these enzymes is not directly involved in methyl-directed mismatch repair in E. coli? A) DNA glycosylase B) DNA helicase II C) DNA ligase D) DNA polymerase III E) Exonuclease I
A
Any sugar that has a free aldehyde group is called a(n) _____. A) reducing sugar B) non-reducing sugar C) ketose D) aldohexose E) alditol
A
Based on Chargaff's rules, which base compositions for double-stranded DNA are possible? %A %G %C %T %U A) 5 45 45 5 0 B) 20 20 20 20 20 C) 35 15 35 15 0 D) All of the answers are correct. E) None of the answers is correct.
A
Based on Chargaff's rules, which of the following are possible base compositions for double-stranded DNA? %A %G %C %T %U A) 5 45 45 5 0 B) 20 20 20 20 20 C) 35 15 35 15 0 D) All of the above E) None of the above
A
Bile acids are derived from which lipid? A) cholesterol B) sphingomyelin C) ceramide D) digalactosyldiacylglycerol E) phosphatidylcholine
A
DNA is _____ chemically stable than RNA due to the _____ on _____. A) more; 2′-hydroxyl groups; RNA B) more; 2′-hydroxyl groups; DNA C) more; 3′-hydroxyl groups; RNA D) less; 2′-hydroxyl groups; RNA E) less; 2′-hydroxyl groups; DNA
A
Facilitated diffusion through a biological membrane is: A) driven by a difference of solute concentration. B) driven by ATP. C) endergonic. D) generally irreversible. E) not specific with respect to the substrate
A
Glucose and galactose are _____ of each other. A) epimers B) enantiomers C) diastereomers D) anomers E) none of the above
A
In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share which one of the following properties? A) The distance between the two glycosidic (base-sugar) bonds is the same in both base pairs, within a few tenths of an angstrom. B) The molecular weights of the two base pairs are identical. C) The number of hydrogen bonds formed between the two bases of the base pair is the same. D) The plane of neither base pair is perpendicular to the axis of the helix. E) The proton-binding groups in both base pairs are in their charged or ionized form
A
In the Watson-Crick structure of DNA, the: A) absence of 2'-hydroxyl groups allows bases to lie perpendicular to the helical axis. B) adenine content of one strand must equal the thymine content of the same strand. C) nucleotides are arranged in the A-form. D) purine content (fraction of bases that are purines) must be the same in both strands. E) two strands are parallel.
A
In the Watson-Crick structure of DNA, the: A) absence of 2'-hydroxyl groups allows bases to lie perpendicular to the helical axis. B) adenine content of one strand must equal the thymine content of the same strand. C) nucleotides are arranged in the A-form. D) purine content (fraction of bases that are purines) must be the same in both strands. E) two strands are parallel
A
Different enzymes that catalyze the same reaction, although may be found in different tissues, are known as
Isozymes
Peripheral membrane proteins: A) are generally noncovalently bound to membrane lipids. B) are usually denatured when released from membranes. C) can be released from membranes only by treatment with detergent(s). D) may have functional units on both sides of the membrane. E) penetrate deeply into the lipid bilayer.
A
Sphingosine is not a component of: A) cardiolipin. B) ceramide. C) cerebrosides. D) gangliosides. E) sphingomyelin.
A
Tay-Sachs disease is the result of a genetic defect in the metabolism of: A) gangliosides. B) phosphatidyl ethanolamine. C) sterols. D) triacylglycerols. E) vitamin D.
A
The CORRECT name for the molecule shown below is: A) 5-methylcytidine. B) C5-methylcytidine. C) 5-methyluridine. D) C5-methylthymidine. E) 5-methylthymidine.
A
The difference between a ribonucleotide and a deoxyribonucleotide is: A) a deoxyribonucleotide has an —H instead of an —OH at C-2. B) a deoxyribonucleotide has an —H instead of an —OH at C-3. C) a ribonucleotide has an extra —OH at C-4. D) a ribonucleotide has more structural flexibility than deoxyribonucleotide. E) a ribonucleotide is a pyranose, deoxyribonucleotide is a furanose.
A
The difference between a ribonucleotide and a deoxyribonucleotide is: A) a deoxyribonucleotide has an —H instead of an —OH at C-2. B) a deoxyribonucleotide has an —H instead of an —OH at C-3. C) a ribonucleotide has an extra —OH at C-4. D) a ribonucleotide has more structural flexibility than deoxyribonucleotide. E) a ribonucleotide is a pyranose, deoxyribonucleotide is a furanose
A
The image below shows a DNA sequencing gel using the Sanger method. The top of the gel is the anode and the bottom is the cathode. Which band represents the shortest and longest fragments of DNA? A) shortest = Z, longest = W B) shortest = X, longest = Z C) shortest = W, longest = Y D) shortest = Y, longest = X E) shortest = W, longest = Z
A
The phosphodiester bond that joins adjacent nucleotides in DNA: A) associates ionically with metal ions, polyamines, and proteins. B) is positively charged. C) is susceptible to alkaline hydrolysis. D) Links C-2 of one base to C-3 of the next. E) links C-3 of deoxyribose to N-1 of thymine or cytosine.
A
The phosphodiester bond that joins adjacent nucleotides in DNA: A) associates ionically with metal ions, polyamines, and proteins. B) is positively charged. C) is susceptible to alkaline hydrolysis. D) Links C-2 of one base to C-3 of the next. E) links C-3 of deoxyribose to N-1 of thymine or cytosine
A
The specificity of the potassium channel for K+ over Na+ is mainly the result of the: A) differential interaction with the selectivity filter protein. B) hydrophobicity of the channel. C) phospholipid composition of the channel. D) presence of carbohydrates in the channel. E) presence of cholesterol in the channel.
A
The type of motion least common in biological membranes is: A) flip-flop diffusion of phospholipid from one monolayer to the other. B) lateral diffusion of individual lipid molecules within the plane of each monolayer. C) lateral diffusion of membrane proteins in the bilayer. D) lateral diffusion of protein molecules in the lipid bilayer E) random motion of the fatty acyl side chains in the interior of the phospholipid bilayer.
A
What is the abbreviated nomenclature for a 14-carbon omega-3 fatty acid that contains no other double bonds? A) 14:1(D11) B) 17:1(D14) C) 14:1(D3) D) 13:1(D11) E) 14:0(D11)
A
Which of the following best describes the cholesterol molecule? A) Amphipathic B) Nonpolar, charged C) Nonpolar, uncharged D) Polar, charged E) Polar, uncharged
A
Which of the following is a major difference between cellulose and chitin? A) chitin is produced by insects, cellulose is produced by plants B) chitin contains glucose and glucosamine, cellulose contains only glucose C) chitin contains (16) glycosidic bonds, cellulose contains (14) glycosidic bonds D) chitin is a branched polymer, cellulose is linear E) none of the above
A
Which of the following is true of sphingolipids? A) Cerebrosides and gangliosides are sphingolipids. B) Phosphatidylcholine is a typical sphingolipid. C) They always contain glycerol and fatty acids. D) They contain two esterified fatty acids. E) They may be charged, but are never amphipathic.
A
Which of the following polysaccharides cannot be digested by mammalian salivary, gastric, or pancreatic enzymes? A) cellulose B) amylopectin C) amylose D) glycogen E) starch
A
Which of the following statements about sterols is true? A) All sterols share a fused-ring structure with four rings. B) Sterols are found in the membranes of all living cells. C) Sterols are soluble in water, but less so in organic solvents such as chloroform. D) Stigmasterol is the principal sterol in fungi. E) The principal sterol of animal cells is ergosterol.
A
Which of the following statements concerning fatty acids is correct? A) One is the precursor of prostaglandins. B) Phosphatidic acid is a common one. C) They all contain one or more double bonds. D) They are a constituent of sterols. E) They are strongly hydrophilic.
A
Which of these is a general feature of the lipid bilayer in all biological membranes? A) Individual lipid molecules are free to diffuse laterally in the surface of the bilayer. B) Individual lipid molecules in one face (monolayer) of the bilayer readily diffuse (flip-flop) to the other monolayer. C) Polar, but uncharged, compounds readily diffuse across the bilayer. D) The bilayer is stabilized by covalent bonds between neighboring phospholipid molecules. E) The polar head groups face inward toward the inside of the bilayer.
A
Which of these statements about facilitated diffusion across a membrane is true? A) A specific membrane protein lowers the activation energy for movement of the solute through the membrane. B) It can increase the size of a transmembrane concentration gradient of the diffusing solute. C) It is impeded by the solubility of the transported solute in the nonpolar interior of the lipid bilayer. D) It is responsible for the transport of gases such as O2, N2, and CH4 across biological membranes. E) The rate is not saturable by the transported substrate
A
Describe the structure of a proteoglycan aggregate such as is found in the extracellular matrix.
A proteoglycan aggregate is a supramolecular assembly of proteoglycan monomers. Each monomer consists of a core protein with multiple, covalently linked polysaccharide chains. Hundreds of these monomers can bind noncovalently to a single extended molecule of hyaluronic acid to form large structures.
Which of these statements about the composition of biological membranes is false? Pg 372 A) In a given eukaryotic cell type (e.g., a hepatocyte), all intracellular membranes have essentially the same complement of lipids and proteins. B) The carbohydrate found in membranes is virtually all part of either glycolipids or glycoproteins. C) The plasma membranes of the cells of vertebrate animals contain more cholesterol than the mitochondrial membranes. D) The ratio of lipid to protein varies widely among cell types in a single organism. E) Triacylglycerols are not commonly found in membranes
A
Which of these statements is generally true of integral membrane proteins? A) A hydropathy plot reveals one or more regions with a high hydropathy index. B) The domains that protrude on the cytoplasmic face of the plasma membrane nearly always have covalently attached oligosaccharides. C) They are unusually susceptible to degradation by trypsin. D) They can be removed from the membrane with high salt or mild denaturing agents. E) They undergo constant rotational motion that moves a given domain from the outer face of a membrane to the inner face and then back to the outer.
A
Which single-stranded nucleic acid could form a hairpin structure? A) 5′ TTTGCGATACTCATCGCATT 3′ B) 5′ TTTGCGATACTCACGCTATT 3′ C) 5′ TTTGCGATACTCTGCGATTT 3′ D) All of the answers are correct. E) None of the answers is correct.
A
Which statement BEST describes how the volatility of lipids is increased for analysis by gas chromatography? A) The lipids are transesterified to convert fatty acids into fatty acid methyl esters. B) The lipids are cleaved with phospholipase enzymes . C) The lipids are degraded by treatment with mild acid or base. D) The lipids are dissolved in chloroform. E) The lipids are desaturated by reaction with a platinum catalyst.
A
Which statement about sterols is TRUE? A) All sterols share a fused-ring structure with four rings. B) Sterols are found in the membranes of all living cells. C) Sterols are soluble in water, but less so in organic solvents such as chloroform. D) Cholesterol is the principal sterol in fungi. E) The principal sterol of animal cells is ergosterol.
A
Which statement concerning fatty acids is CORRECT? A) A fatty acid is the precursor of prostaglandins. B) Phosphatidic acid is a common fatty acid. C) Fatty acids all contain one or more double bonds. D) Fatty acids are a constituent of sterols. E) Fatty acids are strongly hydrophilic.A
A
Which statement describes a distinct difference between membrane lipids in archaea and membrane lipids in eukarya? A) Archaeal membrane lipids have alkyl acids that are ether-linked to glycerol at both ends. B) Eukaryotic membrane lipids consist of glycerol that is ester-linked to three fatty acids. C) Only eukaryotic membrane lipids are amphipathic. D) Archaeal membrane lipids always contain sphingosine. E) Eukaryotic membrane lipids always have a phosphate group attached to glycerol.
A
Which statement is TRUE of sphingolipids? A) Cerebrosides and gangliosides are sphingolipids. B) Phosphatidylcholine is a typical sphingolipid. C) They always contain glycerol and fatty acids. D) They contain two esterified fatty acids. E) They may be charged, but are never amphipathic.
A
Which technique would you NOT use to separate and/or analyze lipids in a laboratory? A) gel electrophoresis B) thin-layer chromatography C) adsorption chromatography D) mass spectrometry E) high-performance liquid chromatography (HPLC)
A
Which term BEST describes the cholesterol molecule? A) amphipathic B) nonpolar, charged C) nonpolar, uncharged D) polar, charged E) polar, uncharged
A
ncubation of DNA at low pH is MOST likely to cause: A) depurination. B) depyrimidination. C) mutation of cytosine to uracil. D) hydrolysis of the phosphodiester bond. E) deamination of adenine and guanine.
A
Which of the following is true regarding metabolic pathways? (A) Metabolic pathways consist of a series of reactions, each catalyzed by a different enzyme. (B) Each reaction in the pathway is catalyzed by the same enzyme. (C) Metabolic pathways consist of only anabolic pathways. (D) Metabolic pathways consist of a single chemical reaction. (E) Metabolic pathways are not important to a cell's ability to function.
A REASON: A metabolic pathway begins with a specific molecule that is then altered in a series of defined steps, resulting in a certain product. Each step of the pathway is catalyzed by a specific enzyme. Metabolic pathways consist of a series of chemical reactions. Each reaction in a metabolic pathway is catalyzed by a different enzyme.
If an enzyme in solution is saturated with substrate, the most effective way to obtain a faster yield of products is to (A) add more of the enzyme. (B) heat the solution to 90°C. (C) add more substrate. (D) add a noncompetitive inhibitor.
A REASON: Since it's already saturated with substrates, you need enzymes to counterbalance the number of substrates and to also increase the rate of reaction (turning substrates => products).
Much of the suitability of ATP as an energy intermediary is related to the instability of the bonds between the phosphate groups. These bonds are unstable because __________. (A) the negatively charged phosphate groups vigorously repel one another and the terminal phosphate group is more stable in water than it is in ATP (B) the valence electrons in the phosphorus atom have less energy on average than those of other atoms (C) the bonds between the phosphate groups are unusually strong and breaking them releases free energy (D) they are hydrogen bonds, which are only about 10% as strong as covalent bonds (E) the phosphate groups are polar and are attracted to the water in the cell's interior
A REASON: Unstable = high energy. Negative charges repel each other. Loss of the terminal phosphate removes some of the repulsion.
What is the type of symmetry that relates the protomers in hemoglobin with respect to each other? A) C2 B) C4 C) D2 D) D4 E) Tetrahedral symmetry
A - C2 symmetry relates to hb protomers
Which of the following polysaccharides cannot be digested by mammalian salivary, gastric, or pancreatic enzymes? A) cellulose B) amylopectin C) amylose D) glycogen E) starch
A - Cellulose Neither can chitin
Which of the following is not a ligand to the porphyrin ring Fe(II) ion in oxymyoglobin? A) His E7 B) His F8 C) Nitrogen atoms in the porphyrin ring D) Oxygen E) all are ligands
A - His E7 not a ligand
O- (no antigens) can be received without being agglutinated by recipient antibodies
A 57-year-old man is brought into the emergency department with severe trauma due to a gunshot wound to the upper right quadrant of his abdomen. He is bleeding profusely and needs an immediate transfusion of blood. Since this is an emergency and there is no time to do a blood typing screen, which blood type can you give this patient? Why can this blood type be used?
A D-amino acid would interrupt an alpha helix made of L-amino acids. Another naturally occurring hindrance to the formation of an alpha helix is the presence of:
A Pro residue.
A hydropathy plot is used to: A) determine the water-solubility of a protein. B) deduce the quaternary structure of a membrane protein. C) determine the water content of a native protein. D) extrapolate for the true molecular weight of a membrane protein. E) predict whether a given protein sequence contains membrane-spanning segments.
A hydropathy plot is used to: E) predict whether a given protein sequence contains membrane-spanning segments.
The size of the DNA region specifically recognized by Type II restriction enzymes is typically: A) 4 to 6 base pairs. B) 10 to 15 base pairs. C) 50 to 60 base pairs. D) 200 to 300 base pairs. E) about the size of an average gene.
A) 4 to 6 base pairs.
The size of the DNA region specifically recognized by type II restriction enzymes is typically: A) 4 to 6 base pairs. B) 10 to 15 base pairs. C) 50 to 60 base pairs. D) 200 to 300 base pairs. E) about the size of an average gene
A) 4 to 6 base pairs.
Which vitamin is derived from cholesterol?
A) A B) B12 C) D D) E E) K C
Which of the following is not a fat-soluble vitamin?
A) A B) C C) D D) E E) K B
What is a significant problem with regard to making cDNA libraries to analyze overall gene function in an eukaryotic organism? A) A cDNA library will only contain genes that are actively transcribed in the organism. B) Reverse transcriptase cannot be used to make cDNA libraries. C) cDNA cannot be amplified by PCR. D) cDNA libraries do not contain intron sequences. E) cDNA libraries may contain several alternatively spliced forms of the same gene.
A) A cDNA library will only contain genes that are actively transcribed in the organism.
Which statement concerning fatty acids is CORRECT? A) A fatty acid is the precursor of prostaglandins. B) Phosphatidic acid is a common fatty acid. C) Fatty acids all contain one or more double bonds. D) Fatty acids are a constituent of sterols. E) Fatty acids are strongly hydrophilic.
A) A fatty acid is the precursor of prostaglandins.
Which statement about facilitated diffusion across a membrane is TRUE? A) A specific membrane protein lowers the activation energy for movement of the solute through the membrane. B) It can increase the size of a transmembrane concentration gradient of the diffusing solute. C) It is impeded by the solubility of the transported solute in the nonpolar interior of the lipid bilayer. D) It is responsible for the transport of gases such as O2, N2, and CH4 across biological membranes. E) The rate is not saturable by the transported substrate.
A) A specific membrane protein lowers the activation energy for movement of the solute through the membrane.
Which statement about sterols is TRUE? A) All sterols share a fused-ring structure with four rings. B) Sterols are found in the membranes of all living cells. C) Sterols are soluble in water, but less so in organic solvents such as chloroform. D) Cholesterol is the principal sterol in fungi. E) The principal sterol of animal cells is ergosterol.
A) All sterols share a fused-ring structure with four rings.
Which of the following statements about sterols is true?
A) All sterols share a fused-ring structure with four rings. B) Sterols are found in the membranes of all living cells. C) Sterols are soluble in water, but less so in organic solvents such as chloroform. D) Stigmasterol is the principal sterol in fungi. E) The principal sterol of animal cells is ergosterol. A
Which statement describes a distinct difference between membrane lipids in archaea and membrane lipids in eukarya? A) Archaeal membrane lipids have alkyl acids that are ether-linked to glycerol at both ends. B) Eukaryotic membrane lipids consist of glycerol that is ester-linked to three fatty acids. C) Only eukaryotic membrane lipids are amphipathic. D) Archaeal membrane lipids always contain sphingosine. E) Eukaryotic membrane lipids always have a phosphate group attached to glycerol.
A) Archaeal membrane lipids have alkyl acids that are ether-linked to glycerol at both ends.
Which of the following molecules or substances contain, or are derived from, fatty acids?
A) Beeswax B) Prostaglandins C) Sphingolipids D) Triacylglycerols E) All of the above contain or are derived from fatty acids. E
42. D-Allose is an aldohexose. Methylation of which hydroxyl group on β-D-allopyranose prevents the molecule from mutarotating to α-D-allopyranose? A) C1 B) C2 C) C3 D) C4 E) C5
A) C1
Which of the following contains an ether-linked alkyl group?
A) Cerebrosides B) Gangliosides C) Phosphatidyl serine D) Platelet-activating factor E) Sphingomyelin D
Which statement is TRUE of sphingolipids? A) Cerebrosides and gangliosides are sphingolipids. B) Phosphatidylcholine is a typical sphingolipid. C) They always contain glycerol and fatty acids. D) They contain two esterified fatty acids. E) They may be charged, but are never amphipathic.
A) Cerebrosides and gangliosides are sphingolipids.
Which of the following is true of sphingolipids
A) Cerebrosides and gangliosides are sphingolipids. B) Phosphatidylcholine is a typical sphingolipid. C) They always contain glycerol and fatty acids. D) They contain two esterified fatty acids. E) They may be charged, but are never amphipathic. A
Which of the following is not true of sterols?
A) Cholesterol is a sterol that is commonly found in mammals. B) They are commonly found in bacterial membranes. C) They are more common in plasma membranes than in intracellular membranes (mitochondria, lysosomes, etc.). D) They are precursors of steroid hormones. E) They have a structure that includes four fused rings. B
Which statement about the composition of biological membranes is FALSE? A) In a given eukaryotic cell type (e.g., a hepatocyte), all intracellular membranes have essentially the same complement of lipids and proteins. B) The carbohydrate found in membranes is virtually all part of either glycolipids or glycoproteins. C) The plasma membranes of the cells of vertebrate animals contain more cholesterol than the mitochondrial membranes. D) The ratio of lipid to protein varies widely among cell types in a single organism. E) Triacylglycerols are not commonly found in membranes.
A) In a given eukaryotic cell type (e.g., a hepatocyte), all intracellular membranes have essentially the same complement of lipids and proteins
Which statement describes a general feature of the lipid bilayer in all biological membranes? A) Individual lipid molecules are free to diffuse laterally in the surface of the bilayer. B) Individual lipid molecules in one face (monolayer) of the bilayer readily diffuse (flip-flop) to the other monolayer. C) Polar, but uncharged, compounds readily diffuse across the bilayer. D) The bilayer is stabilized by covalent bonds between neighboring phospholipid molecules. E) The polar head groups face inward toward the inside of the bilayer.
A) Individual lipid molecules are free to diffuse laterally in the surface of the bilayer.
Which of the following statements is true of lipids?
A) Many contain fatty acids in ester or amide linkage. B) Most are simply polymers of isoprene. C) Testosterone is an important sphingolipid found in myelin. D) They are more soluble in water than in chloroform. E) They play only passive roles as energy-storage molecules. B
Membrane lipids in tissue samples obtained from different parts of the leg of an arctic reindeer have different fatty acid compositions. Logically, what difference would you predict? A) Membrane lipids from tissue near the hooves (feet) contain a greater proportion of unsaturated fatty acids relative to that in the upper leg. B) Membrane lipids from tissue in the upper leg contain a greater proportion of unsaturated fatty acids relative to that in the hooves (feet). C) Both answers A and B are equally likely. D) Neither answer A nor B is likely.
A) Membrane lipids from tissue near the hooves (feet) contain a greater proportion of unsaturated fatty acids relative to that in the upper leg.
Which of the following statements concerning fatty acids is correct?
A) One is the precursor of prostaglandins. B) Phosphatidic acid is a common one. C) They all contain one or more double bonds. D) They are a constituent of sterols. E) They are strongly hydrophilic. A
7. A) List and explain the function of the ingredients required for a PCR reaction. B) Describe the steps of each cycle of PCR. (C) What are the two 5 nucleotides primers required to amplify the following dsDNA between the two sets of the ^ marks? (6%) 5'CATGC^GCATG------------------------------------------------------GCCGT^AATGC3' 3'GTACG^CGTAC-------------------------------------------------------CGGCA^TTACG5'
A) PCR reactions need a template DNA molecule containing a region to be amplified, synthetic DNA oligonucleotide primers to serve as the starting point for DNA polymerase to extend the template, dNTPs that serve as the raw materials to be added to the growing nucleotide chains and the energy for the reaction, and a thermostable DNA polymerase to catalyze 5¢ to 3¢ DNA synthesis. B) Step 1: Template denaturation is done at a high temperature; Step 2: the temperature of the reaction is lowered for primers to anneal to the template DNA; Step 3: the temperature is raised to the optimum temperature for the Taq (or other thermostable) DNA polymerase to catalyze DNA synthesis. (C) 5' GCATG3' and 5'ACGGC3'
Which statement is TRUE for passive transport across a biological membrane? A) Passive transport is driven by a solute electrochemical gradient. B) Passive transport is driven by ATP. C) Passive transport is irreversible. D) Passive transport is driven by both a solute electrochemical gradient ATP. E) Passive transport is driven by a solute electrochemical gradient and is irreversible.
A) Passive transport is driven by a solute electrochemical gradient.
Which of the following statements about PCR is (are) true?
A) Small amounts of DNA can be easily amplified to millions of copies. B) PCR is used in forensic and clinical diagnosis. C) PCR reaction products can be used in cloning
Which statement does NOT describe a process by which the specificity of aquaporins is ensured? A) The channel contains a negatively charged Asp residue to scavenge protons and H3O+. B) The diameter of the channel narrows to 2.8 Å. C) There are carbonyl backbone residues in the channel that hydrogen bond with water. D) Arg and His residues in the channel repel protons and H3O+. E) Electric dipoles of short a helices repel protons and H3O+
A) The channel contains a negatively charged Asp residue to scavenge protons and H3O+.
Which statement BEST describes how the volatility of lipids is increased for analysis by gas chromatography? A) The lipids are transesterified to convert fatty acids into fatty acid methyl esters. B) The lipids are cleaved with phospholipase enzymes . C) The lipids are degraded by treatment with mild acid or base. D) The lipids are dissolved in chloroform. E) The lipids are desaturated by reaction with a platinum catalyst.
A) The lipids are transesterified to convert fatty acids into fatty acid methyl esters.
Which statement is generally TRUE of integral membrane proteins? A) The secondary structure in the transmembrane region consists solely of a helices or b sheets. B) The domains that protrude on the cytoplasmic face of the plasma membrane nearly always have covalently attached oligosaccharides. C) They are unusually susceptible to degradation by trypsin. D) They can be removed from the membrane with high salt or mild denaturing agents. E) They undergo constant rotational motion that moves a given domain from the outer face of a membrane to the inner face and then back to the outer.
A) The secondary structure in the transmembrane region consists solely of a helices or b sheets.
Which statement is FALSE regarding the major facilitator superfamily of transporters? A) These proteins are all secondary active transporters. B) Both GLUT1 and lactose permease belong to this family. C) These proteins contain two domains within the membrane. D) These proteins contain 12 or 14 transmembrane a helices
A) These proteins are all secondary active transporters.
Syndecans are proteoglycans that have glycosaminoglycans attached to the N-terminal domain, a single transmembrane helix and a C-terminal domain that can be phosphorylated. What type of membrane proteins are these? A) Type I B) Type II C) Type III D) Type IV E) Type V
A) Type I
Which of the following techniques is not commonly used to study oligosaccharide structures? A) X-ray crystallography B) Matrix-assisted laser desorption/ionization mass spectroscopy (MALDI-MS) C) Nuclear magnetic resonance (NMR) D) Complete chemical synthesis E) Oligosaccharide microarrays
A) X-ray crystallography
A method of comparing the relative gene expression of all the genes in an organism at two different stages of its development is: A) a DNA microarray. B) yeast two-hybrid analysis. C) tandem affinity purification. D) immunofluorescence. E) quantitiative PCR.
A) a DNA microarray.
Which method of visualizing a protein's location should you use if you want to determine its location in a living cell? A) a GFP fusion tag B) immunofluorescence C) qPCR D) Gram stain E) affinity purification
A) a GFP fusion tag
Peripheral membrane proteins: A) are generally noncovalently bound to membrane lipids. B) are usually denatured when released from membranes. C) can be released from membranes only by treatment with detergent(s). D) may have functional units on both sides of the membrane. E) penetrate deeply into the lipid bilayer.
A) are generally noncovalently bound to membrane lipids.
38. The sialic acids A) are important constituents of glycoproteins and glycolipids. B) are N-acetyl glucosamine derivatives. C) incorporate a succinic acid derivative. D) all of the above E) none of the above
A) are important constituents of glycoproteins and glycolipids.
Sphingosine is not a component of:
A) cardiolipin. B) ceramide. C) cerebrosides. D) gangliosides. E) sphingomyelin. A
Fatty acids are a component of
A) carotenes. B) cerebrosides. C) sterols. D) vitamin D. E) vitamin K. B
47. Which of the following polysaccharides cannot be digested by mammalian salivary, gastric, or pancreatic enzymes? A) cellulose B) amylopectin C) amylose D) glycogen E) starch
A) cellulose
Bile acids are derived from which lipid? A) cholesterol B) sphingomyelin C) ceramide D) digalactosyldiacylglycerol E) phosphatidylcholine
A) cholesterol
Recombinant DNA technology can be used for
A) constructing mutant proteins B) the industrial production of useful proteins C) producing transgenic organisms D) correcting genetic defects ALL
The specificity of the potassium channel for K+ over Na+ is mainly the result of the: A) differential interaction with the selectivity filter protein. B) hydrophobicity of the channel. C) phospholipid composition of the channel. D) presence of carbohydrates in the channel. E) presence of cholesterol in the channel.
A) differential interaction with the selectivity filter protein.
Facilitated diffusion through a biological membrane is: A) driven by a difference of solute concentration. B) driven by ATP. C) endergonic. D) generally irreversible. E) not specific with respect to the substrate
A) driven by a difference of solute concentration.
Which technique is NOT used to make a cDNA library? A) extraction of DNA from the organism you are studying B) extraction of mRNA from the organism you are studying C) use of reverse transcriptase to copy RNA into DNA D) ligation of DNA into a cloning vector E) insertion of a cloning vector into cells
A) extraction of DNA from the organism you are studying
Tay-Sachs disease is the result of a genetic defect in the metabolism of: A) gangliosides. B) phosphatidyl ethanolamine. C) sterols. D) triacylglycerols. E) vitamin D.
A) gangliosides.
Which technique would you NOT use to separate and/or analyze lipids in a laboratory? A) gel electrophoresis B) thin-layer chromatography C) adsorption chromatography D) mass spectrometry E) high-performance liquid chromatography (HPLC)
A) gel electrophoresis
Which compound is NOT needed to build a cDNA library? A) genomic DNA B) mRNA C) reverse transcriptase D) dNTPs E) DNA polymerase
A) genomic DNA
***Compounds that function as 'mixed inhibitors'
A) interfere with substrate binding to the enzyme B) bind to the enzyme reversibly C) can bind to the enzyme/substrate complex D) all of the above
Conserved gene order observed in the chromosomes of two distantly related organisms provides evidence of a(n) _____ relationship between genes. A) orthologous B) homologous C) paralogous D) analogous E) genologous
A) orthologous
A(n) _____ would NOT used as a heterologous host for the expression of recombinant proteins/ A) retrovirus B) bacterium such as E. coli C) eukaryote such as S. cerevisiae D) insect cell E) mammalian cell
A) retrovirus
Which statement about actin is correct? Actin is expressed only in muscle. Actin is expressed at low levels in most cells. No known function has been described for actin in nonmuscle cells. Nonmuscle cells only contain G actin. Actin is the most abundant cytoplasmic protein in many cell types.
Actin is the most abundant cytoplasmic protein in many cell types.
Which factor MOST significantly determines the direction in which an ion moves through an ion channel in a membrane? A) the electrochemical gradient across the membrane B) the size and shape of the channel C) the ion selectivity of the channel. D) both the electrochemical gradient across the membrane and the size and shape of the channel E) both the size and shape of the channel and the ion selectivity of the channel
A) the electrochemical gradient across the membrane
If you want to determine which proteins might be interacting in a cell, which technique would you use to examine the interaction in a living cell? A) yeast two-hybrid analysis B) immunoprecipitation C) a DNA microarray D) immunofluorescence E) comparative genomics
A) yeast two-hybrid analysis
54. Starch is a mixture of A) α-amylose and amylopectin. B) glycogen and amylopectin. C) glycogen and α-amylose. D) glycogen and cellulose. E) α-amylose and maltose.
A) α-amylose and amylopectin.
Sphingolipids can contain of all of the following except?
A)glycerol. B) sphingosine. C) phosphate. D) a mono- or oligosaccharide. A
Carbon monoxide binds to heme: A) with a higher affinity than oxygen. B) resulting in the oxidation of the Fe(II) to Fe(III) C) in a manner that displaces carbon dioxide, causing CO2 poisoning. D) from the side opposite oxygen, resulting in a brown colored heme. E) with a lower affinity than oxygen.
A- CO binds to heme higher then O2
Max Perutz's investigation of the structure of hemoglobin primarily utilized_____. A) X-ray crystallography B) NMR spectroscopy C) genomics D) mass spectrometry E) genetic engineering
A- x ray crys looked at Hb sturcuture
(a) What kinds of forces or bonds anchor an integral membrane protein in a biological membrane? (b) What forces hold a peripheral membrane protein to the membrane? (c) What might one do to solubilize each of the two types of membrane proteins?
A. Hydrophobic interactions between hydrophobic domans of the protein and the fatty acid of the bilayer b. hydrogen bonds between charged and polar side chains c. use detergents,convdrting membranes to micelles
Which statement about myosin is not true? Myosin is a heterohexamer. Myosin contains two globular heads. Myosin contains six different polypeptides Myosin aggregates to form thick filaments All of the answers above are true of myosin
All of the answers above are true of myosin
Common problems with expression of eukaryotic proteins in bacteria may include proteins:
All of the answers are correct
Binding energy between an enzyme and a substrate contribute to catalysis in which way?
All of the answers are correct.
Which attribute contributes to water's unusual properties?
All of the answers are correct.
Which statement describes a function of the addition of methyl groups to DNA?
All of the statements describe a function of DNA methylation.
Which molecules or substances contain, or are derived from, fatty acids?
All of these contain or are derived from fatty acids.
Which positions in the purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?
All purine ring nitrogens (N-1, N-3, N-7, and N-9) have the potential to form hydrogen bonds (see Figs 8-1, 8-11, and 2-3). However, N-1 is involved in Watson-Crick hydrogen bonding with a pyrimidine, and N-9 is involved in the N-glycosyl linkage with deoxyribose and has very limited hydrogen-bonding capacity. Thus, N-3 and N-7 are available to form further hydrogen bonds.
Which statement about sterols is TRUE?
All sterols share a fused-ring structure with four rings.
What are the similarities and differences between integrins, cadherins, and selectins?
All three are families of integral membrane proteins that are involved in cell adhesion. Integrins mediate cell adhesion to proteins of the extracellular matrix. Cadherins and selectins mediate cell-cell adhesion the former by interaction with cadherins on the surface of other cells, the latter by interaction with polysaccharides on the surface of other cells.
What is the difference between Allosteric Activators and Allosteric Inhibitors?
Allosteric Activators shift the conformation of the enzyme to make the active site more available for substrate binding. Allosteric Inhibitors shift the conformation of the enzyme to make the active site less available for substrate binding. They both can alter the activity of the enzyme.
What type of enzymes often display sigmoidal plots of activity versus substrate concentration?
Allosteric enzymes
What is the purpose of the Allosteric Site?
Allosteric means "Other". So, the Allosteric site is the other site that regulates the availability of the active site. The Allosteric site is the location for an Inhibitor or activator molecule.
Phospholipids are amphipathic molecules. Show how this property accounts for the impermeability of biological membranes to polar compounds and ions.
Amphipathic molecules, with both hydrophobic and hydrophilic domains, when placed in water tend to arrange themselves in a way that minimizes contact of their hydrophobic domains with water. One structure that accomplishes this is the lipid bilayer where hydrophobic fatty acyl chains point toward the center of the bilayer, forming a hydrophobic layer about 3 nm thick with the polarity of hexane. This lipid bilayer is impermeable to polar and charged compounds because it is energetically costly for these compounds to give up their favorable interactions with the polar solvent water and to dissolve in the lipid bilayer.
Polysaccharides that are digested by mammalian salivary, gastric, or pancreatic enzymes?
Amylopectin, amylose, glycogen, and starch
what is an Allosteric Enzyme?
An enzyme with multiple binding sites, an Active site and an Allosteric Site. Allosteric enzymes can alternate between active & inactive forms.
The binding of one O2 to a molecule of hemoglobin results in: A decrease in hemoglobin's ability to bind a second O2. The release of any other O2 that may have bound earlier. Dissociation of the hemoglobin subunits. The movement of hemoglobin to an organism's muscle tissue. An increased affinity for O2 in the remaining subunits (which have not yet bound O2).
An increased affinity for O2 in the remaining subunits (which have not yet bound O2). When hemoglobin is in the T state, binding of oxygen to one subunit triggers a global change in conformation. This increases the affinity of the remaining subunits for oxygen
a) What is meant by the transition temperature of a membrane? List the two characteristics of the fatty acids in a biological membrane that affect the transition temperature. Using or , show in which direction an increase in these characteristics would change the transition temperature.
Ans. (a) the transition temperature of a membrane is the temperature at which its structure changes from a paracyrstalline solid to a liquid state. (b) The two characteristics of of fatty acids that directly affect Tt are degree of unsaturation (down) and chain length (up).
The pitch of an alpha helix is 5.4 A per turn, and there are 3.6 amino acid residues per turn. If the thickness of the lipid bilayer is 30 A, how many amino acid residues are required in an alpha helix that is just long enough to span the lipid bilayer?
Ans. If the pitch is 5.4 A/turn and there are 3.6 residues per turn, then each residue lengthens the helix by 5.4/ 3.6 = 1.5 A/residue. Dividing 30 A by 1.5 A/residue gives a value of 20 residues necessary to span the lipid bilayer.
Draw a hydropathy plot for a hypothetical integral membrane protein with 3 transmembrane segments and containing 190 amino acids. Be sure to label the x- and y-axes appropriately, including numerical values.
Ans. The plot should have a y-axis that is labeled "hydropathy index" and an x-axis that is labeled "residue number" or "position in the protein." The y-axis should have values from + 3 to - 3; the x-axis should have an integral number that has a range of zero to several hundred. The plot should show three distinct peaks corresponding to the 3 transmembrane segments.
What chemical features distinguish a plasmalogen from a common glycerophospholipid?
Ans: (1) The long-chain acyl group attached to C-1 of glycerol is ether-linked in a plasmalogen, but is an ester-linked fatty acyl group in typical glycerophospholipids. (2) There is a double bond between C-1 and C-2 of this fatty acyl chain in plasmalogens, but not in other phospholipids. (See Fig. 10-10, p. 351.)
What are three differences between ion channels and ion transporters?
Ans: (1) The rate of ion movement through channels is much greater; (2) ion transporters exhibit saturation, whereas ion channels do not; (3) ion channels open and close in response to external stimuli or events such as ligand-binding or changes in electrical potential across the membrane.
Circle the fatty acid in each pair that has the higher melting temperature. (a) 18:19 18:29,12 (b) 18:0 18:19 (c) 18:0 16:0
Ans: (a) 18:19 (b) 18:0 (c) 18:0
Distinguish between simple diffusion (SD), facilitated diffusion (FD), and active transport (AT) across a membrane for the following questions (more than one may be true). (a) Which processes are energy dependent? (b) Which processes need some kind of carrier protein(s)? (c) Which processes can be saturated by substrate? (d) Which processes can establish a concentration gradient? (e) How much energy does it take to transport an uncharged substrate in, if its starting inside concentration is 10-fold greater than outside?
Ans: (a) AT only; (b) FD and AT; (c) FD and AT; (d) AT only; (e) 5.7 kJoules/mole
(a) Define the term amphipathic. (b) Diagram two types of assemblies that amphipathic molecules form in water. (c) What are the forces that contribute to the formation of the structures diagrammed in (b)?
Ans: (a) Amphipathic means having one region that is polar and another that is nonpolar. (b) The two common structures formed by lipids in water are micelles and bilayers. (See Fig. 11-4, p. 374.) (c) These lipid aggregates in water are stabilized by the energy gain from burying hydrophobic groups out of contact with water. When a hydrophobic chain is surrounded by water, it forces the formation of a cage of immobilized water molecules around it. When several hydrophobic regions cluster, the surface area exposed to water decreases, and the water molecules in the cage are released, with a gain in entropy that drives the formation of the lipid aggregates.
(a) What kinds of forces or bonds anchor an integral membrane protein in a biological membrane? (b) What forces hold a peripheral membrane protein to the membrane? (c) What might one do to solubilize each of the two types of membrane proteins?
Ans: (a) The forces that hold integral membrane proteins in the membrane are hydrophobic interactions between hydrophobic domains of the protein and the fatty acyl chains of the bilayer interior. (b) Peripheral membrane proteins associate with membranes primarily through ionic interactions and hydrogen bonds between charged and polar side chains of the protein and polar head groups of membrane lipids. Some peripheral membrane proteins contain a covalently bound lipid that anchors them to the bilayer. (c) To remove integral membrane proteins, it is generally necessary to use detergents, which convert membranes into "soluble" micelles. Peripheral membrane proteins can often be released by extraction with buffers of high or low salt concentration, high or low pH, or low concentrations of divalent cations.
Working with lipids Pages: 377-379 Difficulty: 2: Which of the following techniques is not commonly used to analyze lipid composition? A) Selective extraction using apolar solvents B) Adsorption chromatography C) X-ray crystallography D) Hydrolysis using enzymes with specificity for certain linkages E) Mass spectroscopy
Ans: C C) X-ray crystallography
In cells, fatty acids are stored as triacylglycerols for energy reserves. (a) What is the molecule to which fatty acids are esterified to form triacylglycerols? (b) Define the logic behind cells storing fatty acids in esterified form.
Ans: (a) Three fatty acids are esterified to glycerol. (b) Triacylglycerols are uncharged and insoluble in water. They form lipid droplets within adipocytes, which do not contribute to the osmolarity of the cytosol in those cells, and do not require any water of hydration.
(a) When relatively high concentrations of fatty acids are suspended in water, they form structures known as ________. (b) When relatively high concentrations of membrane phospholipids are dissolved in water, they form structures known as ________. (c) Why are the structures listed in your answers to (a) and (b) above energetically favored?
Ans: (a) micelles. (b) bilayers. (c) Micelles are favored when the polar head group has a greater cross-sectional area than the nonpolar acyl chain, making the molecule wedge-shaped; bilayers are favored when the cross-sectional area of head group and acyl chain(s) are about the same, so that the molecule is cylindrical. (See Fig. 11-4, p. 374.)
(a) List the major components of membranes. (b) When a preparation of mitochondrial membranes was treated with high salt (0.5 M NaCl), it was observed that 40% of the total protein in this preparation was solubilized. What kind of membrane proteins are in this soluble extract, and what forces normally hold them to the membrane? (c) What kind of proteins constitute the insoluble 60%, and what forces hold these proteins in the membrane?
Ans: (a) phospholipids, sterols, proteins (integral and peripheral); (b) peripheral membrane proteins, which are associated with the membrane through ionic and hydrogen bonds between their charged and polar side chains and the charged head groups of phospholipids; (c) integral membrane proteins (which are held to the membrane by hydrophobic interactions between their nonpolar side chains and the hydrophobic fatty acyl chains of phospholipids), and those peripheral membrane proteins that are held to the membrane by a covalent lipid anchor.
(a) Explain why phosphoglycerides are capable of spontaneously assembling into the bilayer structure found in biological membranes but triacylglycerols are not. (b) What are the forces that drive bilayer formation?
Ans: (a): Triacylglycerols have three fatty acyl groups in ester linkage with glycerol; they are very hydrophobic because the carboxyl groups, which are involved in the ester linkages, cannot ionize. Phosphoglycerides have a polar region at their head group, where a phosphate in a phosphodiester linkage bears a full negative charge. The head group itself (serine, ethanolamine, choline, etc.) may also be charged and is polar in any case. Thus, the phospholipid is amphipathic, having both polar and nonpolar regions, and it forms lipid bilayers spontaneously in water. (b) These lipid bilayers are stabilized by the energy gained from burying hydrophobic groups out of contact with water. A hydrophobic chain in water forces the formation of a cage of immobilized water molecules around it. When several hydrophobic regions cluster in a bilayer, the surface area exposed to water decreases, and the water molecules in the cage are released, accompanied by a gain in entropy that drives the formation of the bilayer.
Storage Lipids Pages: 357-359 Difficulty: 2 Which of the following statements concerning fatty acids is correct? A. A fatty acid is the precursor of prostaglandins. B. Phosphatidic acid is a common fatty acid. C. Fatty acids all contain one or more double bonds. D. Fatty acids are a constituent of sterols. E. Fatty acids are strongly hydrophilic.
Ans: A A. A fatty acid is the precursor of prostaglandins.
Structural lipids in membranes Pages: 368-370 Difficulty: 2 Which of the following statements about sterols is true? A. All sterols share a fused-ring structure with four rings. B. Sterols are found in the membranes of all living cells. C. Sterols are soluble in water, but less so in organic solvents such as chloroform. D. Cholesterol is the principal sterol in fungi. E. The principal sterol of animal cells is ergosterol.
Ans: A A. All sterols share a fused-ring structure with four rings.
Structural lipids in membranes Page: 368 Difficulty: 2 Which of the following best describes the cholesterol molecule? A. Amphipathic B. Nonpolar, charged C. Nonpolar, uncharged D. Polar, charged E. Polar, uncharged
Ans: A A. Amphipathic
Structural lipids in membranes Pages: 366-367 Difficulty: 2 Which of the following is true of sphingolipids? A. Cerebrosides and gangliosides are sphingolipids. B. Phosphatidylcholine is a typical sphingolipid. C. They always contain glycerol and fatty acids. D. They contain two esterified fatty acids. E. They may be charged, but are never amphipathic.
Ans: A A. Cerebrosides and gangliosides are sphingolipids.
Structural lipids in membranes Pages: 362-363 Difficulty: 2 Sphingosine is not a component of: A. cardiolipin. B. ceramide. C. cerebrosides. D. gangliosides. E. sphingomyelin.
Ans: A A. cardiolipin.
Structural lipids in membranes Page: 369 Difficulty: 2 Tay-Sachs disease is the result of a genetic defect in the metabolism of: A. gangliosides. B. phosphatidyl ethanolamine. C. sterols. D. triacylglycerols. E. vitamin D.
Ans: A A. gangliosides.
What chemical features distinguish a cerebroside from a ganglioside?
Ans: A cerebroside has a single sugar residue joined to ceramide; a ganglioside has an oligosaccharide joined to ceramide. (See Fig. 10-13, p. 353.)
Explain why nonpolar compounds are generally able to diffuse across biological membranes without the aid of a specific transport system.
Ans: A nonpolar compound is more soluble in nonpolar solutes, such as benzene or chloroform, than in polar solvents such as water. They generally pass through biological membranes unaided because it is energetically favorable for them to move from the aqueous solvent into the nonpolar region of the bilayer interior.
What are the chemical components of a biological wax, and what is their general structure?
Ans: A wax consists of a long-chain fatty acid in ester linkage with a long-chain fatty alcohol. (See Fig. 10-5, p. 348.)
Show the basic structure of all glycerophospholipids.
Ans: All glycerophospholipids have two fatty acids in ester linkage with C-1 and C-2 of glycerol; often the fatty acid at C-1 is saturated, and that at C-2 is unsaturated. C-3 of glycerol is joined to an alcohol-containing head group through a phosphodiester linkage, which is negatively charged at neutral pH. (See Fig. 10-9, p. 351.)
Which compound can be cleaved in half to generate a molecule important in vision? A) calcitol B) beta-carotene C) arachidonic acid D) tocopherol E) isoprene
B) beta-carotene
Describe the dependence of the melting point of a fatty acid upon (a) chain length and (b) unsaturation; (c) explain these dependencies in molecular terms.
Ans: All other things being equal, (a) the longer the acyl chain, the higher the melting temperature; and (b) the more unsaturation, the lower the melting temperature. (c) The melting temperature is a measure of the thermal energy needed to break the intermolecular interactions that stabilize the "solid" form of a lipid, which depends upon how well the individual lipid molecules fit into the nearly crystalline array of lipids. When a shorter acyl chain lies between two longer chains in a nearly crystalline array of lipid molecules, there is a cavity at the end of the short acyl group that allows freer motion to the neighboring acyl chains. A cis double bond introduces a "kink" into the acyl chain, so that it does not pack as easily with its straighter neighbors.
What are the similarities and differences between integrins, cadherins, and selectins?
Ans: All three are families of integral membrane proteins that are involved in cell adhesion. Integrins mediate cell adhesion to proteins of the extracellular matrix. Cadherins and selectins mediate cell-cell adhesion the former by interaction with cadherins on the surface of other cells, the latter by interaction with polysaccharides on the surface of other cells.
Phospholipids are amphipathic molecules. Show how this property accounts for the impermeability of biological membranes to polar compounds and ions.
Ans: Amphipathic molecules, with both hydrophobic and hydrophilic domains, when placed in water tend to arrange themselves in a way that minimizes contact of their hydrophobic domains with water. One structure that accomplishes this is the lipid bilayer where hydrophobic fatty acyl chains point toward the center of the bilayer, forming a hydrophobic layer about 3 nm thick with the polarity of hexane. This lipid bilayer is impermeable to polar and charged compounds because it is energetically costly for these compounds to give up their favorable interactions with the polar solvent water and to dissolve in the lipid bilayer.
What is an amphipathic compound? Explain how such compounds contribute to the structure of biological membranes.
Ans: An amphipathic compound has one region or domain that is hydrophilic and another that is hydrophobic. When added to water, amphipathic compounds tend to arrange in a way that exposes their hydrophilic regions to the solvent and hides their hydrophobic domains. One structure that accomplishes this is the lipid bilayer, which forms spontaneously with phospholipids in water. (See Fig. 11-4, p. 374)
The bacterium E. coli can grow at 20 °C or at 40 °C. At which growth temperature would you expect the membrane phospholipids to have a higher ratio of saturated to unsaturated fatty acids, and why?
Ans: At 40 °C, the membranes of E. coli will contain more saturated fatty acids than at 20 °C. The cell regulates fatty acid composition to achieve the same fluidity in its membranes, regardless of growth temperature. Saturated fatty acids counterbalance the fluidizing effect of high temperature.
Storage Lipids Page: 361 Difficulty: 2 Which of the following is not a consequence of partial hydrogenation of vegetable oils? A) Longer shelf life B) Lower melting temperature C) Reduction of some cis double bonds to single bonds D) Conversion of some cis double bonds to trans double bonds E) Increased risk of cardiovascular disease upon consumption by humans
Ans: B B) Lower melting temperature
Structural lipids in membranes Page: 368 Difficulty: 2 Which of the following answers is not true? A) Phospholipase A1 hydrolyzes the fatty acid from the 1-position on the glycerol backbone. B) Phospholipase B1 hydrolyzes the fatty acid from the 2-position on the glycerol backbone. C) Phospholipase C hydrolyzes the complete phospho-head group from the glycerol backbone. D) Phospholipase D hydrolyzes just the head group from the phospho-glycerol backbone.
Ans: B B) Phospholipase B1 hydrolyzes the fatty acid from the 2-position on the glycerol backbone.
Storage Lipids Pages: 362 Difficulty: 2 Biological waxes are all: A) triesters of glycerol and palmitic acid. B) esters of single fatty acids with long-chain alcohols. C) triesters of glycerol and three long chain saturated fatty acids. D) sphingolipids. E) None of the above
Ans: B B) esters of single fatty acids with long-chain alcohols.
Storage Lipids Pages: 358-361 Difficulty: 2 Which of the following statements is true of lipids? A. Many contain fatty acids in ester or amide linkage. B. Most are simply polymers of isoprene. C. Testosterone is an important sphingolipid found in myelin. D. They are more soluble in water than in chloroform. E. They play only passive roles as energy-storage molecules.
Ans: B B. Most are simply polymers of isoprene.
Structural lipids in membranes Pages: 368-370 Difficulty: 2 Which of the following is not true of sterols? A. Cholesterol is a sterol that is commonly found in mammals. B. Sterols are commonly found in bacterial membranes. C. Sterols are more common in plasma membranes than in intracellular membranes (mitochondria, lysosomes, etc.). D. Serols are precursors of steroid hormones. E. Sterols have a structure that includes four fused rings.
Ans: B B. Sterols are commonly found in bacterial membranes.
Structural lipids in membranes Page: 366 Difficulty: 2 Fatty acids are a component of: A. carotenes. B. cerebrosides. C. sterols. D. vitamin D. E. vitamin K.
Ans: B B. cerebrosides.
Structural lipids in membranes Pages: 366-367 Difficulty: 2 A compound containing N-acetylneuraminic acid (sialic acid) is: A. cardiolipin. B. ganglioside GM2. C. phosphatidylcholine. D. platelet-activating factor. E. sphingomyelin.
Ans: B B. ganglioside GM2.
Lipids as signals, cofactors, and pigments Page: 371 Difficulty: 2 Non-steroidal anti-inflammatory drugs (NSAIDS) like aspirin and ibuprofen act by blocking production of: A. biological waxes B. prostaglandins C. sphingolipids D. vitamin D E. none of the above
Ans: B B. prostaglandins
Compare the structure and activity of a membrane transport protein that transports a polar substance across a membrane with a typical soluble enzyme. How are transporter and enzyme similar? How are they different?
Ans: Both proteins have domains that specifically recognize and bind to their substrates via weak interactions; they both therefore mediate processes that are stereospecific and saturable. The membrane transporter usually spans the membrane, having one or several hydrophobic domains that interact with the hydrophobic acyl chains of fatty acids in the interior of the lipid bilayer. Soluble enzymes tend to have their hydrophobic residues buried within their interiors, and their hydrophilic residues on the surface, where they interact with water.
Lipids as signals, cofactors, and pigments Pages: 370-371 Difficulty: 2 An example of a glycerophospholipid that is involved in cell signaling is: A. arachidonic acid. B. ceramide. C. phosphatidylinositol. D. testosterone. E. vitamin A (retinol).
Ans: C C. phosphatidylinositol.
Storage Lipids Page: 360 Difficulty: 1 Triacylglycerols are composed of: A) a glycerol backbone. B) three fatty acids. C) amide linkages between the fatty acids and the glycerol. D) A and B above. E) A, B, and C above.
Ans: D D) A and B above.
Structural lipids in membranes Page: 365 Difficulty: 2 Which of the following contains an ether-linked alkyl group? A. Cerebrosides B. Gangliosides C. Phosphatidyl serine D. Platelet-activating factor E. Sphingomyelin
Ans: D D. Platelet-activating factor
Structural lipids in membranes Pages: 362-267 Difficulty: 2 Which of the following statements about membrane lipids is true? A. Glycerophospholipids are found only in the membranes of plant cells. B. Glycerophospholipids contain fatty acids linked to glycerol through amide bonds. C. Lecithin (phosphatidylcholine), which is used as an emulsifier in margarine and chocolate, is a sphingolipid. D. Some sphingolipids include oligosaccharides in their structure. E. Triacylglycerols are the principal components of erythrocyte membranes.
Ans: D D. Some sphingolipids include oligosaccharides in their structure.
Storage Lipids Pages: 357-362 Difficulty: 2 Which of the following molecules or substances contain, or are derived from, fatty acids? A.) Beeswax B) Prostaglandins C) Sphingolipids D) Triacylglycerols E) All of the above contain or are derived from fatty acids.
Ans: E E) All of the above contain or are derived from fatty acids.
Structural lipids in membranes Page: 364 Difficulty: 1 Which of the following is not a glycerophospholipid? A) Phosphatidylcholine B) Phosphatidylethanolamine C) Phosphatidylserine D) Cardiolipin E) Ceramide
Ans: E E) Ceramide
Lipids as signals, cofactors, and pigments Page: 361 Difficulty: 2 Identify the molecule(s) derived from sterols. A. Arachidonic acid B. Gangliosides C. Phosphatidylglycerol D. Prostaglandins E. Cortisol
Ans: E E. Cortisol
Draw the structure of phosphatidylserine in the ionic form it would have at pH 7.
Ans: For this structure, see Fig. 10-8, p. 350. At neutral pH, there is a charge on the phosphate group, and serine is in the zwitterionic form; it has a protonated amino group and an ionized carboxyl group.
Draw the structure of phosphatidylcholine. Circle the part of the molecule that is polar and draw an arrow to the part that is nonpolar.
Ans: For this structure, see Fig. 10-9, p. 351. At neutral pH, there is a negative charge on the phosphate group, and the quaternary amino group of choline carries a fixed positive charge; this entire phosphorylcholine moiety is polar. The acyl chains attached to glycerol are the nonpolar part of the molecule.
If beeswax, cholesterol, and phosphatidylglycerol were dissolved in chloroform, then subjected to thin-layer chromatography on silica gel using a mixture of chloroform/methanol/water as the developing solvent, which would move fastest?
Ans: In this chromatography, the least polar compound (beeswax) moves fastest and the most polar (phosphatidylglycerol, which has a negative charge on its head group) moves the slowest. (See Fig. 10-24, p. 364.)
Explain the differences between integral and peripheral membrane proteins.
Ans: Integral membrane proteins are very firmly associated with the membrane; their hydrophobic domains are associated with the fatty acyl groups in the interior in hydrophobic interactions. Peripheral membrane proteins are more loosely associated and usually do not penetrate the hydrophobic interior of the bilayer. Conditions that reduce ionic interactions and hydrogen bonds commonly release them. (See Fig. 11-6, p. 375.)
Explain why extraction of lipids from tissues requires organic solvents.
Ans: Lipids are either strongly hydrophobic or amphipathic. Because the solvent in tissues is water, lipids are mainly present in aggregates. This aggregation does not occur in organic solvents; as a result, the lipids are more soluble and thus extractable from the tissues.
A plant breeder has developed a new frost-resistant variety of tomato that contains higher levels of unsaturated fatty acids in membrane lipids than those found in standard tomato varieties. However, when temperatures climb above 95 °F, this frost-resistant variety dies, whereas the standard variety continues to grow. Provide a likely explanation of the biochemical basis of increased tolerance to cold and increased susceptibility to heat of this new tomato variety.
Ans: More unsaturated fatty acids will cause an increase in membrane fluidity because unsaturated fatty acids contain "kinks" and cannot pack as tightly as saturated fatty acids. At cold temperatures, the fluidity increase from the extra unsaturated fatty acids counterbalances the tendency of lipids to solidify at low temperature. At high temperatures, the fluidizing effects of the extra unsaturated fatty acids add to the fluidizing effect of higher temperature, and the membrane of the new plant loses its integrity.
What is the effect of a double bond on fatty acid structure?
Ans: Most double bonds in fatty acids are in the cis configuration. This results in a rigid bend in the hydrocarbon chain. (See Fig. 10-1, p. 345.)
What is the major difference between gated and non-gated ion channels? Give an example of two different gating signals.
Ans: Non-gated channels are always open; gated channels open in response to a signal. Two possible signals are the presence of a ligand or a change in membrane poential.
Why is a hydropathy plot useful, and what are its limitations?
Ans: Peaks on a hydropathy plot indicate areas of high hydrophobicity, which may signal the presence of transmembrane helices or other integral membrane protein segments. However, because water soluble proteins have hydrophobic interiors, it is possible to get hydrophobic areas for proteins that are not membrane associated.
Match these molecules with their biological roles. a) glycogen (b) starch (c) trehalose (d) chitin (e) cellulose (f) peptidoglycan (g) hyaluronate (h) proteoglycan __ viscosity, lubrication of extracellular secretions __ carbohydrate storage in plants __ transport/storage in insects __ exoskeleton of insects __ structural component of bacterial cell wall __ structural component of plant cell walls __ extracellular matrix of animal tissues __ carbohydrate storage in animal liver
Ans: g; b; c; d; f; e; h; a
Draw the structure of a biological membrane as proposed by the fluid mosaic model. Indicate the positions and orientations of phospholipids, cholesterol, integral and peripheral membrane proteins, and the carbohydrate moieties of glycoproteins and glycolipids.
Ans: Phospholipids and sterols are found in both faces of the lipid bilayer. Integral membrane proteins penetrate or span the lipid bilayer, but peripheral membrane proteins associate at the membrane surface with lipid head groups or integral membrane proteins. The carbohydrate moieties of glycolipids and glycoproteins are invariably on the outside face of the plasma membrane. (See Fig. 11-3, p. 373.)
Reagents A and B both react covalently with primary amino groups such as those of phosphatidylethanolamine. Reagent A permeates erythrocytes, but reagent B is impermeant. Both A and B are available in radioisotopically labeled form. Describe a simple experiment by which you might determine whether the phosphatidylethanolamine of erythrocyte membranes is located in the outside face of the lipid bilayer, the inside face, or in both. Be brief and use diagrams to support your answer.
Ans: Reagent A will label phosphatidylethanolamine head groups in both the outer and the inner monolayer of the membrane; reagent B will label only the phosphatidylethanolamine molecules on the outer face. If phosphatidylethanolamine is equally distributed on both sides of the bilayer, twice as much labeling of phosphatidylethanolamine should be observed with reagent A as with reagent B. Deviations from this ratio indicate asymmetry in the distribution of phosphatidylethanolamine.
Give the structure of phosphatidylethanolamine containing one palmitate and one oleate. Show the ionic form expected at pH 7. How many ester bonds are there in this compound?
Ans: See Fig. 10-9, p. 351 for the phospholipid structure and Table 10-1, p. 344 for the structures of the fatty acids. There are two carboxylate esters and two phosphate esters (one phosphodiester) in the molecule.
Compare and contrast symport and antiport. Which term best describes the transport system mediated by the Na+K+ ATPase?
Ans: Symport and antiport are both types of cotransport systems in which two solutes move through the membrane simultaneously. In symport, both move in the same direction; in antiport, one solute goes in one direction, the other in the opposite direction. The Na+K+ ATPase of the plasma membrane is an antiport system. It moves K+ in and Na+ out in a ratio of 2 K+ per 3 Na+. Neither of the two ions can be transported unless the other is present, which is characteristic of cotransport systems. (See Fig. 11-34, p. 397, and Fig. 11-36, p. 399.)
If the hydrophobic interior of a membrane were about 3 nm thick, what would be the minimum number of amino acids in a stretch of transmembrane helix?
Ans: The dimensions of an helix are about 5.4 Å/turn, and there are 3.6 residues/turn, so each residue extends the helix by about 1.5 Å or 0.15 nm. To span 3 nm of lipid bilayer will therefore require a minimum of 20 residues.
The plasma membrane of an animal cell consists of 45% by weight of phospholipid and 55% protein. What is the mole ratio (moles of lipid/moles of protein) if the average molecular weight of phospholipids is 750 and the average molecular weight of membrane proteins is 50,000?
Ans: The ratio of moles lipid/moles protein is about 55. In 100 g of membrane, there are 45 g/750 g•mol-1 = 0.06 mol phospholipid, and 55 g/50,000 g•mol-1 = 1.1 10-3 mol protein. So lipid/protein = 0.06/0.0011 = 55.
Show the structure of sphingosine and indicate the relationship between sphingosine and ceramide.
Ans: The structure of sphingosine is shown in Fig. 10-13, p. 353, which also shows that the attachment of a fatty acyl group to sphingosine in amide linkage converts it to ceramide.
Explain the cause of hereditary diseases of sphingolipid metabolism, such as Tay-Sachs and Niemann-Pick diseases.
Ans: These diseases are the result of mutations in the genes that code for enzymes of sphingolipid breakdown. The mutant enzyme is defective and unable to catalyze its reaction in the metabolic pathway; this results in the accumulation of the metabolic intermediate that is the substrate for the enzyme. (See Box 10-2, p. 356.)
What do all these compounds have in common: vitamin A, vitamin K, ubiquinone, and dolichol?
Ans: They are all lipids with potent biological activities derived from isoprenoid precursors.
A protein is found to extend all the way through the membrane of a cell. Describe this protein in terms of the location of particular types of amino acid side chains in its structure and its ability to move within the membrane.
Ans: This integral membrane protein associates with the lipid bilayer through hydrophobic interactions between domains containing many hydrophobic amino acids and the fatty acyl chains of membrane lipids. Polar and charged residues are located on portions of the protein that protrude out of either face of the membrane. The protein is free to diffuse laterally in the plane of the membrane, but cannot move across the lipid bilayer.
What is the most significant chemical difference between triacylglycerols and glycerophospholipids that leads to their different functions?
Ans: Triacylglycerols are nonpolar hydrophobic molecules that can be stored in specialized nonaqueous cellular compartments. Glycerophospholipids are amphipathic molecules that can serve as structural components of membranes, which have hydrophilic and hydrophobic regions.
Describe three functions of triacylglycerols in mammals and one function in higher plants.
Ans: Triacylglycerols provide mammals with (1) stored fuel, (2) insulation, and (3) a source of metabolic water. In some animals, such as camels and desert rats, the oxidation of stored lipids provides water; in hibernating animals, oxidation of stored lipids generates heat to maintain body temperature (see Chapter 4). In plants, oxidation of the triacylglycerols stored in seeds provides the energy and precursors for biosynthetic processes during germination, before photosynthetic mechanisms become functional.
Match the compounds on the left with the important roles they play listed on the right. (Answers are used only once.) (a) prostaglandins ___ blood clotting (b) sphingolipids ___ necessary for sight (c) thromboxanes ___ mediates pain and inflammation (d) vitamin A ___ important component of myelin membranes
Ans: c; d; a; b
Which statement about antigen-binding sites in antibodies is false? An antigen-binding site on an IgG is formed by the amino-terminal ~110 amino acids of a light chain and the amino terminal ~110 amino acids of a heavy chain. An antigen-binding site on an IgG is formed by the variable region of a light chain and the variable region of a heavy chain. The antigen-binding site is composed of two Ig folds. Antigen-binding specificity is determined by the sequences of the hypervariable sequences in both the light chain and the heavy chain. Antigen binding specificity is determined exclusively by the sequences in the carboxy-terminal ~110 amino acids in the light chain and the heavy chain
Antigen binding specificity is determined exclusively by the sequences in the carboxy-terminal ~110 amino acids in the light chain and the heavy chain
The bacterium E. coli can grow at 20 °C or at 40 °C. At which growth temperature would you expect the membrane phospholipids to have a higher ratio of saturated to unsaturated fatty acids, and why?
At 40 °C, the membranes of E. coli will contain more saturated fatty acids than at 20 °C. The cell regulates fatty acid composition to achieve the same fluidity in its membranes, regardless of growth temperature. Saturated fatty acids counterbalance the fluidizing effect of high temperature.
9. The role of the Dam methylase is to: A) add a methyl group to uracil, converting it to thymine. B) modify the template strand for recognition by repair systems. C) remove a methyl group from thymine. D) remove a mismatched nucleotide from the template strand. E) replace a mismatched nucleotide with the correct one.
B
According to the sequence below (note that the DNA is written in the 5′ → 3′ direction, and the gene of interest is underlined), the BEST forward primer to use for this gene is: A) 5′ GGTTTGAATCAAATGGCTGA 3′. B) 5′ ATGACTGATACATCATCCTC 3′. C) 3′ ATGACTGATACATCATCCTC 5′. D) 5′ GAGGATGATGTATCAGTCAT 3′. E) 3′ GAGGATGATGTATCAGTCAT 5′.
B
Amylopectin contains primarily _____ glycosidic bonds with _____ glycosidic bonds as branch points. A) a(14); (12) B) a(14); (16) C) a(14); (16) D) B(14); (14) E) B(14); (16)
B
Biological waxes are all: A) triesters of glycerol and palmitic acid. B) esters of single fatty acids with long-chain alcohols. C) triesters of glycerol and three long chain saturated fatty acids. D) sphingolipids. E) None of the answers is correct.
B
Biological waxes are all: A) trimesters of glycerol and palmitic acid. B) esters of single fatty acids with long-chain alcohols. C) trimesters of glycerol and three long chain saturated fatty acids. D) sphingolipids. E) none of the above.
B
Compounds that generate nitrous acid (such as nitrites, nitrates, and nitrosamines) change DNA molecules by: A) breakage of phosphodiester bonds. B) deamination of bases. C) depurination. D) formation of thymine dimers. E) transformation of A → T.
B
Compounds that generate nitrous acid (such as nitrites, nitrates, and nitrosamines) change DNA molecules by: A) breakage of phosphodiester bonds. B) deamination of bases. C) depurination. D) formation of thymine dimers. E) transformation of A → T.
B
Consider the transport of glucose into an erythrocyte by facilitated diffusion. When the glucose concentrations are 5 mM on the outside and 0.1 mM on the inside, the free-energy change for glucose uptake into the cell is: (These values may be of use to you: R = 8.315 J/mol•K; T = 298 K; 9 (Faraday constant) = 96,480 J/V; N = 6.022 1023/mol.) A) less than 2 kJ/mol. B) about 10 kJ/mol. C) about 30 kJ/mol. D) about -30 kJoule/mol. E) impossible to calculate without knowledge of the membrane potential.
B
Double stranded regions of RNA typically take on a(n): A) A-form left-handed helix. B) A-form right-handed helix. C) B-form left-handed helix. D) B-form right-handed helix. E) Z-form left-handed helix.
B
Hoogsteen base-pairing occurs when a third strand of DNA binds along the _____ of a double helix of DNA. A) minor groove B) major groove C) free 5′ end D) free 3′ end E) Any of these parts of a DNA double helix could participate in a Hoogsteen interaction.
B
Human adipocytes contain which enzyme that catalyzes the breakdown of triacylglycerols? A) glycerase B) lipase C) fatase D) esterase E) triacylase
B
In a double-stranded nucleic acid, cytosine typically base-pairs with: A) adenosine. B) guanine. C) inosine. D) thymine. E) uracil.
B
In a double-stranded nucleic acid, cytosine typically base-pairs with: A) adenosine. B) guanine. C) inosine. D) thymine. E) uracil.
B
In high-performance liquid chromatography of lipid mixtures using a column packed with a silica gel, which types of lipids will elute first? A) positively charged lipids B) neutral lipids C) negatively charged lipids D) polar lipids E) zwitterionic lipids
B
In one catalytic cycle, the Na+/K+ ATPase transporter transports: A) 2 Na+ out, 3 K+ in, and converts 1 ATP to ADP + Pi. B) 3 Na+ out, 2 K+ in, and converts 1 ATP to ADP + Pi. C) 3 Na+ in, 2 K+ out, and converts 1 ATP to ADP + Pi. D) 1 Na+ out, 1 K+ in, and converts 1 ATP to ADP + Pi. E) 2 Na+ out, 3 K+ in, and converts 1 ADP + Pi to ATP.
B
Movement of water across membranes is facilitated by proteins called: A) annexins. B) aquaporins. C) hydropermeases. D) selectins. E) transportins.
B
Nonsteroidal anti-inflammatory drugs (NSAIDS) like aspirin and ibuprofen act by blocking production of: A) biological waxes B) prostaglandins C) sphingolipids D) vitamin D E) None of the answers is correct.
B
Platelet-activating factor is much more water soluble than most other glycerophospholipids due to which feature? A) its ether-linked alkyl chain at the C-1 of glycerol B) its ester-linked acetic acid at the C-2 of glycerol C) its ethanolamine head group D) its lack of any long alkyl chains linked to glycerol E) the presence of sphingosine, rather than glycerol, as a lipid backbone
B
What would happen if blocking tags were NOT used in reversible terminator sequencing, a next-generation method of DNA sequencing? A) The DNA fragments to sequence/read would be too large. B) More than one dNTP could be incorporated to the same growing nucleotide chain during a single cycle. C) The flow cell could not immobilize DNA fragments. D) Multiple fluorescent colors could be observed across the flow cell at the same time. E) Luciferase would not react in the presence of ATP.
B
The DNA oligonucleotide abbreviated pATCGAC: A) has seven phosphate groups. B) has a hydroxyl at its 3' end. C) has a phosphate on its 3' end. D) has an A at its 3' end. E) violates Chargaff's rules.
B
The DNA oligonucleotide abbreviated pATCGAC: A) has seven phosphate groups. B) has a hydroxyl at its 3' end. C) has a phosphate on its 3' end. D) has an A at its 3' end. E) violates Chargaff's rules
B
The covalent backbone of DNA and RNA consists of: A) alternating phosphate groups and nitrogenous bases. B) alternating phosphate groups and pentose residues. C) alternating pentose residues and nitrogenous bases. D) alternating pentose residues and cyclic nucleosides. E) None of the answers is correct.
B
The difference between thymine and uracil is: A) one methylene group on the pyrimidine ring. B) one methyl group on the pyrimidine ring. C) one hydroxyl group on the ribose ring. D) one amine group on the pyrimidine ring. E) one methyl group on the purine ring
B
The difference between thymine and uracil is: A) one methylene group on the pyrimidine ring. B) one methyl group on the pyrimidine ring. C) one hydroxyl group on the ribose ring. D) one amine group on the pyrimidine ring. E) one methyl group on the purine ring.
B
The enzyme _____ from _____ allows animals such as cows to derive energy from cellulose. A) chitinase; termites B) cellulase; microorganisms C) glucosyltransferase; viruses D) lactase; microorganisms E) none of the above
B
The experiment of Avery, MacLeod, and McCarty in which nonvirulent bacteria were made virulent by transformation was significant because it showed that: A) bacteria can undergo transformation. B) genes are composed of DNA only. C) mice are more susceptible to pneumonia than are humans. D) pneumonia can be cured by transformation. E) virulence is determine genetically
B
The image below shows a Sanger DNA sequencing gel where one ingredient was left out of all sequencing reactions. The top of the gel is the anode and the bottom of the gel is the cathode. The gel was turned on and ran correctly. What is the MOST likely missing ingredient? A) dNTPs B) ddNTPs C) radioactive DNA primer D) DNA polymerase E) template DNA
B
The molecular formula for a monosaccharide is _____ where _____. A) CnH2n+2On; n 3 B) CnH2nOn; n 3 C) CnH2nOn; n 4 D) CnH2n+2On; n 4 E) none of the above
B
The shortest helix segment in a protein that will span a membrane bilayer has about _____ amino acid residues. A) 5 B) 20 C) 50 D) 100 E) 200
B
The steroid hormones testosterone and beta-estradiol are derived from which lipid molecule? A) phosphatidylcholine B) cholesterol C) lipoxin A D) arachidonic acid E) geraniol
B
The study and classification of the complete set of lipids produced in an organisms is called: A) proteomics. B) lipidomics. C) genomics. D) lipidification. E) fatification.
B
The transformation of a monosaccharide into its _____ occurs easily and does not require the assistance of a catalyst. A) epimer B) anomer C) sugar alcohol D) diastereomer E) none of the above
B
Under which condition will integral protein be extracted from membrane. (a) a buffer of alkaline or acid pH. (b) a solution containing detergent (c) a solution of chelating agents which remove divalent ions (d) high ionic strength (high salt)
B
Waxes are BEST described as: A) esters of glycerol and three fatty acids. B) esters of one long-chain fatty acid and one long-chain alcohol. C) polyunsaturated long-chain fatty acids. D) esters of two long-chain fatty acids. E) ethers of glycerol and short-chain alcohols.
B
What feature do Tay-Sachs disease, Fabry disease, and Niemann-Pick disease have in common? A) defects in enzymes responsible for synthesizing membrane lipids B) defects in enzymes responsible for breaking down membrane lipids in the lysosomes C) hyperactive membrane lipid degradation enzymes D) defects in enzymes responsible for cholesterol synthesis E) All of the answers are correct.
B
When double-stranded DNA is heated at neutral pH, which change does NOT occur? A) The absorption of ultraviolet (260 nm) light increases. B) The covalent N-glycosidic bond between the base and the pentose breaks. C) The helical structure unwinds. D) The hydrogen bonds between A and T break. E) The viscosity of the solution decreases.
B
When double-stranded DNA is heated at neutral pH, which change does not occur? A) The absorption of ultraviolet (260 nm) light increases. B) The covalent N-glycosidic bond between the base and the pentose breaks. C) The helical structure unwinds. D) The hydrogen bonds between A and T break. E) The viscosity of the solution decreases
B
Which deoxyoligonucleotide will hybridize with a DNA containing the sequence (5')AGACTGGTC(3')? A) (5')CTCATTGAG(3') B) (5')GACCAGTCT(3') C) (5')GAGTCAACT(3') D) (5')TCTGACCAG(3') E) (5')TCTGGATCT(3')
B
Which eicosanoids contains a five-carbon ring as part of its structure? A) thromboxanes B) prostaglandins C) lipoxins D) leukotrienes E) arachidonates
B
Which feature allows certain lipid molecules to be used as colorful pigments in plants and animals? A) Their high oxygen content helps electrons circulate, which allows absorption of visible light. B) Their conjugated bond structures allow absorption of visible light. C) Their four-fused ring structure allows visible light reflection. D) Their hydrophobicity bends light around them. E) Their low specific gravities cause light to reflect from their surfaces.
B
Which method can be used to visualize lipids that have been separated by thin-layer chromatography by reversibly reacting with double bonds in fatty acids? A) ethanol B) iodine fumes C) low-wavelength UV light D) rhodamine E) ethidium bromide
B
Which of the following deoxyoligonucleotides will hybridize with a DNA containing the sequence (5')AGACTGGTC(3')? A) (5')CTCATTGAG(3') B) (5')GACCAGTCT(3') C) (5')GAGTCAACT(3') D) (5')TCTGACCAG(3') E) (5')TCTGGATCT(3')
B
Which of the following is a mixture of two types of polymers? A) cellulose B) starch C) chitin D) glycogen E) amylose
B
Which of the following is not a fat-soluble vitamin? A) A B) C C) D D) E E) K
B
31. The transformation of a monosaccharide into its ______ occurs easily and does not require the assistance of a catalyst. A) epimer B) anomer C) sugar alcohol D) diastereomer E) none of the above
B) anomer
Which of the following statements is true of lipids? A) Many contain fatty acids in ester or amide linkage. B) Most are simply polymers of isoprene. C) Testosterone is an important sphingolipid found in myelin. D) They are more soluble in water than in chloroform. E) They play only passive roles as energy-storage molecules.
B
Which statement BEST describes why lipids typically float on water? A) Lipids are nonpolar, while water is polar. B) Lipids have lower specific gravities than water does. C) Lipids have higher melting temperature than water does. D) Lipids store more energy than water does. E) Lipids contain carbon, while water does not.
B
Which statement about N-linked glycosylation is correct? A) N-linked oligosaccharides are attached to proteins one sugar at the time in the endoplasmic reticulum. B) N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation in the endoplasmic reticulum. C) N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation in the cytoplasm. D) N-linked sugars are attached to proteins as a 14 residue oligosaccharide after translation in the Golgi apparatus. E) N-linked oligosaccharides are attached to proteins one sugar at the time in the Golgi apparatus.
B
Which statement is NOT true about base stacking when nucleic acids are in a double-stranded conformation? A) Stacking interactions occur when two or more bases are positioned with their rings parallel to each other. B) Stacking interactions are hydrophilic in nature. C) Stacking involves a combination of van der Waals and dipole-dipole interactions between bases. D) Base stacking helps to minimize contact of the bases with water. E) Base stacking interactions are important in stabilizing the three-dimensional structure of nucleic acids.
B
Which statement is NOT true of sterols? A) Cholesterol is a sterol that is commonly found in mammals. B) Sterols are commonly found in bacterial membranes. C) Sterols are more common in plasma membranes than in intracellular membranes (mitochondria, lysosomes, etc.). D) Serols are precursors of steroid hormones. E) Sterols have a structure that includes four fused rings.
B
Which statement is NOT true? A) Phospholipase A1 hydrolyzes the fatty acid from the 1-position on the glycerol backbone. B) Phospholipase B1 hydrolyzes the fatty acid from the 2-position on the glycerol backbone. C) Phospholipase C hydrolyzes the complete phospho-head group from the glycerol backbone. D) Phospholipase D hydrolyzes just the head group from the phospho-glycerol backbone.
B
Movement of water across membranes is facilitated by proteins called: A) annexins. B) aquaporins. C) hydropermeases. D) selectins. E) transportins.
B) aquaporins.
Which statement is TRUE of lipids? A) Many contain fatty acids in ester or amide linkage. B) Most are simply polymers of isoprene. C) Testosterone is an important sphingolipid found in myelin. D) They are more soluble in water than in chloroform. E) They play only passive roles as energy-storage molecules.
B
Which type of damage to DNA structure is MOST likely to be caused by UV light? A) deamination B) pyrimidine dimers C) depurination D) depyrimidination E) hydrolysis of the phosphodiester bond
B
Which types of membrane lipids are modified to determine blood type in humans? A) phosphatidylserines B) glycosphingolipids C) galactolipids D) plasmalogens E) sphingomyelins
B
Which types of signaling lipids are produced by platelets to aid in the formation of blood clots? A) prostaglandins B) thromboxanes C) arachidonates D) lipoxins E) leukotrienes
B
Which of the following statements about the role of ATP in cell metabolism is true? (A) The phosphate bonds of ATP are unusually strong bonds. (B) The energy from the hydrolysis of ATP may be directly coupled to endergonic processes by the transfer of the phosphate group to another molecule. (C) The free energy released by ATP hydrolysis has a much more negative ΔG value than the hydrolysis of phosphate groups from other phosphorylated molecules.
B REASON: A key feature in the way cells manage their energy resources to do this work is energy coupling, the use of an exergonic process to drive an endergonic one. ATP is responsible for mediating most energy coupling in cells, and in most cases it acts as the immediate source of energy that powers cellular work. Read about energy coupling.
What would the value of ΔS be for a chemical reaction in which a molecule is broken down into smaller components? (A) Zero (B) Positive (C) Neutral (D) Negative
B REASON: A reaction in which a molecule is broken down into smaller components would have a positive ΔS value. ΔS is the change in a system's entropy. When entropy is increased, as in a reaction in which a molecule is broken down, the ΔS value is positive.
Which of these are by-products of cellular respiration? (A) carbon dioxide and water (B) heat, carbon dioxide, and water (C) ATP and carbon dioxide (D) ATP, carbon dioxide, and water (E) glucose, carbon dioxide, and water
B REASON: By-products of any reaction usually contains heat + cellular respiration produces CO2 and H2O.
In general, the hydrolysis of ATP drives cellular work by __________. (A) lowering the free energy of the reaction (B) releasing free energy that can be coupled to other reactions (C) releasing heat (D) acting as a catalyst (E) changing to ADP and phosphate
B REASON: Energy coupling is key feature in the way cells manage their energy resources to do work, which is the use of an exergonic process to drive an endergonic one. ATP is responsible for mediating most energy coupling in cells, and in most cases it acts as the immediate source of energy (not a catalyst) that powers cellular work. Byproducts such as heat are not effective energy sources for such work.
As a result of its involvement in a reaction, an enzyme _____. (A) permanently alters its shape. (B) is unchanged. (C) is used up. (D) loses a phosphate group. (E) loses energy.
B REASON: Enzymes are not changed as a result of their participation in a reaction.
ATP allosterically inhibits enzymes in ATP-producing pathways. The result of this is called __________. (A) competitive inhibition (B) feedback inhibition (C) cooperativity (D) denaturing (E) positive feedback
B REASON: In feedback inhibition, a metabolic pathway is halted by the inhibitory binding of its end product to an enzyme that acts early in the pathway. Feedback inhibition thereby prevents the cell from making more product than is necessary and thus wasting chemical resources.
The binding of an allosteric inhibitor to an enzyme causes the rate of product formation by the enzyme to decrease. Which of the following best explains why this decrease occurs? (A) The allosteric inhibitor binds to the substrate and prevents it from binding at the active site. (B) The allosteric inhibitor causes a structural change in the enzyme that prevents the substrate from binding at the active site. (C) The allosteric inhibitor binds to the active site, preventing the substrate from binding. (D) The allosteric inhibitor lowers the temperature of the active site. (E) The allosteric inhibitor causes free energy change of the reaction to increase.
B REASON: In general, any allosteric regulator functions by changing the structure of the enzyme to change the ability of the active site to bind the substrate.
How do enzymes lower activation energy? (A) by increasing reactivity of products (B) by locally concentrating the reactants (C) by harnessing heat energy to drive the breakage of bonds between atoms (D) The first two responses are correct. (E) The second and third choices are correct.
B REASON: One of the ways enzymes work is to increase the concentrations of reactants at a single place.
A plot of reaction rate (velocity) against temperature for an enzyme indicates little activity at 10°C and 45°C, with peak activity at 35°C. The most reasonable explanation for the low velocity at 10°C is that __________. (A) the substrate becomes a competitive inhibitor at lower temperature (B) there is too little activation energy available (C) the hydrogen bonds that define the structure of the enzyme's active site are unstable (D) the enzyme was denatured (E) the cofactors required by the enzyme system lack the thermal energy required to activate the enzyme
B REASON: The environment usually supplies activation energy in the form of heat. The lower the temperature, the less energy that is available to overcome the activation energy barrier.
Which of the following is an example of the second law of thermodynamics as it applies to biological reactions? (A) Cellular respiration releases some energy as heat. (B) The aerobic respiration of one molecule of glucose produces six molecules each of carbon dioxide and water. (C) All types of cellular respiration produce ATP. (D) All of the listed responses are correct. (E) None of the listed responses is correct.
B REASON: The second law of thermodynamics states that spontaneous processes, those requiring no outside input of energy, increase the entropy (disorder) of the universe. In this example, carbon dioxide and water are more disordered than glucose. Cellular respiration, in which the sugar glucose and other organic fuels are broken down in the presence of oxygen to release energy and produce carbon dioxide and water, is a major pathway of catabolism.
In your body, what process converts the chemical energy found in glucose into the chemical energy found in ATP? (A) anabolism (B) cellular respiration (C) redox (D) digestion (E) potentiation
B REASON: This is the name given to the process by which the body converts food energy to energy stored in ATP.
Which diagram correctly illustrates the clustering of lipids in the formation of a micelle?
B (the tails pointed in and the heads pointed out.)
Which statement about N-linked glycosylation is correct? A) N-linked oligosaccharides are attached to proteins one sugar at the time in the endoplasmic reticulum. B) N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation in the endoplasmic reticulum. C) N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation in the cytoplasm. D) N-linked sugars are attached to proteins as a 14 residue oligosaccharide after translation in the Golgi apparatus. E) N-linked oligosaccharides are attached to proteins one sugar at the time in the Golgi apparatus.
B - N-linked sugars are attached to proteins as a 14 residue oligosacch. during translation in the ER
The reaction between an alcohol and an anomeric carbon of a carbohydrate forms a _____ bond. A) anomeric B) glycosidic C) hemiacetal D) ester E) ether
B and C
Humoral immunity is mediated by soluble molecules. Which cell type produces the soluble molecules that carry out the humoral immunity? T cells B cells macrophages neutrophils monocytes
B cells
GLUT1 has a Kt of 1.5 mM for glucose and a Kt of 30 mM for galactose. What concentration of galactose would be required to reach the same rate of import as 5mM glucose? A) 3 mM B) 10 mM C) 15 mM D) 30 mM E) 100 mM
B) 10 mM
13. How many stereoisomers are possible for a ketopentose such as ribulose? A) 2 B) 4 C) 8 D) 16 E) 32
B) 4
Chimpanzees and humans differ by approximately how much due to transposons, base-pair changes, and chromosome segment duplications and rearrangements across their entire genomic sequences? A) 1.5% B) 4% C) 95% D) 10% E) 0.1%
B) 4%
If you wanted to compare the sequence of a gene you isolated in the laboratory with a database of other genetic sequences, which tool would you use? A) linkage analysis B) BLAST C) forensic DNA analysis D) haplotype identification E) quantitative PCR
B) BLAST
Which vitamin is NOT fat soluble? A) A B) C C) D D) E E) K
B) C
If you wanted to study the effects of inactivating a specific gene on development of a mouse, which technique or system would you use to inactivate that gene? A) transfection B) CRISPR/Cas9 C) tandem affinity purification D) yeast two-hybrid E) oligonucleotide-directed mutagenesis
B) CRISPR/Cas9
Which protein forms a complex with a guide RNA to target DNA for cleavage and destruction? A) RecA B) Cas9 C) EcoRI D) Gal4p E) GST
B) Cas9
For the process of solute transport, the constant Kt is: A) analogous to Ka for ionization of a weak acid. B) analogous to Km for an enzyme-catalyzed reaction. C) analogous to Vmax for an enzyme reaction D) proportional to the number of molecules of glucose transporter per cell. E) the maximum rate of glucose transport.
B) analogous to Km for an enzyme-catalyzed reaction.
Which statement about the polymerase chain reaction (PCR) is FALSE? A) DNA amplified by PCR can be cloned. B) DNA amplification is linear in magnitude. C) Newly synthesized DNA must be heat-denatured before the next round of DNA synthesis begins. D) The boundaries of the amplified DNA segment are determined by the synthetic oligonucleotides used to prime DNA synthesis. E) The technique is sufficiently sensitive that DNA sequences can be amplified from a single animal or human hair.
B) DNA amplification is linear in magnitude.
Which of the following statements about the polymerase chain reaction (PCR) is false? A) DNA amplified by PCR can be cloned. B) DNA is amplified at many points within a cellular genome. C) Newly synthesized DNA must be heat-denatured before the next round of DNA synthesis begins. D) The boundaries of the amplified DNA segment are determined by the synthetic oligonucleotides used to prime DNA synthesis. E) The technique is sufficiently sensitive that DNA sequences can be amplified from a single animal or human hair.
B) DNA is amplified at many points within a cellular genome.
Which DNA sequence is a palindrome? A) AATGCC B) GGATCC C) GATATG D) CCCGCG E) AGTAGT
B) GGATCC
Which statement is TRUE regarding lipid anchors? A) Palmitoylations and prenylations both occur via thioester linkages. B) GPI anchors and prenylations are both attached to the C-terminal end of the mature protein. C) Myristoylations and palmitoylations are both reversible modifications. D) Prenylations occur exclusively on the outside leaflet of the plasma membrane.
B) GPI anchors and prenylations are both attached to the C-terminal end of the mature protein.
Which of the following does not apply to the construction or use of a DNA library? A) Determining the location of a particular DNA sequence in a DNA library requires a suitable hybridization probe. B) Genomic libraries are better for expressing gene products than cDNA libraries. C) Many segments of DNA from a cellular genome are cloned. D) Specialized DNA libraries can be made by cloning DNA copies of mRNAs. E) The DNA copies of mRNA found in a cDNA library are made by reverse transcriptase.
B) Genomic libraries are better for expressing gene products than cDNA libraries.
Which statement does NOT apply to the construction or use of a DNA library? A) Determining the location of a particular DNA sequence in a DNA library requires a suitable hybridization probe. B) Genomic libraries are better for expressing gene products than cDNA libraries. C) Many segments of DNA from a cellular genome are cloned. D) Specialized DNA libraries can be made by cloning DNA copies of mRNAs. E) The DNA copies of mRNA found in a cDNA library are made by reverse transcriptase.
B) Genomic libraries are better for expressing gene products than cDNA libraries.
Which amino acid when repeated six to ten times at the N- or C-terminal ends of a protein allows that protein to bind to Ni2+ ions? A) Glu B) His C) Ala D) Tyr E) Asp
B) His
What is meant by the term "positive-inside rule"? A) The typical transmembrane potential for plasma membranes is positive on the inside. B) Integral plasma membrane proteins commonly have positively charge amino acids on the cytosolic side. C) Concentrations of cations are usually higher inside than outside of cells. D) All of the answers are correct. E) None of the answers is correct.
B) Integral plasma membrane proteins commonly have positively charge amino acids on the cytosolic side.
59. Which statement about N-linked glycosylation is correct? A) N-linked oligosaccharides are attached to proteins one sugar at the time in the endoplasmic reticulum. B) N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation in the endoplasmic reticulum. C) N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation in the cytoplasm. D) N-linked sugars are attached to proteins as a 14 residue oligosaccharide after translation in the Golgi apparatus. E) N-linked oligosaccharides are attached to proteins one sugar at the time in the Golgi apparatus.
B) N-linked sugars are attached to proteins as a 14 residue oligosaccharide during translation in the endoplasmic reticulum.
Which statement is NOT true of sterols? A) Cholesterol is a sterol that is commonly found in mammals. B) Sterols are commonly found in bacterial membranes. C) Sterols are more common in plasma membranes than in intracellular membranes (mitochondria, lysosomes, etc.). D) Serols are precursors of steroid hormones. E) Sterols have a structure that includes four fused rings.
B) Sterols are commonly found in bacterial membranes.
Which statement is NOT true about the chloride-bicarbonate exchanger (AE)? A) The AE protein increases the rate of bicarbonate transport across the membrane. B) The AE protein uses ATP as an energy source to drive bicarbonate transport. C) The AE protein transports chloride ions across the membrane. D) The AE protein is classified as an anti-porter. E) The AE protein spans the membrane at least 12 times.
B) The AE protein uses ATP as an energy source to drive bicarbonate transport.
Which statement is TRUE regarding the SERCA pump? A) The E1 conformation has a higher Kd value for Ca2+ than the E2 conformation. B) The P domain contains a high-energy acyl phosphate structure when it is phosphorylated. C) Three calcium ions are moved in each cycle of the transporter. D) This protein can be classified as an antiport. E) None of the statements is true.
B) The P domain contains a high-energy acyl phosphate structure when it is phosphorylated.
If a monovalent cation is being imported into a cell in the absence of a concentration gradient (i.e., the concentration for the transported cation is equal on both sides of the membrane), what could you predict about DGt? Assume the transmembrane potential is 50mV (inside negative). A) The value of DGt will have a positive sign. B) The value of DGt will have a negative sign. C) The value of DGt will likely be close to zero. D) It is impossible to predict anything about the value of DGt.
B) The value of DGt will have a negative sign.
Which feature allows certain lipid molecules to be used as colorful pigments in plants and animals? A) Their high oxygen content helps electrons circulate, which allows absorption of visible light. B) Their conjugated bond structures allow absorption of visible light. C) Their four-fused ring structure allows visible light reflection. D) Their hydrophobicity bends light around them. E) Their low specific gravities cause light to reflect from their surfaces.
B) Their conjugated bond structures allow absorption of visible light.
Which statement does NOT describe a characteristic of valinomycin? A) This can act as an antibiotic. B) This molecule is a small protein. C) This compound preferentially transports potassium ions over sodium ions. D) This compound has carbonyl groups that form coordination bonds to ions.
B) This molecule is a small protein
What is a polylinker? A) a type of cloning vector B) a DNA fragment with multiple recognition sequences for restriction endonucleases C) a type of expression vector D) an enzyme that joins DNA molecules together E) a method of getting DNA into a cell
B) a DNA fragment with multiple recognition sequences for restriction endonucleases
The E. coli recombinant plasmid pBR322 has been widely utilized in genetic engineering experiments. pBR322 has all of the following features except: A) a number of conveniently located recognition sites for restriction enzymes. B) a number of palindromic sequences near the EcoRI site, which permit the plasmid to assume a conformation that protects newly inserted DNA from nuclease degradation. C) a replication origin, which permits it to replicate autonomously. D) resistance to two different antibiotics, which permits rapid screening for recombinant plasmids containing foreign DNA. E) small overall size, which facilitates entry of the plasmid into host cells.
B) a number of palindromic sequences near the EcoRI site, which permit the plasmid to assume a conformation that protects newly inserted DNA from nuclease degradatio
The E. coli recombinant plasmid pBR322 has been widely utilized in genetic engineering experiments. Which feature does pBR322 NOT have? A) a number of conveniently located recognition sites for restriction enzymes B) a number of palindromic sequences near the EcoRI site, which permit the plasmid to assume a conformation that protects newly inserted DNA from nuclease degradation C) a replication origin, which permits it to replicate autonomously D) resistance to two different antibiotics, which permits rapid screening for recombinant plasmids containing foreign DNA E) small overall size, which facilitates entry of the plasmid into host cells
B) a number of palindromic sequences near the EcoRI site, which permit the plasmid to assume a conformation that protects newly inserted DNA from nuclease degradation
A common cloning strategy for introducing foreign genes into plants with Agrobacterium employs all the following features except: A) a selectable antibiotic marker such as kanamycin resistance. B) a shuttle vector with 25 bp T-DNA repeats flanking the foreign gene of choice. C) a Ti plasmid lacking its T-DNA segment. D) active vir gene products from the altered Ti plasmid. E) an ability to induce crown gall formation in infected leaves.
B) a shuttle vector with 25 bp T-DNA repeats flanking the foreign gene of choice.
If you want to determine what other proteins might be interacting with the protein you have been studying, what type of fusion tag would you add to your protein to aid in purification of both the protein you have been studying and the proteins interacting with it? A) a green fluorescent protein fusion tag B) a tandem affinity purification tag C) a maltose-binding protein tag D) an epitope tag E) a B-galactosidase tag
B) a tandem affinity
Consider the transport of glucose into an erythrocyte by facilitated diffusion. What is the free-energy change for glucose uptake into the cell when the glucose concentrations are 5 mM on the outside and 0.1 mM on the inside? (These values may be of use to you: R = 8.315 J/mol · K; T = 298 K; Á (Faraday constant) = 96,480 J/V; N = 6.022 × 1023 /mol.) A) less than 2 kJ/mol B) about 10 kJ/mol C) about 30 kJ/mol D) about -30 kJoule/mol E) It is impossible to calculate without knowledge of the membrane potential.
B) about 10 kJ/mol
The fluorophore in GFP is derived from covalent modifications of which structures located at the interior of the protein? A) coenzymes B) amino acids C) prosthetic groups D) metal ions E) nucleotides
B) amino acids
What kind of bond can link a myristoyl anchor to a polypeptide? A) an ester bond to an internal serine B) an amide bond to a glycine C) a thioester to a cysteine D) an ester bond to the C-terminus E) a thioether bond to a cysteine side chain
B) an amide bond to a glycine
Fatty acids are attached to sphingosine by what type of chemical linkage? A) an ether linkage B) an amide linkage C) an ester linkage D) a peroxide linkage E) a alkyl linkage
B) an amide linkage
Waxes are BEST described as: A) esters of glycerol and three fatty acids. B) esters of one long-chain fatty acid and one long-chain alcohol. C) polyunsaturated long-chain fatty acids. D) esters of two long-chain fatty acids. E) ethers of glycerol and short-chain alcohols.
B) esters of one long-chain fatty acid and one long-chain alcohol.
Biological waxes are all: A) triesters of glycerol and palmitic acid. B) esters of single fatty acids with long-chain alcohols. C) triesters of glycerol and three long chain saturated fatty acids. D) sphingolipids. E) None of the answers is correct.
B) esters of single fatty acids with long-chain alcohols.
A compound containing N-acetylneuraminic acid (sialic acid) is: A) cardiolipin. B) ganglioside GM2. C) phosphatidylcholine. D) platelet-activating factor. E) sphingomyelin.
B) ganglioside GM2.
Which molecule is MOST commonly used as a backbone the linkage of three fatty acids to form fats? A) glycogen B) glycerol C) sphingosine D) glucose E) phosphoglycerol
B) glycerol
Which types of membrane lipids are modified to determine blood type in humans? A) phosphatidylserines B) glycosphingolipids C) galactolipids D) plasmalogens E) sphingomyelins
B) glycosphingolipids
Groups of single nucleotide polymorphisms that are usually inherited together from one parent are called: A) genotypes. B) haplotypes. C) phenotypes. D) karyotypes. E) cytotypes.
B) haplotypes.
Which method can be used to visualize lipids that have been separated by thin-layer chromatography by reversibly reacting with double bonds in fatty acids? A) ethanol B) iodine fumes C) low-wavelength UV light D) rhodamine E) ethidium bromide
B) iodine fumes
Platelet-activating factor is much more water soluble than most other glycerophospholipids due to which feature? A) its ether-linked alkyl chain at the C-1 of glycerol B) its ester-linked acetic acid at the C-2 of glycerol C) its ethanolamine head group D) its lack of any long alkyl chains linked to glycerol E) the presence of sphingosine, rather than glycerol, as a lipid backbone
B) its ester-linked acetic acid at the C-2 of glycerol
Human adipocytes contain which enzyme that catalyzes the breakdown of triacylglycerols? A) glycerase B) lipase C) fatase D) esterase E) triacylase
B) lipase
The study and classification of the complete set of lipids produced in an organisms is called: A) proteomics. B) lipidomics. C) genomics. D) lipidification. E) fatification.
B) lipidomics.
Which factor is NOT a consequence of partial hydrogenation of vegetable oils? A) longer shelf life B) lower melting temperature C) reduction of some cis double bonds to single bonds D) conversion of some cis double bonds to trans double bonds E) increased risk of cardiovascular disease upon consumption by humans
B) lower melting temperature
If you wanted to analyze membrane lipids from a biological sample, which solvent would MOST effectively extract those lipids? A) benzene B) methanol C) water D) chloroform E) ethyl ether
B) methanol
In high-performance liquid chromatography of lipid mixtures using a column packed with a silica gel, which types of lipids will elute first? A) positively charged lipids B) neutral lipids C) negatively charged lipids D) polar lipids E) zwitterionic lipids
B) neutral lipids
What is the CORRECT order of steps in vesicle fusion to a cell? A) outer leaflet lipid mixing, content release, inner leaflet lipid mixing B) outer leaflet lipid mixing, inner leaflet lipid mixing, content release C) inner leaflet lipid mixing, content release, outer leaflet lipid mixing D) inner-leaflet lipid mixing, outer leaflet lipid mixing, content release E) content release, inner leaflet lipid mixing, outer leaflet lipid mixing
B) outer leaflet lipid mixing, inner leaflet lipid mixing, content release
Which eicosanoids contains a five-carbon ring as part of its structure? A) thromboxanes B) prostaglandins C) lipoxins D) leukotrienes E) arachidonates
B) prostaglandins
Which technique can be used to estimate the relative copy numbers of particular DNA sequences in a sample? A) reverse transcriptase PCR B) quantitative PCR C) some gel based analysis such as with the Bioanalyzer and Fragment Analyzer gel band density are used in calculating concentration in a lot of labs. D) normal PCR E) in vitro transcription
B) quantitative PCR
Current estimates indicate that _____% of the human genome is translated into protein. A) less than 0.5 B) roughly 1.5 C) roughly 10 D) roughly 25 E) more than 50
B) roughly 1.5
53. Which of the following is a mixture of two types of polymers? A) cellulose B) starch C) chitin D) glycogen E) amylose
B) starch
Which tag is NOT used to study protein function? A) green fluorescent protein (GFP) B) synteny tag C) tandem affinity purification (TAP) D) Gal4p DNA binding domain E) Gal4p activation domain
B) synteny tag
Compensatory mutations in genes for noncoding RNAs indicate that: A) these genes are not important for the function of the organism. B) the secondary structure of the noncoding RNA is important for its function. C) the noncoding RNA is not undergoing accelerated evolution. D) All of the answers are correct. E) None of the answers is correct.
B) the secondary structure of the noncoding RNA is important for its function.
Which types of signaling lipids are produced by platelets to aid in the formation of blood clots? A) prostaglandins B) thromboxanes C) arachidonates D) lipoxins E) leukotrienes
B) thromboxanes
Which solvent is NOT used to dissolve lipids? A) ethyl ether B) water C) benzene D) methanol E) chloroform
B) water
A method of determining if proteins are interacting in vivo that makes use of a transcription factor involved in regulating galactose metabolism genes is: A) a DNA microarray. B) yeast two-hybrid analysis. C) tandem affinity purification. D) immunofluorescence. E) quantitiative PCR.
B) yeast two-hybrid analysis.
52. Which polysaccharide is found in a helically coiled conformation? A) chitin B) α-amylose C) cellulose D) lignin E) none of the above
B) α-amylose
31. The transformation of a monosaccharide into its ______ occurs easily and does not require the assistance of a catalyst. A) epimer B) anomer C) sugar alcohol D) diastereomer E) none of the above
B- Anomer
When the partial pressure of O2 in venous blood is 30 torr, the saturation of myoglobin with O2 is ______ while the saturation of hemoglobin with O2 is ______. A) 0.55, 0.91 B) 0.91, 0.55 C) 2.8 torr, 26 torr D) 0.91, 0.97 E) none of the above
B- Myo it 91 and HB is about 50
Which of the following is a mixture of two types of polymers? A) cellulose B) starch C) chitin D) glycogen E) amylose
B- Starch is a mixture of a- amylose and amylopectin
Which polysaccharide is found in a helically coiled conformation? A) chitin B) α-amylose C) cellulose D) lignin E) none of the above
B- a-amylose
Lactose monomers
B-Galactose + B-Glucose via a 1-4 linkage
B-form DNA in vivo is a ________-handed helix, _____ Å in diameter, with a rise of ____ Å per base pair. A) left; 20; 3.9 B) right; 18; 3.4 C) right; 18; 3.6 D) right; 20; 3.4 E) right; 23; 2.6
B-form DNA in vivo is a ________-handed helix, _____ Å in diameter, with a rise of ____ Å per base pair. D) right; 20; 3.4
Which of the following characterizes an asymmetric carbon? A. It has four identical groups attached to it B. It has four different groups attached to it C. It has at least one carboxyl and one amino group attached to it D. It has two heavy groups on one side and two light groups on the other
B. It has four different groups attached to it
Which of the following statements about 2,3-bisphosphoglycerate (BPG) binding is FALSE? BPG binds less tightly to fetal hemoglobin than to adult hemoglobin, thereby aiding oxygen transfer to a fetus. BPG binds to hemoglobin at one site and lowers hemoglobin's affinity for oxygen at another site. BPG aids oxygen delivery to tissues by increasing the affinity of myoglobin for oxygen. BPG requires a binding site containing multiple positively charged groups.
BPG aids oxygen delivery to tissues by increasing the affinity of myoglobin for oxygen. This statement is false. BPG does not affect the affinity of myoglobin for oxygen.
Why is BPG essential for the delivery of O2 to the tissues? BPG stabilizes the R state conformation of hemoglobin. BPG stabilizes O2 binding to hemoglobin. BPG stabilizes the association of hemoglobin subunits. BPG stabilizes the T state conformation of hemoglobin.
BPG stabilizes the T state conformation of hemoglobin. The T state of hemoglobin has lower affinity for oxygen and this enables release of oxygen in the tissues.
When cloning a foreign DNA fragment into a plasmid, it is often useful to insert the fragment at a site that interrupts a selectable marker (such as the tetracycline-resistance gene of pBR322). The loss of function of the interrupted gene can be used to identify clones containing recombinant plasmids with foreign DNA. With a yeast artificial chromosome (YAC) vector, it is not necessary to do this; the researcher can still distinguish vectors that incorporate large foreign DNA fragments from those that do not. How are these recombinant vectors identified?
Bacteriophage λ DNA can be packaged into infectious phage particles only if it is between 40,000 and 53,000 bp long. The two essential pieces of the bacteriophage λ vector have about 30,000 bp in all, so the vector is not packaged into phage particles unless the additional, foreign DNA is of sufficient length: 10,000 to 23,000 bp.
Which of the enzymes listed in the table below produce identical sticky ends? Enzyme Cleavage site AluI AG ↓↓ CT HindIII A ↓↓ AGCTT BamHI G ↓↓ GATCC EcoRI G ↓↓ AATTC BglII A ↓↓ GATCT
BamHI and BglII
Describe the differences between a proteoglycan and a glycoprotein.
Both are made up of proteins and polysaccharides. In proteoglycans, the carbohydrate moiety dominates, constituting 95% or more of the mass of the complex. In glycoproteins, the protein constitutes a larger fraction, generally 50% or more of the total mass.
3. Briefly explain the difference between base-excision repair and nucleotide-excision repair.
Base excision involves removing only the defective base from the DNA by cleavage of the Nglycosidic linkage of the base to deoxyribose. This leaves an apurinic or apyrimidinic site. In a subsequent step, the abasic nucleotide is removed and the missing nucleotide is replaced by DNA polymerase 1. Nucleotide excision involves removing the defective base together with its deoxyribose and phosphate (as well as some neighboring nucleotides) by cleavage of phosphodiester bonds in the DNA chain in the first step.
The number of structurally different polysaccharides that can be made with 20 different monosaccharides is far greater than the number of different polypeptides that can be made with 20 different amino acids, if both polymers contain an equal number (say 100) of total residues. Explain why.
Because virtually all peptides are linear (i.e., are formed with peptide bonds between the alpha-carboxyl and alpha-amino groups), the variability of peptides is limited by the number of different subunits. Polysaccharides can be linear or branched, can be alpha- or beta-linked, and can be joined 1--> 4, 1 --> 3, 1--> 6, etc. The number of different ways to arrange 20 different sugars in a branched oligosaccharide is therefore much larger than the number of different ways a peptide could be made with an equal number of residues.
A sequence of amino acids in a certain protein is found to be Ser-Gly-Pro-Gly. The sequence is most probably partof a(n):
Beta turn
white blood cells
Blood cells that perform the function of destroying disease-causing microorganisms. Their nuclei contain DNA
Why does the Na+/K+ antiporter and the Ca2+ antiporter carry out unidirectional transport with respect to each ion across the plasma membrane?
Both are building up potential energy for physiological functions by creating a concentration gradient. Na+/K+ coupled with SGLT for the cell to intake glucose Ca2+ used to prepare for rapid Ca2+ influx needed in muscle contraction, neurotransmitter release, and glycogen breakdown
How are a nucleoside and a nucleotide similar and how are they different?
Both have a nitrogenous base and a pentose; nucleotides also have a phosphate group, which nucleosides lack.
What is an amphipathic compound? Explain how such compounds contribute to the structure of biological membranes.
Both hydrophilic and hydrophobic. dissolves in water and forms aggregate or membrane
How are IgG molecules able to recognize a wide variety of different antigens? Both light and heavy chains have hypervariable sequences that form the antigen binding site. Each light chain has hypervariable sequences that form the antigen binding site, while the heavy chains do not vary. Each heavy chain has hypervariable sequences that form the antigen binding site, while the light chains do not vary. The Fc portion has hypervariable sequences that form the antigen binding site.
Both light and heavy chains have hypervariable sequences that form the antigen binding site.
Compare the structure and activity of a membrane transport protein that transports a polar substance across a membrane with a typical soluble enzyme. How are transporter and enzyme similar? How are they different?
Both proteins have domains that specifically recognize and bind to their substrates via weak interactions; they both therefore mediate processes that are stereospecific and saturable. The membrane transporter usually spans the membrane, having one or several hydrophobic domains that interact with the hydrophobic acyl chains of fatty acids in the interior of the lipid bilayer. Soluble enzymes tend to have their hydrophobic residues buried within their interiors, and their hydrophilic residues on the surface, where they interact with water.
Following complete hydrolysis ofa sample of glycogen and a sample of cellulose, which statement must be true?
Both samples consist of a mixture of a-D-glucose and B-D-glucose.
In 1944 Avery, MacLeod, and McCarty did experiments with Diplococcus pneumoniae that proved that
DNA can permanently transform a non-pathogenic strain into a pathogenic strain.
How do DNA binding proteins recognize specific DNA sequences?
By specific interactions with H-bond donors and acceptors on the sides of G-C and A-T pairs exposed in the major and minor grooves of DNA
In order to perform PCR, the following reagents must be included:
DNA fragment, primers flanking the region of interest, dNTPs, DNA Polymerase
10. In base-excision repair, the first enzyme to act is: A) AP endonuclease. B) Dam methylase. C) DNA glycosylase. D) DNA ligase. E) DNA polymerase.
C
Myoglobin's secondary structure is primarily composed of ______________. A) parallel b-sheets B) antiparallel b-sheets C) a-helices D) omh-loops E) polyproline helices
C- myogolbin composed of a helices
From the abbreviated name of the compound Gal(B1->4)Glc, we know that:
C-4 of glucose is joined to C-1 of galactose by a glycosidic bond
From the abbreviated name of the compound Gal(b1-4)Glyc, we know that:
C-4 of glucose is joined to c-1 of galactose by a glycosidic bond
3. When performing PCR, what is the advantage to using a DNA polymerase isolated from a thermophilic organism? A) The PCR reaction does not need to be cooled below the denaturation step. B) The PCR reaction does not need primers to proceed. C) The PCR reaction does not need to have fresh enzyme added after each cycle. D) The PCR reaction does not need to have fresh dNTPs added after each cycle. E) The PCR reaction does not need to have fresh template DNA added after each cycle.
C
4. How did the addition of different-colored fluorescent tags on each ddNTP improve the Sanger DNA sequencing method? A) Scientists did not need to use a heat-stable DNA polymerase. B) A DNA primer was no longer needed. C) All four ddNTPs could be incorporated into a single reaction. D) Scientists could now use short tandem repeats to assist their sequencing. E) The template DNA could now be double stranded.
C
Double-stranded DNA was isolated from a cryophilic bacterium. Which choice is MOST likely to represent a possible composition of its bases? A) 30% A:T, 70% G:C B) 50% A:T, 50% G:C C) 70% A:T, 30% G:C D) Any of these choices is a likely composition. E) None of these choices is a likely composition.
C
Double-stranded regions of RNA: A) are less stable than double-stranded regions of DNA. B) can be observed in the laboratory, but probably have no biological relevance. C) can form between two self-complementary regions of the same single strand of RNA. D) do not occur. E) have the two strands arranged in parallel (unlike those of DNA, which are antiparallel).
C
A ligand-gated ion channel (such as the nicotinic acetylcholine receptor) is: A) a charged lipid in the membrane bilayer that allows ions to pass through. B) a membrane protein that permits a ligand to pass through the membrane only when opened by the appropriate ion. C) a membrane protein that permits an ion to pass through the membrane only when opened by the appropriate ligand. D) a molecule that binds to the membrane thereby allowing ions to pass through. E) always requires a second ligand to close the channel once it is opened.
C
A process not involving the fusion of two membranes or two regions of the same membrane is: A) endocytosis. B) entry of enveloped viruses into cells. C) entry of glucose into cells. D) exocytosis. E) reproductive budding in yeast
C
A tetraplex of DNA is MOST likely to form with which residue? A) Adenosine B) Thymidine C) Guanosine D) Cytidine E) A tetraplex is equally likely with all bases.
C
According to the sequence below (note that the DNA is written in the 5′ → 3′ direction, and the gene of interest is underlined), the BEST reverse primer to use for this gene is: A) 5′ ATTGAATCCTTGGCT GGTGA 3′. B) ′ ATTGAATCCTTGGCT GGTGA 5′. C) 5′ TCACCAGCCAAGGATTCAAT 3′. D) 3′ TCACCAGCCAAGGATTCAAT 5′. E) 3′ GGTGAGTCGG TTCAATTCGT 5′.
C
An example of a glycerophospholipid that is involved in cell signaling is: A) arachidonic acid. B) ceramide. C) phosphatidylinositol. D) testosterone. E) vitamin A (retinol).
C
An example of a glycerophospholipid that is involved in cell signaling is: A) arachidonic acid. B) ceramide. C) phosphatidylinositol. D) testosterone. E) vitamin A (retinol).
C
An integral membrane protein can be extracted with: A) a buffer of alkaline or acid pH. B) a chelating agent that removes divalent cations. C) a solution containing detergent. D) a solution of high ionic strength. E) hot water.
C
At equilibrium in solution, D-glucose consists of a mixture of its anomers. Which statement most accurately describes the solution? A) consists of approximately equal amounts of the - and -anomers B) the -anomer is more stable and is slightly preferred over the -anomer C) the -anomer predominates over the -anomer by a ratio of approximately 2:1 D) straight-chain form is present in high concentration E) none of the above
C
Commercial vegetable oils can be converted from liquid forms to solid forms and have their shelf lives increased due to which process? A) partial desaturation B) unsaturation C) partial hydrogenation D) hydrolysis E) complete esterification
C
Double-stranded regions of RNA: A) are less stable than double-stranded regions of DNA. B) can be observed in the laboratory, but probably have no biological relevance. C) can form between two self-complementary regions of the same single strand of RNA. D) do not occur. E) have the two strands arranged in parallel (unlike those of DNA, which are antiparallel).
C
For the helix in double-stranded B-form DNA, the majority of the stability can be attributed to: A) base-pairing interactions via H-bonds. B) interactions along the phosphate backbone. C) base-stacking interactions via van-der-Waals interactions. D) covalent bonds between adjacent bases in one strand. E) ionic interactions with metal ions.
C
For the helix in double-stranded B-form DNA, the majority of the stability can be attributed to: A) base-pairing interactions via H-bonds. B) interactions along the phosphate backbone. C) base-stacking interactions via van-der-Waals interactions. D) covalent bonds between adjacent bases in one strand. E) ionic interactions with metal ions.
C
How did the addition of different-colored fluorescent tags on each ddNTP improve the Sanger DNA sequencing method? A) Scientists did not need to use a heat-stable DNA polymerase. B) A DNA primer was no longer needed. C) All four ddNTPs could be incorporated into a single reaction. D) Scientists could now use short tandem repeats to assist their sequencing. E) The template DNA could now be double stranded.
C
In nucleotides and nucleic acids, syn and anti conformations relate to: A) base stereoisomers. B) rotation around the phosphodiester bond. C) rotation around the sugar-base bond. D) sugar pucker. E) sugar stereoisomers
C
Integrins are: A) membrane proteins that are involved in ion transport. B) membrane proteins that are involved in sugar transport. C) membrane proteins that mediate cell adhesion. D) proteins of the extracellular matrix that bind to cell surface proteins. E) proteins that are found at the membrane-cytoplasm interface.
C
The MOST striking difference between A-, B-, and Z-form DNA is that: A) A -orm does not contain a major and minor groove. B) B-form has the smallest helical diameter. C) Z-form is left handed. D) B-form has the greatest number of base pairs per helical turn. E) A-form maximizes base stacking interactions.
C
The chemical difference between a nucleotide and a nucleoside is that: A) a different nitrogenous base is added to each. B) nucleotides do not contain phosphate groups. C) nucleosides do not contain phosphate groups. D) nucleotides do not contain pentose sugars E) nucleosides do not contain pentose sugars.
C
The fluidity of the lipid side chains in the interior of a bilayer is generally increased by: A) a decrease in temperature. B) an increase in fatty acyl chain length. C) an increase in the number of double bonds in fatty acids. D) an increase in the percentage of phosphatidyl ethanolamine E) the binding of water to the fatty acyl side chains.
C
The inner (plasma) membrane of E. coli is about 75% lipid and 25% protein by weight. How many molecules of membrane lipid are there for each molecule of protein? (Assume that the average protein is Mr 50,000 and the average lipid is 750.) Pg 372 A) 1 B) 50 C) 200 D) 10,000 E) 50,000
C
Due primarily to single nucleotide polymorphisms, each human differs from every other human, on average, by what percentage of the human genome? A) 6% B) 15% C) 0.1% D) 98% E) 1.5%
C) 0.1%
What is the abbreviated nomenclature for octadecanoic acid with two double bonds? A) 16:1 B) 14:2 C) 18:2 D) 18:0 E) 18:1
C
When a bacterium such as E. coli is shifted from a warmer growth temperature to a cooler growth temperature, it compensates by: A) increasing its metabolic rate to generate more heat. B) putting longer-chain fatty acids into its membranes. C) putting more unsaturated fatty acids into its membranes. D) shifting from aerobic to anaerobic metabolism. E) synthesizing thicker membranes to insulate the cell.
C
When performing PCR, what is the advantage to using a DNA polymerase isolated from a thermophilic organism? A) The PCR reaction does not need to be cooled below the denaturation step. B) The PCR reaction does not need primers to proceed. C) The PCR reaction does not need to have fresh enzyme added after each cycle. D) The PCR reaction does not need to have fresh dNTPs added after each cycle. E) The PCR reaction does not need to have fresh template DNA added after each cycle.
C
Which conformation is NOT permitted due to steric interference? A) purine in syn conformation B) purine in anti conformation C) pyrimidine in syn conformation D) pyrimidine in anti conformation E) All of these conformations are permitted.
C
Which glycerophospholipid has a net charge of zero at pH 7? A) phosphatidylserine B) phasphatidic acid C) phosphatidylcholine D) phosphatidylglycerol E) phosphatidylinositol 4,5-bisphosphate
C
Which membrane lipid serves as a reservoir of messenger molecules for signal transduction? A) taruocholic acid (TA) B) phosphatidylserine (PS) C) phosphatidylinositol 4,5-bisphosphate (PIP2 ) D) thromboxane A2 (TXA2 ) E) sphingomyelin (SM)
C
How many stereoisomers are possible for an aldopentose such as ribose? A. 2 B. 4 C. 8 D. 16
C. 8
Which of the following is a heteropolysaccharide? A) amylopectin B) cellulose C) pectin D) chitin E) none of the above
C
Which of the following is not true of all naturally occurring DNA? A) Deoxyribose units are connected by 3',5'-phosphodiester bonds. B) The amount of A always equals the amount of T. C) The ratio A+T/G+C is constant for all natural DNAs. D) The two complementary strands are antiparallel. E) Two hydrogen bonds form between A and T.
C
Which of the following polysaccharides cannot be digested by mammalian salivary, gastric, or pancreatic enzymes? A) amylopectin B) amylose C) chitin D) glycogen E) starch
C
Which of the following statements concerning the tautomeric forms of bases such as uracil is correct? A) The double-lactim form contains a ketone group. B) The lactam form contains an alcohol group. C) The lactam form predominates at neutral pH. D) Formation of the lactim from the lactam is irreversible. E) The lactim and double-lactim forms are stabilized at high pH
C
Which of these statements about the composition of membranes is true? A) All biological membranes contain cholesterol. B) Free fatty acids are major components of all membranes. C) The inner and outer membranes of mitochondria have different protein compositions. D) The lipid composition of all membranes of eukaryotic cells is essentially the same. E) The lipid:protein ratio varies from about 1:4 to 4:1
C
Which one of the following statements about membranes is true? Pg 372 A) Most plasma membranes contain more than 70% proteins. B) Sterol lipids are common in bacterial plasma membranes. C) Sterol lipids are common in human cell plasma membranes. D) Sterol lipids are common in plant cell plasma membranes. E) The plasma membranes of all cell types within a particular organism have basically the same lipid and protein composition.
C
Which statement concerning the tautomeric forms of bases such as uracil is CORRECT? A) The double-lactim form contains a ketone group. B) The lactam form contains an alcohol group. C) The lactam form predominates at neutral pH. D) Formation of the lactim from the lactam is irreversible. E) The lactim and double-lactim forms are stabilized at high pH.
C
Which statement is NOT true of all naturally occurring DNA? A) Deoxyribose units are connected by 3',5'-phosphodiester bonds. B) The amount of A always equals the amount of T. C) The ratio A+T/G+C is constant for all natural DNAs. D) The two complementary strands are antiparallel. E) Two hydrogen bonds form between A and T.
C
Which technique is NOT commonly used to analyze lipid composition? A) selective extraction using apolar solvents B) adsorption chromatography C) x-ray crystallography D) hydrolysis using enzymes with specificity for certain linkages E) mass spectroscopy
C
Which technique used to analyze lipids is the fastest but may not be the most accurate? A) thin-layer chromatography B) high-performance chromatography C) nuclear magnetic resonance D) direct mass spectrometry E) gas chromatography
C
Which term BEST describes the polarity of membrane lipids? A) ambidextrous B) completely nonpolar C) amphipathic D) completely polar E) amphibolic
C
Which type of chemical linkage is used to join fatty acids to glycerol? A) an ether linkage B) a peptide bond C) an ester linkage D) a double bond E) a peroxide bond
C
Which types of membrane lipids make up 70% to 80% of the total membrane lipids in a vascular plant? A) phosphatidylserines B) glycosphingolipids C) galactolipids D) plasmalogens E) sphingomyelins
C
The inner (plasma) membrane of E. coli is about 75% lipid and 25% protein by weight. How many molecules of membrane lipid are there for each molecule of protein? (Assume that the average protein is Mr 50,000 and the average lipid is 750.) A) 1 B) 50 C) 200 D) 10,000 E) 50,000
C) 200
Current estimates indicate that humans have about _____ genes. A) 3,000 B) 10,000 C) 30,000 D) 100,000 E) 300,000
C) 30,000
Consider a situation in which the enzyme is operating at optimum temperature and pH, and has been saturated with substrate. What is your best option for increasing the rate of the reaction? (A) Increase the pH. (B) Increase the temperature. (C) Increase the enzyme concentration. (D) Increase the substrate concentration.
C REASON: If an enzyme is saturated with substrate, and it is operating at optimum pH and optimum temperature, there is very little that can be done except to increase the enzyme concentration. Some enzymes can be activated further by allosteric activators, in which case one might add some activator to the reaction. But otherwise, increasing the enzyme concentration is the only option.
Which of the following statements about feedback regulation of a metabolic pathway is correct? (A) Accumulation of the product of the pathway increases further formation of that product. (B) The products of the pathway become the reactants for a different reaction, and thus products are unable to accumulate. (C) The final product of a metabolic pathway is usually the compound that regulates the pathway. (D) The enzyme that is regulated by feedback inhibition is usually the last enzyme in the metabolic pathway. (E) The compound that regulates the pathway acts as a competitive inhibitor or a positive allosteric regulator.
C REASON: It is quite common that the end product of the pathway controls the overall rate of the pathway. (ex. exergonic driving endergonic).
Some bacteria are metabolically active in hot springs because (A) they are able to maintain a lower internal temperature. (B) high temperatures make catalysis unnecessary. (C) their enzymes have high optimal temperatures. (D) their enzymes are completely insensitive to temperature.
C REASON: Some enzymes have high optimal temperatures, meaning they need to reach a certain (higher) temperature in order to function properly.
What is meant by the "induced fit" of an enzyme? (A) The shape of the active site is nearly perfect for specifically binding the enzyme's substrate or substrates. (B) The presence of the substrate in solution induces the enzyme to slightly change its structure. (C) The enzyme changes its shape slightly as the substrate binds to it. (D) The enzyme structure is altered so that it can be induced to fit many different types of substrate. (E) The substrate can be altered so that it is induced to fit into the enzyme's active site.
C REASON: The enzyme changes shape, not the substrate.
Which part of the adenosine triphosphate molecule is released when it is hydrolyzed to provide energy for biological reactions? (A) a-phosphate (the phosphate closest to ribose) (B) B-phosphate (the middle) (C) (gamma) γ-phosphate (the terminal phosphate) (D) adenine group (E) ribose sugar
C REASON: The γ-phosphate is the primary phosphate group on the ATP molecule that is hydrolyzed when energy is needed to drive anabolic reactions. Located the farthest from the ribose sugar, it has a higher energy than either the α- or β-phosphate.
Most cells cannot harness heat to perform work because (A) heat does not involve a transfer of energy. (B) cells do not have much thermal energy; they are relatively cool. (C) temperature is usually uniform throughout a cell. (D) heat can never be used to do work.
C REASON: Cells usually have uniform temperature and pH.
Which gas does not bind to the porphyrin ring Fe(II) ion in myoglobin? A) NO B) CO C) CO2 D) O2 E) H2S
C - CO2 does not bind to porphyrin ring
Which of these is not an artificial sweetener? A) saccharine B) aspartame C) maltose D) acesulfame E) alitame
C - Maltose
The value of n, the Hill constant (coefficient), for hemoglobin is about ______ as great as the value for myoglobin. A) half B) twice C) three times D) five times E) ten times
C - hill constant is 3x as great
Consider a hypothetical hemoglobin-like molecule with a Hill coefficient (constant) of 1 and the same p50 value as normal hemoglobin. Choose the statement below that best describes the two proteins. A) There is a cooperative interaction between oxygen-binding sites in both the hypothetical and normal hemoglobins. B) The hypothetical hemoglobin has a greater oxygen affinity than normal hemoglobin. C) The oxygen binding curve for the hypothetical hemoglobin is hyperbolic, and the curve for normal hemoglobin is sigmoidal. D) The two hemoglobins would be able to deliver about the same amount of oxygen to the tissues. E) At pO2 less than p50, normal hemoglobin has a greater YO2 value.
C - hypothetical Hg is hyperbolic, normal is sigmoidal
Cellulose is (asked for Chitin but they are both B 1-4) A) a linear copolymer of glucose and galactose. B) a branched polymer of glucose. C) a linear polymer of glucose with β(1-->4) linkages. D) a linear polymer of glucose with α(14) linkages. E) sometimes called starch.
C - linear polymer of glucose with B(1-->4) linkages
A saccharide that has free aldehyde group is called a(n) _____________. A) ketose B) nonreducing sugar C) reducing sugar D) aldohexose E) alditol
C - reducing sugar
Which statement about transposons is NOT correct? A) They are a form of molecular parasite. B) They have played a major role in human evolution. C) All transposons are active and move around the human genome. D) Some transposons move to another genomic location via an RNA intermediate. E) They often contain genes that encode proteins that catalyze transposon movement.
C) All transposons are active and move around the human genome.
Following complete hydrolysis of a sample of glycogen and a sample of cellulose, which of the following must be true? A) The glycogen sample is more soluble than the cellulose sample. B) The cellulose sample is more soluble than the glycogen sample. C) Both samples consist of a mixture of alpha-D-glucose and beta-D-glucose. D) The glycogen sample has a higher ratio of alpha-D-glucose than the cellulose sample. E) The cellulose sample contains only beta-D-glucose.
C) Both samples consist of a mixture of alpha-D-glucose and beta-D-glucose.
Which vitamin is derived from cholesterol? A) A B) B12 C) D D) E E) K
C) D
When cloning a gene into a plasmid, which enzyme would you use to covalently attach the gene to the plasmid DNA? A) DNA polymerase B) exonuclease III C) DNA Ligase D) alkaline phosphatase E) a restriction endonuclease
C) DNA Ligase
The PCR reaction mixture does NOT include: A) all four deoxynucleoside triphosphates. B) DNA containing the sequence to be amplified. C) DNA ligase. D) heat-stable DNA polymerase. E) oligonucleotide primer(s).
C) DNA ligase.
The PCR reaction mixture does not include: A) all four deoxynucleoside triphosphates. B) DNA containing the sequence to be amplified. C) DNA ligase. D) heat-stable DNA polymerase. E) oligonucleotide primer(s).
C) DNA ligase.
_____ is NOT a commonly used tag for affinity purification of cloned proteins. A) Glutathione-S-transferase B) Maltose binding protein C) Nickel D) Protein A E) Chitin-binding domain
C) Nickel
Which statement does NOT describe a characteristic of the fluid mosaic model of membranes? A) Hydrophobic interactions predominate between lipids in the membrane. B) Proteins and lipids are able to move laterally at different rates. C) Protein structures are able to move from one leaflet to another. D) Noncovalent forces predominate in intermolecular interactions.
C) Protein structures are able to move from one leaflet to another.
Which of the following statements concerning sialic acid residues on glycoproteins is true? A) Sialic residues on erythrocytes are recognized by lectins, leading to removal of the erythrocytes. B) Sialic residues on ceruloplasmin are recognized by lectins, leading to removal of ceruloplasmin. C) Sialic residues are removed by neuraminidases. D) The anti-viral drug oseltamavir accelerates the removal of sialic acid residues. E) Both A and B above
C) Sialic residues are removed by neuraminidases.
Which analytical technique does NOT help illuminate a gene's cellular function? A) DNA microarray analysis B) protein chip analysis C) Southern blotting D) two-dimensional gel electrophoresis E) two-hybrid analysis
C) Southern blotting
Which one of the following analytical techniques does not help illuminate a gene's cellular function? A) DNA microarray analysis B) Protein chip analysis C) Southern blotting D) Two-dimensional gel electrophoresis E) Two-hybrid analysis
C) Southern blotting
Which statement about membranes is TRUE? A) Most plasma membranes contain more than 70% proteins. B) Sterol lipids are common in bacterial plasma membranes. C) Sterol lipids are common in human cell plasma membranes. D) Sterol lipids are common in plant cell plasma membranes. E) The plasma membranes of all cell types within a particular organism have basically the same lipid and protein composition.
C) Sterol lipids are common in human cell plasma membranes.
Which statement about the composition of membranes is TRUE? A) All biological membranes contain cholesterol. B) Free fatty acids are major components of all membranes. C) The inner and outer membranes of mitochondria have different protein compositions. D) The lipid composition of all membranes of eukaryotic cells is essentially the same. E) The lipid:protein ratio varies from about 1:4 to 4:1.
C) The inner and outer membranes of mitochondria have different protein compositions.
Which of the following statements about heparan sulfate is not true? A) Sulfation of heparan sulfate to form NS domains is important for its role as an anti-coagulant. B) Heparan sulfate can promote protein-protein interactions via the NS domains. C) The secondary structure of heparan sulfate is completely random. D) The NA domains of heparan sulfate contain no sulfation. E) The core repeating structure of heparan sulfate is made up of alternating GlcNAc and GlcA.
C) The secondary structure of heparan sulfate is completely random.
What prevents proton translocation through aquaporins? A) Asp and Glu residues bind to protons to prevent their translocation. B) Carbonyl groups in the selectivity filter interact with water molecules. C) Two side chain amide groups act as hydrogen bond donors to a single water molecule. D) All of the answers are correct. E) None of the answers is correct.
C) Two side chain amide groups act as hydrogen bond donors to a single water molecule.
Which statement regarding Type I and Type II restriction endonucleases is NOT accurate? A) Type I endonucleases cleave DNA at random sites. B) Type II endonucleases recognize small (4-6 bp) palindromic sequences. C) Type II endonucleases always make staggered cuts in DNA strands. D) Type I endonucleases require ATP. E) Type I endonucleases are generally large, multisubunit complexes.
C) Type II endonucleases always make staggered cuts in DNA strands.
A ligand-gated ion channel (such as the nicotinic acetylcholine receptor) is: A) a charged lipid in the membrane bilayer that allows ions to pass through. B) a membrane protein that permits a ligand to pass through the membrane only when opened by the appropriate ion. C) a membrane protein that permits an ion to pass through the membrane only when opened by the appropriate ligand. D) a molecule that binds to the membrane thereby allowing ions to pass through. E) always requires a second ligand to close the channel once it is opened.
C) a membrane protein that permits an ion to pass through the membrane only when opened by the appropriate ligand.
An integral membrane protein can be extracted with: A) a buffer of alkaline or acid pH. B) a chelating agent that removes divalent cations. C) a solution containing detergent. D) a solution of high ionic strength. E) hot water.
C) a solution containing detergent.
Which term BEST describes the polarity of membrane lipids? A) ambidextrous B) completely nonpolar C) amphipathic D) completely polar E) amphibolic
C) amphipathic
Which type of chemical linkage is used to join fatty acids to glycerol? A) an ether linkage B) a peptide bond C) an ester linkage D) a double bond E) a peroxide bond
C) an ester linkage
The fluidity of the lipid side chains in the interior of a bilayer is generally increased by: A) a decrease in temperature. B) an increase in fatty acyl chain length. C) an increase in the number of double bonds in fatty acids. D) an increase in the percentage of phosphatidyl ethanolamine E) the binding of water to the fatty acyl side chains.
C) an increase in the number of double bonds in fatty acids.
Restriction enzymes: A) act at the membrane to restrict the passage of certain molecules into the cell. B) are highly specialized ribonucleases that degrade mRNA soon after its synthesis. C) are sequence-specific DNA endonucleases. D) are very specific proteases that cleave peptides at only certain sequences. E) catalyze the addition of a certain amino acid to a specific tRNA.
C) are sequence-specific DNA endonucleases.
Restriction enzymes: A) act at the membrane to restrict the passage of certain molecules into the cell. B) are highly specialized ribonucleases that degrade mRNA soon after its synthesis. C) are sequence-specific DNA endonucleases. D) are very specific proteases that cleave peptides at only certain sequences. E) catalyze the addition of a certain amino acid to a specific tRNA.
C) are sequence-specific DNA endonucleases.
A process NOT involving the fusion of two membranes or two regions of the same membrane is: A) endocytosis. B) entry of enveloped viruses into cells. C) entry of glucose into cells. D) exocytosis. E) reproductive budding in yeast.
C) entry of glucose into cells.
Which enzymes are NOT involved in moving phospholipids from one leaflet to another? A) flippases that move phosphatidylethanolamine and phosphatidylserine B) floppases that move phospholipids from the cytosolic leaflet to the extracellular leaflet C) flip-floppases that allow phospholipids to move back and forth between the inner and outer leaflets D) scramblases that allow phospholipids to move down their concentration gradient E) phosphatidylinositol transfer proteins that play a role in lipid signaling
C) flip-floppases that allow phospholipids to move back and forth between the inner and outer leaflets
39. The bonding of alcohols to the anomeric center of a carbohydrate results in the formation of a(n) __________ bond. A) anomeric B) amide C) glycosidic D) ester E) hydrogen
C) glycosidic
P-type ATPase transporters such as the SERCA pumps can be classified as enzymes. As what enzyme class would they be classified? A) oxidoreductases B) transferases C) hydrolases D) lyases E) ligases
C) hydrolases
Mutations in which genetic sequences are NOT likely to have a phenotypic effect? A) noncoding RNAs B) exons C) interspersed nuclear elements D) All of the answers are correct. E) None of the answers is correct.
C) interspersed nuclear elements
FRAP experiments are generally used in membrane studies to examine: A) transverse diffusion rates. B) active transport rates. C) lateral diffusion rates. D) both transverse diffusion rates and active transport rates. E) both transverse diffusion rates and lateral diffusion rates.
C) lateral diffusion rates.
Certain restriction enzymes produce cohesive (sticky) ends. This means that they: A) cut both DNA strands at the same base pair. B) cut in regions of high GC content, leaving ends that can form more hydrogen bonds than ends of high AT content. C) make a staggered double-strand cut, leaving ends with a few nucleotides of single-stranded DNA protruding. D) make ends that can anneal to cohesive ends generated by any other restriction enzyme. E) stick tightly to the ends of the DNA they have cut.
C) make a staggered double-strand cut, leaving ends with a few nucleotides of single-stranded DNA protruding.
Integrins are: A) membrane proteins that are involved in ion transport. B) membrane proteins that are involved in sugar transport. C) membrane proteins that mediate cell adhesion. D) proteins of the extracellular matrix that bind to cell surface proteins. E) proteins that are found at the membrane-cytoplasm interface.
C) membrane proteins that mediate cell adhesion
Myoglobin and a single chain of hemoglobin have similar ______ structures. A) primary B) secondary C) tertiary D) quaternary E) none of the above
C- 3
If you wanted to create specific DNA sequence changes to a plasmid in the coding sequence for a protein you are researching, but there are no suitably located restriction sites nearby, which technique would you use? A) error-prone PCR B) site-directed mutagenesis C) oligonucleotide-directed mutagenesis D) exposing the plasmid DNA to UV light E) exposing the cells containing the plasmid DNA to chemical mutagens
C) oligonucleotide-directed mutagenesis
Commercial vegetable oils can be converted from liquid forms to solid forms and have their shelf lives increased due to which process? A) partial desaturation B) unsaturation C) partial hydrogenation D) hydrolysis E) complete esterification
C) partial hydrogenation
Which glycerophospholipid has a net charge of zero at pH 7? A) phosphatidylserine B) phasphatidic acid C) phosphatidylcholine D) phosphatidylglycerol E) phosphatidylinositol 4,5-bisphosphate
C) phosphatidylcholine
Which membrane lipid serves as a reservoir of messenger molecules for signal transduction? A) taruocholic acid (TA) B) phosphatidylserine (PS) C) phosphatidylinositol 4,5-bisphosphate (PIP2) D) thromboxane A2 (TXA2) E) sphingomyelin (SM)
C) phosphatidylinositol 4,5-bisphosphate (PIP2)
An example of a glycerophospholipid that is involved in cell signaling is: A) arachidonic acid. B) ceramide. C) phosphatidylinositol. D) testosterone. E) vitamin A (retinol).
C) phosphatidylinositol.
A convenient cloning vector with which to introduce foreign DNA into E. coli is a(n): A) E. coli chromosome. B) messenger RNA. C) plasmid. D) yeast "ARS" sequence. E) yeast transposable element.
C) plasmid.
A convenient cloning vector with which to introduce foreign DNA into E. coli is a(n): A) E. coli chromosome. B) messenger RNA. C) plasmid. D) yeast "ARS" sequence. E) yeast transposable element.
C) plasmid.
Which phrase BEST describes the term "amphitropic"? A) cytosolic lipid-linked proteins B) GPI-linked proteins C) proteins that are reversibly membrane-associated or cytosolic D) proteins that are either integral or lipid-linked
C) proteins that are reversibly membrane-associated or cytosolic
When a bacterium such as E. coli is shifted from a warmer growth temperature to a cooler growth temperature, it compensates by: A) increasing its metabolic rate to generate more heat. B) putting longer-chain fatty acids into its membranes. C) putting more unsaturated fatty acids into its membranes. D) shifting from aerobic to anaerobic metabolism. E) synthesizing thicker membranes to insulate the cell.
C) putting more unsaturated fatty acids into its membranes.
Which type of DNA sequence is NOT found in the human genome? A) long repetitive repeats B) introns C) retro-palindromes D) simple sequence repeats E) transposons
C) retro-palindromes
Which process represents the HIGHEST energy state in membrane fusion? A) formation of coiled-coils in SNARE proteins B) formation of the fusion pore C) the hemifusion state D) the expansion of the fusion pore E) lipid mixing in both outer and inner leaflets
C) the hemifusion state
The process of linkage analysis does NOT rely on which technique to determine the genetic causes of diseases? A) analysis of family pedigrees B) identification of SNPs that are most often inherited with the disease-causing gene C) the sequence of the entire chromosome where the disease-causing gene is located to directly identify it D) comparing the DNA of people who have the disease with the DNA of people who don't have the disease E) obtaining many sequences of a region of the chromosome that is associated with the disease
C) the sequence of the entire chromosome where the disease-causing gene is located to directly identify it
Which technique is NOT commonly used to analyze lipid composition? A) selective extraction using apolar solvents B) adsorption chromatography C) x-ray crystallography D) hydrolysis using enzymes with specificity for certain linkages E) mass spectroscopy
C) x-ray crystallography
If you are comparing the total gene expression of a black panther during its early development and later adult life and have labeled the cDNA you obtained from its early development stages with a green fluorophore and the cDNA you obtained from its adult life stages with a red fluorophore, what color would you expect to see on your DNA microarray for genes that are equally expressed in both the early development and adult life stages? A) green B) red C) yellow D) brown E) magenta
C) yellow
How do lipids differ from the three other major classes of biological molecules?
lipids do not polymerize
What is the type of symmetry that relates the protomers in hemoglobin with respect to each other? C2 C4 D2 D4 Tetrahedral symmetry
C2
Nucleotides contain one or more phosphate groups that are usually attached to the:
C3' or C5' atoms
Nucleotides contain phosphate groups bonded to the:
C3' or C5' atoms
Nucleotides contain one or more phosphate groups that are usually attached to the:
C3ʹ or C5ʹ atoms
Which gas does not bind to the porphyrin ring Fe(II) ion in myoglobin? NO CO CO2 O2 H2S
CO2
Hemoglobin is involved in the transport of which ion and/or molecule through the blood?
CO2, O2, and H+
Select the statement the best matches that following: ATP Major component of the thick filament of the myofibril. Major component of the thin filament of the myofibril. Calcium binding protein. Chemical energy source for muscle contraction. Functional unit of the myofibril.
Chemical energy source for muscle contraction.
Compounds that contain a nitrogenous base, a sugar, and a phosphate group are called (a)_________________. Two purines found in DNA are (b)______________ and __________________. A pyrimidine found in all DNA but in only some RNA is (c)_________________. In DNA, the base pair (d)___-___ is held together by three hydrogen bonds; the base pair (e)___-___ has only two such bonds.
Compounds that contain a nitrogenous base, a sugar, and a phosphate group are called (a) nucleotides. Two purines found in DNA are (b)adenine and guanine. A pyrimidine found in all DNA but in only some RNA is (c)thymidine. In DNA, the base pair (d)G-C is held together by three hydrogen bonds; the base pair (e)A-T has only two such bonds.
Compounds that generate nitrous acid (such as nitrites, nitrates, and nitrosamines) change DNA molecules by: A) breakage of phosphodiester bonds. B) deamination of bases. C) depurination. D) formation of thymine dimers. E) transformation of A --> T.
Compounds that generate nitrous acid (such as nitrites, nitrates, and nitrosamines) change DNA molecules by: B) deamination of bases.
plasma
Liquid portion of blood. Carries water, nutrients, and waste products through the body. Thickness determines how blood will behave when spattering.
A restriction endonuclease that has a recognition sequence of 8 bp in length would be expected to cut dsDNA on average once in how many base pairs? A) 256 B) 1024 C) 4096 D) 65536 E) 1048576
D) 65536
Dna denaturation
Covalent bonds remain intact. - Genetic code remains intact. • Hydrogen bonds are broken. - Two strands separate. • Base stacking is lost - UV absorbance increases.
Which statement about cystine is correct?
Cystine forms when the-CH2-SH R group is oxidized to form a -CH2-S-S-CH2 disulfide bridge between 2 cysteines.
1. In DNA sequencing by the Sanger (dideoxy) method: A) radioactive dideoxy ATP is included in each of four reaction mixtures before enzymatic synthesis of complementary strands. B) specific enzymes are used to cut the newly synthesized DNA into small pieces, which are then separated by electrophoresis. C) the dideoxynucleotides must be present at high levels to obtain long stretches of DNA sequence. D) the role of the dideoxy CTP is to occasionally terminate enzymatic synthesis of DNA where Gs occur in the template strands. E) the template DNA strand is radioactive.
D
11. The ABC excinuclease is essential in: A) base-excision repair. B) methyl-directed repair. C) mismatch repair. D) nucleotide-excision repair. E) SOS repair.
D
13. In homologous recombination in E. coli, the protein that moves along a double-stranded DNA, unwinding the strands ahead of it and degrading them, is: A) chi. B) DNA ligase. C) RecA protein. D) RecBCD enzyme. E) RuvC protein (resolvase).
D
14. In homologous recombination in E. coli, the protein that assembles into long, helical filaments that coat a region of DNA is: A) DNA methylase. B) DNA polymerase. C) histone. D) RecA protein. E) RecBCD enzyme
D
17. Which of the following is not a feature of homologous recombination during meiosis? A) A double strand break B) Cleavage of two crossover events C) Alignment of homologous chromosomes D) Formation of a single Holliday intermediate E) Exposed 3' ends invade the intact duplex DNA of the homolog
D
18. Which of the following is not a feature of site-specific recombination? A) A specific recombinase enzyme is required. B) The energy of the phosphodiester bond is preserved in covalent enzyme-DNA linkage. 4 C) Recombination sites have non-palindromic sequences. D) Formation of Holliday intermediates is required. E) Insertions or deletions can result from site-specific recombination.
D
2. In the chemical synthesis of DNA: A) the dimethoxytrityl (DMT) group catalyzes formation of the phosphodiester bond. B) the direction of synthesis is 5' to 3'. C) the maximum length of oligonucleotide that can be synthesized is 8-10 nucleotides. D) the nucleotide initially attached to the silica gel support will become the 3' end of the finished product. E) the protecting cyanoethyl groups are removed after each step.
D
5. A next-generation method of DNA sequencing, 454 sequencing, uses pyrosequencing in which the addition of nucleotides is detected by a: A) radioactive signal. B) fluorescently labeled dNTP. C) pulse from a laser. D) flash of light. E) nano-ruler's physical movement of 4.54 nm detected by laser
D
6. The Ames test is used to: A) detect bacterial viruses. B) determine the rate of DNA replication. C) examine the potency of antibiotics. D) measure the mutagenic effects of various chemical compounds. E) quantify the damaging effects of UV light on DNA molecules.
D
A next-generation method of DNA sequencing, 454 sequencing, uses pyrosequencing in which the addition of nucleotides is detected by a: A) radioactive signal. B) fluorescently labeled dNTP. C) pulse from a laser. D) flash of light. E) nano-ruler's physical movement of 4.54 nm detected by laser.
D
A patient you are treating appears to be deficient in vitamin D. You have previously prescribed vitamin D supplements, but they do not appear to be working. Which organs and/or tissues should you check to make sure that the enzymes they produce are functioning appropriately? A) the liver B) the kidneys C) the pancreas D) both a the liver and the kidneys E) the liver, the kidneys, and the pancreas
D
According to the current model for HIV infection, which of the following is not involved in the process of membrane fusion? A) A cell surface co-receptor protein B) A cell surface receptor protein C) A viral glycoprotein complex D) The viral chromosome E) The viral envelope
D
Nonsteroidal antiinflammatory drugs (NSAIDs) inhibit the synthesis of which signaling lipids from arachidonic acid? A) prostaglandins B) thromboxanes C) leukotrienes D) both prostaglandins and thromboxanes E) both thromboxanes and leukotrienes
D
Advantages to using triacylglycerols, rather than polysaccharaides, to store energy include which reason(s)? A) The carbon atoms of triacylglycerols are more reduced. B) Triacylglycerols contain more oxygen than polysaccharides and therefore are more efficient to oxidize. C) Since triacylglycerols are hydrophobic, excess water does not need to be stored along with them. D) The carbon atoms of triacylglycerols are more reduced, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them. E) Triacylglycerols contain more oxygen than polysaccharides and therefore are more efficient to oxidize, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them.
D
B-form DNA in vivo is a _____-handed helix, _____ Å in diameter, with a rise of _____ Å per base pair. A) left; 20; 3.9 B) right; 18; 3.4 C) right; 18; 3.6 D) right; 20; 3.4 E) right; 23; 2.6
D
B-form DNA in vivo is a ________-handed helix, _____ Å in diameter, with a rise of ____ Å per base pair. A) left; 20; 3.9 B) right; 18; 3.4 C) right; 18; 3.6 D) right; 20; 3.4 E) right; 23; 2.6
D
Consider the transport of K+ from the blood (where its concentration is about 4 mM) into an erythrocyte that contains 150 mM K+. The transmembrane potential is about 60 mV, inside negative relative to outside. The free-energy change for this transport process is: (These values may be of use to you: R = 8.315 J/mol.K; T = 298 K; 9 (Faraday constant) = 96,480 J/V; N = 6.022 1023/mol.) A) about 5 J/mol. B) about 15 J/mol. C) about 5 kJ/mol. D) about 15 kJ/mol. E) impossible to calculate with the information given.
D
For the oligoribonucleotide pACGUAC, the nucleotide at the: A) 3' end has a phosphate at its 3' hydroxyl. B) 3' end is a purine. C) 5' end has a 5' hydroxyl. D) 5' end has a phosphate on its 5' hydroxyl. E) 5' end is a pyrimidine.
D
For the oligoribonucleotide pACGUAC: A) the nucleotide at the 3' end has a phosphate at its 3' hydroxyl. B) the nucleotide at the 3' end is a purine. C) the nucleotide at the 5' end has a 5' hydroxyl. D) the nucleotide at the 5' end has a phosphate on its 5' hydroxyl. E) the nucleotide at the 5' end is a pyrimidine
D
Glucose transport into erythrocytes is an example of: A) active transport. B) antiport. C) electrogenic uniport D) facilitated diffusion. E) symport.
D
If a patient you are treating has asthmatic attacks due to the overproduction of leukotrienes, which drug would you prescribe to help treat that condition? A) testosterone B) ibuprofen C) aspirin D) prednisone E) warfarin
D
In DNA sequencing by the Sanger (dideoxy) method: A) radioactive dideoxy ATP is included in each of four reaction mixtures before enzymatic synthesis of complementary strands. B) specific enzymes are used to cut the newly synthesized DNA into small pieces, which are then separated by electrophoresis. C) the dideoxynucleotides must be present at high levels to obtain long stretches of DNA sequence. D) the role of the dideoxy CTP is to occasionally terminate enzymatic synthesis of DNA where Gs occur in the template strands. E) the template DNA strand is radioactive.
D
In DNA sequencing by the Sanger (dideoxy) method: A) radioactive dideoxy ATP is included in each of four reaction mixtures before enzymatic synthesis of complementary strands. B) specific enzymes are used to cut the newly synthesized DNA into small pieces, which are then separated by electrophoresis. C) the dideoxynucleotides must be present at high levels to obtain long stretches of DNA sequence. D) the role of the dideoxy CTP is to occasionally terminate enzymatic synthesis of DNA where Gs occur in the template strands. E) the template DNA strand is radioactive
D
In a nucleoside, the pentose sugar is in its _____ form, and the ring is _____. A) α-furanose; planar B) α-pyranose; puckered C) β-furanose; planar D) β-furanose; puckered E) β-pyranose; planar
D
In the Watson-Crick model for the DNA double helix, which of the following is not true? A) The two strands run anti-parallel to one another. B) The base-pairing occurs on the inside of the double helix. C) The double helix is right-handed. D) There are two equally sized grooves that run up the sides of the helix. F) The two strands have complementary sequences.
D
In the Watson-Crick model for the DNA double helix, which statement is NOT true? A) The two strands run anti-parallel to one another. B) The base-pairing occurs on the inside of the double helix. C) The double helix is right-handed. D) There are two equally sized grooves that run up the sides of the helix. E) The two strands have complementary sequences.
D
In the chemical synthesis of DNA: A) the dimethoxytrityl (DMT) group catalyzes formation of the phosphodiester bond. B) the direction of synthesis is 5' to 3'. C) the maximum length of oligonucleotide that can be synthesized is 8-10 nucleotides. D) the nucleotide initially attached to the silica gel support will become the 3' end of the finished product. E) the protecting cyanoethyl groups are removed after each step.
D
In the chemical synthesis of DNA: A) the dimethoxytrityl (DMT) group catalyzes formation of the phosphodiester bond. B) the direction of synthesis is 5' to 3'. C) the maximum length of oligonucleotide that can be synthesized is 8-10 nucleotides. D) the nucleotide initially attached to the silica gel support will become the 3' end of the finished product. E) the protecting cyanoethyl groups are removed after each step.
D
Membrane fusion leading to neurotransmitter release requires the action of: A) cadherins. B) selectins. C) flipases. D) tSNARE and vSNARE. E) none of the above.
D
Phospholipase C hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP2 ) to form which signaling molecule that triggers Ca2+ release from the endoplasmic reticulum? A) diacylglycerolphosphate (DAGP) B) inositol 5-monophosphate (IP1 ) C) diacylglycerol (DAG) D) inositol 1,4,5-triphosphate (IP3 ) E) inositol 4,5-bisphosphate (IP2 )
D
Specific hydrolysis of phosphatidylcholine can be achieved by which technique? A) treatment of the lipid with phospholipase C B) treatment of the lipid with mild acid C) dissolving the lipid in chloroform D) treatment of the lipid with both phospholipase C and mild acid E) both treatment of the lipid with phospholipase C and dissolving the lipid in chloroform
D
The double helix of DNA in the B-form is stabilized by: A) covalent bonds between the 3' end of one strand and the 5' end of the other. B) hydrogen bonding between the phosphate groups of two side-by-side strands. C) hydrogen bonds between the riboses of each strand. D) nonspecific base-stacking interaction between two adjacent bases in the same strand. E)
D
The fluidity of a lipid bilayer will be increased by: F) decreasing the number of unsaturated fatty acids. C) decreasing the temperature. G) increasing the length of the alkyl chains. D) increasing the temperature. E) substituting 18:0 (stearic acid) in place of 18:2 (linoleic acid).
D
The image below shows a DNA sequencing gel using the Sanger method. The top of the gel is the anode and the bottom is the cathode. What is the sequence of the template DNA? A) 5′ ACTAGTGACCGT 3′ B) 5′ TGCCAGTGATCA 3′ C) 5′ ACGGTCACTAGT 3′ D) 5′ TGATCACTGGCA 3′ E) It cannot be determined from this information.
D
The nucleic acid bases: A) absorb ultraviolet light maximally at 280 nm. B) are all about the same size. C) are relatively hydrophilic. D) are roughly planar. E) can all stably base-pair with one another.
D
The nucleic acid bases: A) absorb ultraviolet light maximally at 280 nm. B) are all about the same size. C) are relatively hydrophilic. D) are roughly planar. E) can all stably base-pair with one another
D
The ribonucleotide polymer (5')GTGATCAAGC(3') could only form a double-stranded structure with: A) (5')CACTAGTTCG(3'). B) (5')CACUAGUUCG(3'). C) (5')CACUTTCGCCC(3'). D) (5')GCTTGATCAC(3'). E) (5')GCCTAGTTUG(3').
D
The ribonucleotide polymer (5')GTGATCAAGC(3') could only form a double-stranded structure with: A) (5')CACTAGTTCG(3'). B) (5')CACUAGUUCG(3'). C) (5')CACUTTCGCCC(3'). D) (5')GCTTGATCAC(3'). E) (5')GCCTAGTTUG(3').
D
The scientists who used x-ray crystallography to shed light on the three-dimensional structure of DNA were: A) Erwin Chargaff and colleagues. B) Alfred D. Hershey and Martha Chase. C) James Watson and Francis Crick. D) Rosalind Franklin and Maurice Wilkins. E) Oswald T. Avery, Colin MacLeod, and Maclyn McCarty.
D
The type of membrane transport that uses ion gradients as the energy source is: A) facilitated diffusion B) passive transport. C) primary active transport. D) secondary active transport. E) simple diffusion.
D
Triacylglycerols are composed of: A) a glycerol backbone. B) three fatty acids. C) amide linkages between the fatty acids and the glycerol. D) both a glycerol backbone and three fatty acids. E) a glycerol backbone, three fatty acids, and amide linkages between the fatty acids and the glycerol.
D
Triple-helical DNA structures can result from Hoogsteen (non Watson-Crick) interactions. These interactions are primarily: A) covalent bonds involving deoxyribose. B) covalent bonds involving the bases. C) hydrogen bonds involving deoxyribose. D) hydrogen bonds involving the bases. E) hydrophobic interactions involving the bases.
D
Triple-helical DNA structures can result from Hoogsteen (non Watson-Crick) interactions. These interactions are primarily: A) covalent bonds involving deoxyribose. B) covalent bonds involving the bases. C) hydrogen bonds involving deoxyribose. D) hydrogen bonds involving the bases. E) hydrophobic interactions involving the bases
D
Under which condition will peripheral protein be extracted from membrane. (a) a buffer of alkaline or acid pH. (b) a solution of chelating agents which remove divalent ions (c) high ionic strength (high salt) (d) all of the above
D
What is the MOST likely length of an mRNA that will code for a polypeptide with 150 amino acids? A) 50 nucleotides B) 150 nucleotides C) 450 nucleotides D) >450 nucleotides E) All of these lengths are possible depending on the organism in which the mRNA is found.
D
Which DNA primer would have the HIGHEST melting temperature? A) GCATCGGC B) AATCGGAT C) ATACAGATCGGC D) ACCGGCAGGTCGGC E) ATACGCAGATCGGC
D
Which base compositions for single-stranded RNA are possible? %A %G %C %T %U A) 5 45 45 0 5 B) 25 25 25 0 25 C) 35 10 30 0 25 D) All of the answers are correct. E) None of the answers is correct.
D
Which drug is NOT lipid based? A) prednisone B) warfarin C) erythromycin D) aspirin E) lovastatin
D
Which health effect is NOT associated with consumption of trans fats? A) lowering of HDL cholesterol B) increased inflammatory response in the body C) raising of LDL cholesterol D) increased joint flexibility due to additional membrane fluidity E) increased risk of heart disease
D
Which of the following are possible base compositions for single-stranded RNA? %A %G %C %T %U A) 5 45 45 0 5 B) 25 25 25 0 25 C) 35 10 30 0 25 D) All of the above E) None of the above
D
Which of the following contains an ether-linked alkyl group? A) Cerebrosides B) Gangliosides C) Phosphatidyl serine D) Platelet-activating factor E) Sphingomyelin
D
Which of the following is a palindromic sequence? A) AGGTCC TCCAGG B) CCTTCC GCAAGG C) GAATCC CTTAGG D) GGATCC CCTAGG E) GTATCC CATAGG
D
Which of the following is the major difference between glycogen and amylopectin? A) glycogen contains -glycosidic bonds, amylopectin contains -glycosidic bonds B) glycogen is branched, amylopectin is linear C) glycogen contains a reducing end, amylopectin does not D) glycogen contains about twice the number of branch points as amylopectin E) glycogen is found in plants, amylopectin is found in animals
D
Which of the following sequences represents a recognition site for N-linked glycosylation where X is any amino acid except Pro? A) Gln—X—Ser B) His—X—Ser C) Arg—X—Ser D) Asn—X—Ser E) Asp—X—Ser
D
Which of the following statements about membrane lipids is true? A) Glycerophospholipids are found only in the membranes of plant cells. B) Glycerophospholipids contain fatty acids linked to glycerol through amide bonds. C) Lecithin (phosphatidylcholine), which is used as an emulsifier in margarine and chocolate, is a sphingolipid. D) Some sphingolipids include oligosaccharides in their structure. E) Triacylglycerols are the principal components of erythrocyte membranes.
D
Which of the following statements does not apply to the K value in the equation for the oxygen binding curve of myoglobin? A) It is numerically equal to p50. B) It is defined as that oxygen partial pressure at which half of the oxygen binding sites are occupied. C) It is a measure of the affinity of myoglobin for oxygen. D) If Y > K, then myoglobin is less than 50% saturated with oxygen. E) It is the value of pO2 at which Y = 0.5.
D
Which one of the following is true of the pentoses found in nucleic acids? A) C-5 and C-1 of the pentose are joined to phosphate groups. B) The pentoses are in a planar configuration. C) The bond that joins nitrogenous bases to pentoses is an O-glycosidic bond. D) The pentoses are always in the β-furanose forms. E) The straight-chain and ring forms undergo constant interconversion
D
Which sequence is palindromic? A) AGGTCC TCCAGG B) CCTTCC GCAAGG C) GAATCC CTTAGG D) GGATCC CCTAGG E) GTATCC CATAGG
D
Which statement about membrane lipids is TRUE? A) Glycerophospholipids are found only in the membranes of plant cells. B) Glycerophospholipids contain fatty acids linked to glycerol through amide bonds. C) Lecithin (phosphatidylcholine), which is used as an emulsifier in margarine and chocolate, is a sphingolipid. D) Some sphingolipids include oligosaccharides in their structure. E) Triacylglycerols are the principal components of erythrocyte membranes.
D
Which statement describes a function of the addition of methyl groups to DNA? A) Methylation is used by E. coli as part of a defense mechanism to distinguish its DNA from foreign DNA. B) Methylation serves as a marker during repair of DNA during replication. C) Methylation of DNA occurs in some animals when infected with certain bacteriophages. D) All of the statements describe a function of DNA methylation. E) None of the statements describes a function of DNA methylation.
D
Which statement is TRUE about fatty acids? A) Fatty acids with longer chains have higher melting points. B) Fatty acids with longer chains have lower solubility in water. C) Fatty acids with more double bonds have higher melting points. D) Fatty acids with longer chains have higher melting points and lower solubility in water. E) None of the statements is true.
D
Which statement is TRUE of the pentoses found in nucleic acids? A) C-5 and C-1 of the pentose are joined to phosphate groups. B) The pentoses are in a planar configuration. C) The bond that joins nitrogenous bases to pentoses is an O-glycosidic bond. D) The pentoses are always in the β-furanose forms. E) The straight-chain and ring forms undergo constant interconversion.
D
Which technique separates lipids based on their affinity for a silica gel material? A) thin-layer chromatography B) adsorption chromatography C) mass spectrometry D) both thin-layer and absorption chromatography E) both thin-layer chromatography and mass spectrometry
D
Which types of lipids would NOT have their fatty acids completely hydrolyzed by treatment with acid or alkali? A) triacylglycerols B) galactolipids C) sphingomyelins D) plasmalogens E) phosphatidylcholines
D
_____ contain(s) an ether-linked alkyl group. A) Cerebrosides B) Gangliosides C) Phosphatidyl serine D) Platelet-activating factor E) Sphingomyelin
D
_____ is NOT a biological use of waxes. A) Energy storage B) Lubrication C) Structure D) Insulation E) Waterproofing
D
Which of the following statements about allosteric proteins is/are true? (A) They are sensitive to environmental conditions. (B) They are acted on by inhibitors. (C) They exist in active and inactive conformations. (D) All of the first listed responses are correct. (E) None of the first three listed responses are correct.
D REASON: All of the reasons are correct; allosteric proteins are sensitive to environmental conditions, they exist in active/inactive conformations, and they are acted on by inhibitors.
The process of stabilizing the structure of an enzyme in its active form by the binding of a molecule is an example of __________. (A) noncompetitive inhibition (B) competitive inhibition (C) cooperativity (D) allosteric regulation (E) feedback inhibition
D REASON: Allosteric regulation involves stabilizing the structure of an enzyme in its active form by the binding of a molecule. Allosteric regulation is the term used to describe any case in which a protein's function at one site is affected by the binding of a regulatory molecule to a separate site.
Which of the following statements correctly describe(s) the role or roles of heat in biological reactions? (A) Heat from the environment is necessary for substrates to get over the activation energy barrier. (B) The kinetic energy of the substrates is increased as the amount of heat in the system is increased. (C) Increasing the amount of heat in a system will always increase the rate of enzyme-catalyzed reactions. (D) The first and second choices are correct. (E) The second and third choices are correct.
D REASON: As the heat energy in a system increases, so does the kinetic energy of the reactants. As the kinetic energy of the reactants increases, the reactants are more likely to interact (with each other directly, or with the active site of an enzyme). Subsequently, the reaction rate would increase. Increasing the amount of heat in a system is true only for a limited temperature range. With increasing temperatures, the enzyme will eventually denature, leading to a lower rate of the reaction.
Which of these statements about enzyme inhibitors is true? (A) A competitive inhibitor binds to the enzyme at a place that is separate from the active site. (B) When the product of an enzyme or an enzyme sequence acts as its inhibitor, this is known as positive feedback. (C) Inhibition of enzyme function by compounds that are not substrates is something that only occurs under controlled conditions in the laboratory. (D) The action of competitive inhibitors may be reversible or irreversible. (E) A noncompetitive inhibitor does not change the shape of the active site.
D REASON: Competitive inhibitors that bind covalently to the enzyme would be irreversible, and those that bind weakly would be reversible.
If the entropy of a living organism is decreasing, which of the following is most likely to be occurring simultaneously? (A) Heat is being used by the organism as a source of energy. (B) The first law of thermodynamics is being violated. (C) In this situation, the second law of thermodynamics must not apply. (D) Energy input into the organism must be occurring to drive the decrease in entropy. (E) The entropy of the organism's environment must also be decreasing.
D REASON: Decreasing energy is equivalent to +delta G, which is a nonspontaneous reaction... therefore, requiring energy.
The formation of glucose-6-phosphate from glucose is an endergonic reaction and is coupled to which of the following reactions or pathways? (A) the conversion of glucose + fructose to make sucrose (B) the contraction of a muscle cell (C) the formation of ATP from ADP + Pi (D) the hydrolysis of ATP (E) the active transport of a phosphate ion into the cell
D REASON: Endergonic reactions are usually coupled with exergonic reactions. D is the only exergonic reaction in the list of answers.
If an enzyme is added to a solution where its substrate and product are in equilibrium, what will occur? (A) Additional substrate will be formed. (B) The reaction will change from endergonic to exergonic. (C) The free energy of the system will change. (D) Nothing; the reaction will stay at equilibrium.
D REASON: Once a reaction reaches equilibrium, it will stay in equilibrium. Additional substrate can't be formed because it's already in equilibrium. Enzymes also do affect free energy change in a chemical reaction.
When 1 mole of ATP is hydrolyzed in a test tube without an enzyme, about twice as much heat is given off as when 1 mole of ATP is hydrolyzed in a cell. Which of the following best explains these observations? (A) Cells are less efficient at energy metabolism than reactions that are optimized in a test tube. (B) The amount of heat released by a reaction has nothing to do with the free energy change of the reaction. (C) In cells, ATP is hydrolyzed to ADP and Pi, but in the test tube it is hydrolyzed to carbon dioxide and water. (D) In the cell, the hydrolysis of ATP is coupled to other endergonic reactions. (E) Cells have the ability to store heat; this cannot happen in a test tube.
D REASON: The coupling of ATP to other endergonic processes in cells means that less of the free energy is released as heat. When ATP is hydrolyzed without this coupling (like in a test tube), all of the energy is released as heat.
Consider the growth of a farmer's crop over a season. Which of the following correctly states a limitation imposed by the first or second law of thermodynamics? (A) The entropy of the universe must decrease to account for the increased entropy associated with plant growth. (B) The process of photosynthesis produces energy that the plant uses to grow. (C) Growth of the crops must occur spontaneously. (D) To obey the first law, the crops must represent an open system. (E) All of the listed responses are correct.
D REASON: The first law states that energy cannot be created. The growth of plants stores much energy in the body of the plant. That energy must have been obtained from the plant's environment; thus, the plant must be an open system.
In cells, what is usually the immediate source of energy for an endergonic reaction? (A) ADP (B) sugar (C) as spontaneous reactions, endergonic reactions do not need an addition of energy (D) ATP (E) glucose
D REASON: The hydrolysis of ATP provides the energy needed for an endergonic reaction.
What is the fate of the phosphate group that is removed when ATP is converted to ADP? (A) It is used to convert an ATP into an AQP. (B) It is acquired by a reactant in an exergonic reaction. (C) It is acquired by a reactant in a spontaneous reaction. (D) It is acquired by a reactant in an endergonic reaction. (E) It is broken down into one phosphorus and four oxygen atoms.
D REASON: By acquiring the phosphate group, the reactant ACQUIRES energy... which is the definition of an endergonic reaction.
Which of the following statements applies to all artificial sweeteners? A) Artificial sweeteners cannot be readily metabolized. B) Artificial sweeteners are peptides and provide important amino acids. C) Artificial sweeteners have fewer calories than sucrose. D) Artificial sweeteners are much sweeter than sucrose. E) all of the above
D - Artificial sweeteners are much sweeter than sucrose
Chitin differs from cellulose due to A) inversion of configuration at the anomeric carbon. B) sulfonation of the C2 OH group. C) a much greater prevalence of branching. D) replacement of the C2 OH group by an acetamido group. E) replacement of the C6 OH group by an amino group.
D - replaces the C2 OH group with an acetamido group
A good expression vector for protein expression in E. coli should have which feature(s)? A) an origin of replication B) a selectable marker C) a promoter, operator, and ribosome-binding site D) All of the answers are correct. E) None of the answers is correct.
D) All of the answers are correct.
Common problems with expression of eukaryotic proteins in bacteria may include proteins: A) aggregating into inclusion bodies. B) not folding correctly due to absence of chaperones. C) not undergoing posttranslational modification. D) All of the answers are correct. E) None of the answers is correct.
D) All of the answers are correct.
During their multiple migrations from Africa to the rest of the world, gene flow likely occurred between which populations of early humanoids? A) between Neanderthals and modern humans B) between Denisovans and modern humans C) between Neanderthals and Denisovans D) All of the answers are correct. E) None of the answers is correct.
D) All of the answers are correct.
Which factor is required to accurately determine the relative amount of gene expression of two or more genes in an organism using qPCR? A) a "no template" control B) an oligonucleotide probe labeled with a fluorophore and a quenching molecule at its ends C) use of reverse transcriptase to copy the RNA products into DNA D) All of the answers are correct. E) None of the answers is correct.
D) All of the answers are correct.
Yeast two-hybrid analysis functions due to which reason? A) The DNA-binding domain and transcriptional activation domain of a separated transcription factor are only brought into close proximity when the two proteins of interest interact with each other. B) The DNA-binding domain and the transcriptional activation domain of a separated transcription factor may remain stable independent of each other. C) Yeast can be grown as either a haploid or a diploid cell. D) All of the answers are correct. E) None of the answers is correct.
D) All of the answers are correct.
46. Which of the following statements applies to all artificial sweeteners? A) Artificial sweeteners cannot be readily metabolized. B) Artificial sweeteners are peptides and provide important amino acids. C) Artificial sweeteners have fewer calories than sucrose. D) Artificial sweeteners are much sweeter than sucrose. E) all of the above
D) Artificial sweeteners are much sweeter than sucrose.
60. Which of the following sequences represents a recognition site for N-linked glycosylation where X is any amino acid except Pro? A) Gln—X—Ser B) His—X—Ser C) Arg—X—Ser D) Asn—X—Ser E) Asp—X—Ser
D) Asn—X—Ser
When forming the disaccharide maltose from two glucose monosaccharides: A) water is eliminated. B) a hemiacetal is converted to an acetal. C) the resulting dissacharide is no longer a reducing sugar. D) Both A and B E) A, B, and C above
D) Both A and B
Which restriction endonuclease cuts DNA in a way that leaves blunt ends? A) EcoRI B) HindIII C) BamHI D) EcoRV E) PstI
D) EcoRV
Which statement is TRUE about fatty acids? A) Fatty acids with longer chains have higher melting points. B) Fatty acids with longer chains have lower solubility in water. C) Fatty acids with more double bonds have higher melting points. D) Fatty acids with longer chains have higher melting points and lower solubility in water. E) None of the statements is true.
D) Fatty acids with longer chains have higher melting points and lower solubility in water.
Which of the following statements about hydrogen bonding in glycogen and cellulose is true? A) Glycogen forms more internal H-bonds than cellulose. B) Extensive internal hydrogen bonding makes cellulose more water soluble than glycogen. C) Extensive hydrogen bonding with water makes cellulose more soluble than glycogen. D) Glycogen primarily forms hydrogen bonds within a single chain. E) The hydrogen bonding in cellulose favors a helical conformation.
D) Glycogen primarily forms hydrogen bonds within a single chain.
Which statement is NOT correct? A) Humans and chimpanzees share a common ancestor. B) Orangutans are an outgroup when compared with humans and chimpanzees. C) Humans and chimpanzees differ over approximately 4% of their genomes. D) Humans evolved from chimpanzees. E) Humans have 23 pairs of chromosomes, while chimpanzees have 24 pairs of chromosomes.
D) Humans evolved from chimpanzees.
Which of the following is a heteropolysaccharide? A) Cellulose B) Chitin C) Glycogen D) Hyaluronate E) Starch
D) Hyaluronate is a heteropolysaccharide. (made of alternating residues of D-glucuronic acid and N-acetylglucosamine)
_____ is NOT a biological use of waxes. A) Energy storage B) Lubrication C) Structure D) Insulation E) Waterproofing
D) Insulation
Which of the following is a dominant feature of the outer membrane of the cell wall of gram negative bacteria? A) Amylose B) Cellulose C) Glycoproteins D) Lipopolysaccharides E) Lipoproteins
D) Lipopolysaccharides is a dominant feature of the outer membrane of the cell wall of gram negative bacteria.
Which of the following is not a reason that it is difficult to study oligosaccharide composition from biological systems? A) Oligosaccharides are often branched. B) Oligosaccharides often have a high negative charge density. C) Oligosaccharides have a variety of linkages (e.g., alpha1->6 or beta1->4). D) Oligosaccharides have too much conformational flexibility. E) There are no specific glycosidase enzymes that can be used to selectively digest oligosaccharides.
D) Oligosaccharides have too much conformational flexibility.
_____ contain(s) an ether-linked alkyl group. A) Cerebrosides B) Gangliosides C) Phosphatidyl serine D) Platelet-activating factor E) Sphingomyelin
D) Platelet-activating factor
Integral membrane proteins tend to be enriched for regular secondary structures in the transmembrane portions of their structures. Which statement explains this observation? A) Regular secondary structures allow for polar amino acids to interact with lipid head groups. B) Regular secondary structures allow the polypeptide to interact with the membrane core. C) Regular secondary structures are energetically favorable for polypeptides. D) Regular secondary structures satisfy hydrogen-bonding potential of the backbone in a hydrophobic environment.
D) Regular secondary structures satisfy hydrogen-bonding potential of the backbone in a hydrophobic environment.
Which statement about membrane lipids is TRUE? A) Glycerophospholipids are found only in the membranes of plant cells. B) Glycerophospholipids contain fatty acids linked to glycerol through amide bonds. C) Lecithin (phosphatidylcholine), which is used as an emulsifier in margarine and chocolate, is a sphingolipid. D) Some sphingolipids include oligosaccharides in their structure. E) Triacylglycerols are the principal components of erythrocyte membranes.
D) Some sphingolipids include oligosaccharides in their structure.
Advantages to using triacylglycerols, rather than polysaccharaides, to store energy include which reason(s)? A) The carbon atoms of triacylglycerols are more reduced. B) Triacylglycerols contain more oxygen than polysaccharides and therefore are more efficient to oxidize. C) Since triacylglycerols are hydrophobic, excess water does not need to be stored along with them. D) The carbon atoms of triacylglycerols are more reduced, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them. E) Triacylglycerols contain more oxygen than polysaccharides and therefore are more efficient to oxidize, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them.
D) The carbon atoms of triacylglycerols are more reduced, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them.
Which statement is TRUE concerning the chloride-bicarbonate exchanger? A) This transporter is electrogenic. B) The exchanger is a passive antiporter. C) This protein is involved in carbon dioxide transport in the blood stream. D) The exchanger is a passive antiporter, and this protein is involved in carbon dioxide transport in the blood stream. E) This transporter is electrogenic, and the exchanger is a passive antiporter.
D) The exchanger is a passive antiporter, and this protein is involved in carbon dioxide transport in the blood stream.
27. At equilibrium in solution, D-glucose consists of a mixture of its anomers. Which statement most accurately describes this solution? A) The solution consists of approximately equal amounts of the α- and β-anomers. B) The straight-chain form is present in high concentration. C) The α-anomer is more stable and is slightly preferred over the β-anomer. D) The β-anomer predominates over the α-anomer by a ratio of approximately 2:1. E) None of the answers above is correct.
D) The β-anomer predominates over the α-anomer by a ratio of approximately 2:1.
Which of the following statements about type II restriction enzymes is false? A) Many make staggered (off-center) cuts within their recognition sequences. B) Some cut DNA to generate blunt ends. C) They are part of a bacterial defense system in which foreign DNA is cleaved. D) They cleave and ligate DNA. E) They cleave DNA only at recognition sequences specific to a given restriction enzyme
D) They cleave and ligate DNA.
Which statement about Type II restriction enzymes is FALSE? A) Many make staggered (off-center) cuts within their recognition sequences. B) Some cut DNA to generate blunt ends. C) They are part of a bacterial defense system in which foreign DNA is cleaved. D) They cleave and ligate DNA. E) They cleave DNA only at recognition sequences specific to a given restriction enzyme.
D) They cleave and ligate DNA.
The gene for green fluorescent protein was originally isolated from which species? A) a panda B) a firefly C) a mushroom D) a jellyfish E) a glowworm
D) a jellyfish
Glucose transport into erythrocytes is an example of: A) active transport. B) antiport. C) electrogenic uniport D) facilitated diffusion. E) symport.
D) facilitated diffusion.
Consider the transport of K+ from the blood (where its concentration is about 4 mM) into an erythrocyte that contains 150 mM K+. The transmembrane potential is about 60 mV, inside negative relative to outside. What is the free-energy change for this transport process? (These values may be of use to you: R = 8.315 J/mol . K; T = 298 K; Á (Faraday constant) = 96,480 J/V; N = 6.022 × 1023/mol.) A) about 5 J/mol B) about 15 J/mol C) about 5 kJ/mol D) about 15 kJ/mol E) It is impossible to calculate with the information given.
D) about 15 kJ/mol
49. Which of these polysaccharides is a branched polymer? A) chitin B) amylose C) cellulose D) amylopectin E) hyaluronic acid
D) amylopectin
Which type of organism do you NOT expect to express functionally fluorescent GFP? A) an obligate aerobe B) a multicellular eukarotic organism C) a facultative anaerobe D) an obligate anaerobe E) a unicellular eukaryotic organism
D) an obligate anaerobe
Triacylglycerols are composed of: A) a glycerol backbone. B) three fatty acids. C) amide linkages between the fatty acids and the glycerol. D) both a glycerol backbone and three fatty acids. E) a glycerol backbone, three fatty acids, and amide linkages between the fatty acids and the glycerol.
D) both a glycerol backbone and three fatty acids.
A patient you are treating appears to be deficient in vitamin D. You have previously prescribed vitamin D supplements, but they do not appear to be working. Which organs and/or tissues should you check to make sure that the enzymes they produce are functioning appropriately? A) the liver B) the kidneys C) the pancreas D) both a the liver and the kidneys E) the liver, the kidneys, and the pancreas
D) both a the liver and the kidneys
Which factor contributes to the selectivity pore of the potassium channel from S. lividans? A) backbone carbonyl groups in irregular secondary structures B) negatively charged amino acids near the channel opening C) the N-terminal ends of 4 a helices D) both backbone carbonyl groups in irregular secondary structures and negatively charged amino acids near the channel opening E) both backbone carbonyl groups in irregular secondary structures and the N-terminal ends of 4 a helices
D) both backbone carbonyl groups in irregular secondary structures and negatively charged amino acids
Which transporters can be classified as active transporters? A) flippases B) floppases C) scramblases D) both flippases and floppases E) both flippases and scramblases
D) both flippases and floppases
Which structure describes an integral membrane protein containing a b barrel? A) maltoporin B) aquaporin C) E. coli OmpF D) both maltoporin and E. coli OmpF E) both maltoporin and aquaporin
D) both maltoporin and E. coli OmpF
Nonsteroidal antiinflammatory drugs (NSAIDs) inhibit the synthesis of which signaling lipids from arachidonic acid? A) prostaglandins B) thromboxanes C) leukotrienes D) both prostaglandins and thromboxanes E) both thromboxanes and leukotrienes
D) both prostaglandins and thromboxanes
Especially stable haplotypes exist in which portions of the human genome due to their relative lack of meiotic recombination? A) the Y chromosome B) the X chromosome C) the mitochondrial genome D) both the Y chromosome and the mitochondrial genome E) both the X chromosome and the mitochondrial genome
D) both the Y chromosome and the mitochondrial genome
Which technique separates lipids based on their affinity for a silica gel material? A) thin-layer chromatography B) adsorption chromatography C) mass spectrometry D) both thin-layer and absorption chromatography E) both thin-layer chromatography and mass spectrometry
D) both thin-layer and absorption chromatography
Which compound is NOT needed in 454 pyrosequencing of DNA? A) dNTPs B) sulfurylase C) luciferase D) ddNTPs E) apyrase
D) ddNTPs
Which technique used to analyze lipids is the fastest but may not be the most accurate? A) thin-layer chromatography B) high-performance chromatography C) nuclear magnetic resonance D) direct mass spectrometry E) gas chromatography
D) direct mass spectrometry
Which compound(s) is/are NOT enriched in lipid rafts? A) sphingolipids B) cholesterol C) GPI-linked proteins D) farnesylated proteins E) All of these molecules are enriched in lipid rafts.
D) farnesylated proteins
Which health effect is NOT associated with consumption of trans fats? A) lowering of HDL cholesterol B) increased inflammatory response in the body C) raising of LDL cholesterol D) increased joint flexibility due to additional membrane fluidity E) increased risk of heart disease
D) increased joint flexibility due to additional membrane fluidity
The fluidity of a lipid bilayer will be increased by: A) decreasing the number of unsaturated fatty acids. B) decreasing the temperature. C) increasing the length of the alkyl chains. D) increasing the temperature. E) substituting 18:0 (stearic acid) in place of 18:2 (linoleic acid).
D) increasing the temperature.
Phospholipase C hydrolyzes phosphatidylinositol 4,5-bisphosphate (PIP2) to form which signaling molecule that triggers Ca2+ release from the endoplasmic reticulum? A) diacylglycerolphosphate (DAGP) B) inositol 5-monophosphate (IP1) C) diacylglycerol (DAG) D) inositol 1,4,5-triphosphate (IP3) E) inositol 4,5-bisphosphate (IP2)
D) inositol 1,4,5-triphosphate (IP3)
Which method is NOT used in linkage analysis? A) comparing densely spaced polymorphisms B) collecting DNA from a family affected by the disease of interest C) sequencing selected parts of the genome D) introducing retroviruses at the mutated locus E) looking for SNP variants
D) introducing retroviruses at the mutated locus
62. Proteins that bind to specific carbohydrates are called ______. A) pectins B) oligonucleotides C) glycosaminoglycans D) lectins E) chitins
D) lectins
What is the meaning of the term "annular lipid"? A) lipids that tend to form micelle structures B) lipids that are formed from the degradation of phospholipids C) lipids that are prosthetic groups in lipid-anchored proteins D) lipids that are found in close association with integral membrane proteins. E) None of the answers is correct.
D) lipids that are found in close association with integral membrane proteins.
The biochemical activity of a protein, such as its enzymatic activity, is called its _____ function. A) phenotypic B) genotypic C) cellular D) molecular E) organismal
D) molecular
Which types of lipids would NOT have their fatty acids completely hydrolyzed by treatment with acid or alkali? A) triacylglycerols B) galactolipids C) sphingomyelins D) plasmalogens E) phosphatidylcholines
D) plasmalogens
If a patient you are treating has asthmatic attacks due to the overproduction of leukotrienes, which drug would you prescribe to help treat that condition? A) testosterone B) ibuprofen C) aspirin D) prednisone E) warfarin
D) prednisone
50. Chitin differs from cellulose due to A) inversion of configuration at the anomeric carbon. B) sulfonation of the C2 OH group. C) a much greater prevalence of branching. D) replacement of the C2 OH group by an acetamido group. E) replacement of the C6 OH group by an amino group.
D) replacement of the C2 OH group by an acetamido group.
The type of membrane transport that uses ion gradients as the energy source is: A) facilitated diffusion B) passive transport. C) primary active transport. D) secondary active transport. E) simple diffusion.
D) secondary active transport.
Which repeating sequences in the human genome are the targets of technologies used in forensic DNA analysis? A) simple-sequence repeats B) single nucleotide polymorphisms C) introns D) short tandem repeats E) long repetitive sequences
D) short tandem repeats
You are comparing the DNA sequences of several species with a shared evolutionary ancestry. Species 1 has a sequence of ATGCCA, species 2 has a sequence of ATACCA, species 3 has a sequence of ATACTA, species 4 has a sequence of ACACTG, and species 5 has a sequence of ATGCCA. Which species is an outgroup compared with all the others? A) species 1 B) species 2 C) species 3 D) species 4 E) species 5
D) species 4
Membrane fusion leading to neurotransmitter release requires the action of: A) cadherins. B) selectins. C) flipases. D) tSNARE and vSNARE. E) None of the answers is correct.
D) tSNARE and vSNARE.
61. O-linked oligosaccharides are commonly attached to the —OH group of _____. A) ribose B) tyrosine C) lysine D) threonine E) glycine
D) threonine
Specific hydrolysis of phosphatidylcholine can be achieved by which technique? A) treatment of the lipid with phospholipase C B) treatment of the lipid with mild acid C) dissolving the lipid in chloroform D) treatment of the lipid with both phospholipase C and mild acid E) both treatment of the lipid with phospholipase C and dissolving the lipid in chloroform
D) treatment of the lipid with both phospholipase C and mild acid
If you want to express two different genes on different plasmids in a bacterial host, which procedure will NOT be successful? A) using plasmids that have the same promoter sequence B) using EcoRI and BamHI restriction endonucleases to clone the genes into their respective plasmids C) placing different fusion tags on each of the genes when cloning them D) using plasmids with the same origin of replication E) using plasmids that have different selectable markers
D) using plasmids with the same origin of replication
Hemoglobin's p50 value is about ______ as great as myoglobin's p50 value. A) one-tenth B) half C) twice D) ten times E) twenty times
D- 10xs as great
At equilibrium in solution, D-glucose consists of a mixture of its anomers. Which statement most accurately describes this solution? A) The solution consists of approximately equal amounts of the a- and B-anomers. B) The straight-chain form is present in high concentration. C) The a-anomer is more stable and is slightly preferred over the B-anomer. D) The B-anomer predominates over the a-anomer by a ratio of approximately 2:1. E) None of the answers above is correct.
D- The beta anomer predominated over the alpha anomer by a ratio of approx. 2:1
O-linked oligosaccharides are commonly attached to the —OH group of _____. A) ribose B) tyrosine C) lysine D) threonine E) glycine
D- Threonine and Serine
If the gene for myoglobin is "knocked out" in mice, the mice: A) have larger lungs. B) respire extremely rapidly. C) have dark brown muscle tissue. D) appear normal, with lighter colored muscle tissue. E) have their growth stunted.
D- mgb gives red color to blood
D-Glucose is called a reducing sugar because it undergoes an oxidation-reduction reaction at the anomeric carbon. One of the products of this reaction is: A) D-galactose. B) D-gluconate. C) D-glucuronate. D) D-ribose. E) muramic acid.
D-Glucose is called a reducing sugar because it undergoes an oxidation-reduction reaction at the anomeric carbon. One of the products of this reaction is: B) D-gluconate.
Mutations leading to changes that can be inherited by the next generation have to be introduced into at the _______ level.
DNA
Mutations leading to changes that can be inherited by the next generation have to be introduced into at the _______ level.
DNA
When cloning a gene into a plasmid, which enzyme would you use to covalently attach the gene to the plasmid DNA?
DNA Ligase
In 1944 Avery, MacLeod, and McCarty did experiments with Diplococcus pneumoniae that proved that
DNA can permanently transform a non-pathogenic strain into a pathogenic strain
In 1944 Avery, MacLeod, and McCarty did experiments with Diplococcus pneumoniae that proved that...?
DNA can permanently transform a non-pathogenic strain into a pathogenic strain
Why is the decreased affinity of fetal hemoglobin for BPG advantageous? With fewer BPG molecules bound there are more heme residues available for O2 binding. Decreased BPG binding biases the fetal hemoglobin toward the R state. More free BPG is available to bind to adult hemoglobin, resulting in a shift to the R state. BPG is available to bind to fetal myoglobin, helping to release O2 in fetal muscle tissue. None of the above.
Decreased BPG binding biases the fetal hemoglobin toward the R state.
What does it mean when the concentration of Delta (G) = Delta (G) PRIME ?
Delta (G) = Delta (G) PRIME When: (X) = (Y) *As both Delta (G) = Delta (G) PRIME and (X) = (Y) undergo reactions, the relative amounts of each will change until they reach equilibrium; when there is no net change in the relative amounts of (X) and (Y).
The phosphodiester bonds that link adjacent nucleotides in both RNA and DNA: A) always link A with T and G with C. B) are susceptible to alkaline hydrolysis. C) are uncharged at neutral pH. D) form between the planar rings of adjacent bases. E) join the 3' hydroxyl of one nucleotide to the 5' hydroxyl of the next
E
Describe the Plot of Initial rate as a function of substrate concentration [S] for an Allosteric Enzyme.
Displays a Sigmoidal curve instead of a hyperbolic curve as in the M-M plot bc of Positive cooperative binding. For Allosteric enzymes, there is a High affinity for the substrate and causes a rapid increase in velocity of the reaction at higher concentration of substrate [S] until Vmax is reached. Vo is Directly proportional to [S] until Vmax is reached. There is low enzyme activity at low substrate concentration and rapid increase in enzyme activity as [S] increases.
Double-stranded regions of RNA: A) are less stable than double-stranded regions of DNA. B) can be observed in the laboratory, but probably have no biological relevance. C) can form between two self-complementary regions of the same single strand of RNA. D) do not occur. E) have the two strands arranged in parallel (unlike those of DNA, which are antiparallel).
Double-stranded regions of RNA: C) can form between two self-complementary regions of the same single strand of RNA.
12. An alternative repair system by error-prone translesion DNA synthesis can result in a high mutation rate, because: A) alternative modified nucleotides can be incorporated more readily. 3 B) interference from the RecA and SSB proteins hinders the normal replication accuracy. C) replication proceeds much faster than normal, resulting in many more mistakes. D) the DNA polymerases involved cannot facilitate base-pairing as well as DNA polymerase III. E) the DNA polymerases involved lack exonuclease proofreading activities.
E
16. Which of the following statements is false? In vitro, the strand-exchange reaction: A) can include formation of a Holliday intermediate. B) is accompanied by ATP hydrolysis. C) may involve transient formation of a three- or four-stranded DNA complex. D) needs RecA protein. E) requires DNA polymerase.
E
7. In a mammalian cell, DNA repair systems: A) are extraordinarily efficient energetically. B) are generally absent, except in egg and sperm cells. C) can repair deletions, but not mismatches. D) can repair most types of lesions except those caused by UV light. E) normally repair more than 99% of the DNA lesions that occur.
E
A hydropathy plot is used to: A) determine the water-solubility of a protein. B) deduce the quaternary structure of a membrane protein. C) determine the water content of a native protein. D) extrapolate for the true molecular weight of a membrane protein. E) predict whether a given protein sequence contains membrane-spanning segments.
E
An electrogenic Na+ transporter: A) catalyzes facilitated diffusion of Na+ from a region of high Na+ concentration to one of lower Na+ concentration. B) must catalyze an electron transfer (oxidation-reduction) reaction simultaneously with Na+ transport. C) must transport both Na+ and a counterion (Cl-, for example). D) transports Na+ against its concentration gradient. E) transports Na+ without concurrent transport of any other charged species.
E
Chargaff's rules state that in typical DNA: A) A = G. B) A = C. C) A = U. D) A + T = G + C. E) A + G = T + C.
E
Chargaff's rules state that in typical DNA: A) A = G. B) A = C. C) A = U. D) A + T = G + C. E) A + G = T + C.
E
Glycoproteins A) are only found in bacteria. B) are extremely homogeneous. C) are typically less than 1% carbohydrate by weight. D) are assembled under strict genetic control. E) exhibit microheterogeneity.
E
In comparison with DNA-DNA double helices, the stability of DNA-RNA and RNA-RNA helices is: A) DNA-DNA > DNA-RNA > RNA-RNA. B) DNA-DNA > RNA-RNA > DNA-RNA. C) RNA-DNA > RNA-RNA > DNA-DNA. D) RNA-RNA > DNA-DNA > DNA-RNA. E) RNA-RNA > DNA-RNA > DNA-DNA.
E
In comparison with DNA-DNA double helices, the stability of DNA-RNA and RNA-RNA helices is: A) DNA-DNA > DNA-RNA > RNA-RNA. B) DNA-DNA > RNA-RNA > DNA-RNA. C) RNA-DNA > RNA-RNA > DNA-DNA. D) RNA-RNA > DNA-DNA > DNA-RNA. E) RNA-RNA > DNA-RNA > DNA-DNA.
E
In living cells, nucleotides and their derivatives can serve as: A) carriers of metabolic energy. B) enzyme cofactors. C) intracellular signals. D) precursors for nucleic acid synthesis. E) All of the answers are correct.
E
In living cells, nucleotides and their derivatives can serve as: A) carriers of metabolic energy. B) enzyme cofactors. C) intracellular signals. D) precursors for nucleic acid synthesis. E) all of the above.
E
In the Watson-Crick model of DNA structure (now called B-form DNA): A) a purine in one strand always hydrogen bonds with a purine in the other strand. B) A-T pairs share three hydrogen bonds. C) G-C pairs share two hydrogen bonds. D) the 5' ends of both strands are at one end of the helix. E) the bases occupy the interior of the helix.
E
In the Watson-Crick model of DNA structure: A) both strands run in the same direction, 3' → 5'; they are parallel. B) phosphate groups project toward the middle of the helix, where they are protected from interaction with water. C) T can form three hydrogen bonds with either G or C in the opposite strand. D) the distance between the sugar backbone of the two strands is just large enough to accommodate either two purines or two pyrimidines. E) the distance between two adjacent bases in one strand is about 3.4 Å.
E
In the Watson-Crick model of DNA structure: A) both strands run in the same direction, 3' → 5'; they are parallel. B) phosphate groups project toward the middle of the helix, where they are protected from interaction with water. C) T can form three hydrogen bonds with either G or C in the opposite strand. D) the distance between the sugar backbone of the two strands is just large enough to accommodate either two purines or two pyrimidines. E) the distance between two adjacent bases in one strand is about 3.4 Å.
E
In the laboratory, several factors are known to cause alteration of the chemical structure of DNA. The factor(s) likely to be important in a living cell is (are): A) heat. B) low pH. C) oxygen. D) UV light. E) both C and D.
E
In the laboratory, several factors are known to cause alteration of the chemical structure of DNA. The factor(s) likely to be important in a living cell is/are: A) heat. B) low pH. C) oxygen. D) UV light. E) both oxygen and UV light.
E
Membrane proteins: A) are sometimes covalently attached to lipid moieties. B) are sometimes covalently attached to carbohydrate moieties. C) are composed of the same 20 amino acids found in soluble proteins. D) diffuse laterally in the membrane unless they are anchored E) have all of the properties listed above.
E
Overproduction of which types of signaling lipids causes asthmatic attacks? A) prostaglandins B) thromboxanes C) arachidonates D) lipoxins E) leukotrienes
E
Purines have ____ ring(s), (each) containing _____ nitrogen(s), whereas pyrimidines have _____ ring(s), (each) containing _____ nitrogens. A) 1; 1; 1; 1 B) 1; 2; 1; 2 C) 2; 1; 1; 2 D) 2; 2; 1; 1 E) 2; 2; 1; 2
E
Purines have ____ ring(s), (each) containing _____ nitrogen(s), whereas pyrimidines have _____ ring(s), (each) containing _____ nitrogens. A) 1; 1; 1; 1 B) 1; 2; 1; 2 C) 2; 1; 1; 2 D) 2; 2; 1; 1 E) 2; 2; 1; 2
E
The "energy carrier" ATP is an example of a(n): A) deoxyribonucleoside triphosphate. B) dinucleotide. C) peptide. D) ribonucleotide. E) ribonucleoside triphosphate.
E
The "energy carrier" ATP is an example of a(n): A) deoxyribonucleoside triphosphate B) di-nucleotide C) peptide D) ribonucleotide E) ribonucleoside triphosphate
E
The compound that consists of ribose linked by an N-glycosidic bond to N-9 of adenine is: A) a deoxyribonucleoside. B) a purine nucleotide. C) a pyrimidine nucleotide. D) adenosine monophosphate. E) adenosine.
E
The compound that consists of ribose linked by an N-glycosidic bond to N-9 of adenine is: A) a deoxyribonucleoside. B) a purine nucleotide. C) a pyrimidine nucleotide. D) adenosine monophosphate. E) adenosine
E
The phosphodiester bonds that link adjacent nucleotides in both RNA and DNA: A) always link A with T and G with C. B) are susceptible to alkaline hydrolysis. C) are uncharged at neutral pH. D) form between the planar rings of adjacent bases. E) join the 3' hydroxyl of one nucleotide to the 5' hydroxyl of the next.
E
The three-carbon monosaccharide _____ is a(n) _____. A) dihydroxyacetone; enantiomer B) fructose; triose C) ribose; hemiacetal D) galactose; ketose E) glyceraldehyde; aldose
E
When a tissue sample is homogenized in a extractant composed of chloroform, methanol, and water, followed by addition of more water to separate the liquid phases, which molecules will remain in the methanol/water phase? A) lipids B) proteins C) sugars D) both lipids and proteins E) both proteins and sugars
E
Which compound is NOT a glycerophospholipid? A) phosphatidylcholine B) phosphatidylethanolamine C) phosphatidylserine D) cardiolipin E) ceramide
E
Which compound is NOT a type of membrane lipid? A) sphingolipid B) glycerophospholipid C) sulfolipid D) sterol E) triacylglycerolipid
E
Which lipid compound is NOT at least partially made from the condensation of isoprene units? A) sterols B) limonene C) beta-carotene D) vitamin E E) phosphatidylinositol
E
Which molecules or substances contain, or are derived from, fatty acids? A) beeswax B) prostaglandins C) sphingolipids D) triacylglycerols E) All of these contain or are derived from fatty acids.
E
Which of the following are characteristic of cellulose?A) highly extended fibers B) (14) glycosidic bonds C) extensive hydrogen bonding between individual molecules D) unbranched polymer E) all of the above
E
Which of the following disaccharides has both anomeric carbons involved in the glycosidic bond? A) lactose B) maltose C) amylose D) chitin E) sucrose
E
Which of the following is a disaccharide? A) amylose B) saccharin C) aspartame D) amylopectin E) none of the above
E
Which of the following is an example of a heteropolysaccharide? A) cellulose B) chitin C) starch D) glycogen E) hyaluronic acid
E
Which of the following is the most abundant disaccharide? A) lactose B) cellulose C) α-amylose D) maltose E) sucrose
E
Which of the following molecules or substances contain, or are derived from, fatty acids? A) Beeswax B) Prostaglandins C) Sphingolipids D) Triacylglycerols E) All of the above contain or are derived from fatty acids.
E
Which transporter will move lipids from the outer leaflet to the cytosolic leaflet of a plasma membrane? A) a flippase B) a floppase C) a scramblase D) both a flippase and a floppase E) both a flippase and a scramblase
E) both a flippase and a scramblase
Which of the following would have the HIGHEST melting temperature? A) 20-mer double-stranded DNA-DNA duplex B) 20-mer double-stranded RNA-RNA duplex C) 40-mer double-stranded DNA-DNA duplex D) 40-mer double-stranded DNA-RNA duplex E) 40-mer double-stranded RNA-RNA duplex
E
Which phospholipid head group is positively charged at pH 7? A) serine B) ethanolamine C) choline D) both serine and ethanolamine E) both ethanolamine and choline
E
As ATP begins to build up in a cell, metabolism slows down. How does this happen? (A) Excess ATP causes many of the enzymes involved in metabolism to denature. (B) None of the listed responses is correct. (C) ATP binds to the active sites of many of the enzymes involved in metabolism, causing them to stop functioning. (D) ATP acts as an activator, increasing the rate of its production. (E) ATP acts as an allosteric inhibitor to many of the enzymes involved in metabolism, thus slowing their function.
E REASON: ATP binds to several catabolic enzymes allosterically, lowering their affinity for substrate and thus inhibiting their activity. ADP, however, functions as an activator of the same enzymes.
Molecules A and B contain 110 kcal/mol of free energy, and molecules B and C contain 150 kcal/mol of energy. A and B are converted to C and D. What can be concluded? (A) The conversion of A and B to C and D is exergonic; the products are less organized than the reactants. (B) The conversion of A and B to C and D is spontaneous. (C) The entropy in the products, C and D, is higher than in the reactants, A and B. (D) A and B will be converted to C and D with a net release of energy. (E) The reaction that proceeds to convert A and B to C and D is endergonic; the products are more organized than the reactants.
E REASON: C and D contain more energy than do A and B; therefore they are more organized and their construction required an input of energy. Also, because the products contain more energy, they are more organized than the reactants. The difference between the energies of the reactants and products is a positive number, therefore, the process is endergonic and the products are more organized. Thus, the products have lower entropy than the reactants.
Succinylcholine is structurally almost identical to acetylcholine. If succinylcholine is added to a mixture that contains acetylcholine and the enzyme that hydrolyzes acetylcholine (but not succinylcholine), the rate of acetylcholine hydrolysis is decreased. Subsequent addition of more acetylcholine restores the original rate of acetylcholine hydrolysis. Which of the following correctly explains this observation? (A) Succinylcholine must be a noncompetitive inhibitor. (B) The active site must have the wrong configuration to permit succinylcholine binding. (C) The presence of succinylcholine changes the conditions in the solution, resulting in a denaturation of the enzyme. (D) Succinylcholine must be an allosteric regulator for this enzyme. (E) Succinylcholine must be a competitive inhibitor with acetylcholine.
E REASON: Competitive inhibition occurs when a molecule mimics the substrate by competing with it at the active site.
Which of the following statements correctly describes cofactors and coenzymes? (A) Cofactors that are metal ions activate enzymes, but coenzymes deactivate them. (B) Both are nonprotein enzyme helpers; but most coenzymes are metal ions, and most cofactors are organic molecules. (C) Neither cofactors nor coenzymes assist enzyme function. (D) Both cofactors and coenzymes act as allosteric inhibitors to various enzymes. (E) Both are nonprotein enzyme helpers; but most cofactors are metal ions, and coenzymes are organic molecules that are a specific type of cofactor.
E REASON: Many enzymes require nonprotein helpers for catalytic activity. These adjuncts, called cofactors, may be bound tightly to the enzyme as permanent residents, or they may bind loosely and reversibly along with the substrate. The cofactors of some enzymes, such as the metal atoms zinc, iron, and copper in ionic form, are inorganic. If the cofactor is an organic molecule, it is referred to more specifically as a coenzyme. Most vitamins are important in nutrition because they act as coenzymes or raw materials from which coenzymes are made.
From the equation ΔG = ΔH - TΔS it is clear that __________. (A) a decrease in the system's total energy will increase the probability of spontaneous change (B) increasing the entropy of a system will increase the probability of spontaneous change (C) increasing the temperature of a system will increase the probability of spontaneous change (D) a decrease in the system's total energy will increase the probability of spontaneous change, and increasing the entropy of a system will increase the probability of spontaneous change (E) a decrease in the system's total energy will increase the probability of spontaneous change, increasing the entropy of a system will increase the probability of spontaneous change, and increasing the temperature of a system will increase the probability of spontaneous change
E REASON: The best answer that includes all of the correct responses.
Which of these reactions requires a net input of energy from its surroundings? (A) ATP --> ADP + P (B) catabolic (C) hydrolysis (D) exergonic (E) endergonic
E REASON: The products of endergonic reactions have more potential energy than the reactants.
Which of the following is an example of a heteropolysaccharide? A) cellulose B) chitin C) starch D) glycogen E) hyaluronic acid
E - Hyaluronic acid
Myoglobin's primary physiological role is to facilitate oxygen ________. A) storage B) metabolism C) binding D) reduction E) diffusion
E - Mgb = Diffusion
Which of the following is a disaccharide? A) amylose B) saccharin C) aspartame D) amylopectin E) none of the above
E - None of the above Disaccharides include lactose and sucrose
Which of the following is the most abundant disaccharide? A) lactose B) cellulose C) α-amylose D) maltose E) sucrose
E - Sucrose
The oxygen binding by hemocyanins is mediated by A) an iron ion B) a pair of iron ions C) a heme group D) a copper atom E) a pair of copper atoms
E - pair of coper atoms needed for hemocyanin
Membrane proteins: A) are sometimes covalently attached to lipid moieties. B) are sometimes covalently attached to carbohydrate moieties. C) are composed of the same 20 amino acids found in soluble proteins. D) diffuse laterally in the membrane unless they are anchored E) All of the answers are correct.
E) All of the answers are correct.
Which molecules or substances contain, or are derived from, fatty acids? A) beeswax B) prostaglandins C) sphingolipids D) triacylglycerols E) All of these contain or are derived from fatty acids.
E) All of these contain or are derived from fatty acids.
58. N-linked oligosaccharides can be covalently linked to proteins at which amino acid? A) Gly B) Ser C) Glu D) Tyr E) Asn
E) Asn
37. Uronic acids A) are aldoses where the aldehyde is oxidized to a carboxylic acid. B) are aldoses where the 1° alcohol is oxidized to a carboxylic acid. C) can be found in the pyranose or furanose forms. D) A and C are both correct. E) B and C are both correct.
E) B and C are both correct.
In humans, the fatty acid composition of membrane lipids in skin cells is different from the fatty acid composition of membrane lipids in the internal organs because the internal organs function at a slightly higher temperature. Which difference in fatty acid composition is MOST likely to be observed? A) Skin cells show lower levels of 18:0 relative to 18:1 AND higher levels of 16:0 relative to 18:0. B) Skin cells show higher levels of 20:0 relative to 18:0 AND higher levels of 18:2 relative to 18:0. C) Skin cells show lower levels of 20:0 relative to 18:0 AND lower levels of 18:0 relative to 18:2. D) Skin cells show higher levels of 18:2 relative to 18:0 AND lower levels of 16:0 relative to 18:0. E) Both answers A and C are true.
E) Both answers A and C are true. (Skin cells show lower levels of 18:0 relative to 18:1 AND higher levels of 16:0 relative to 18:0. Skin cells show lower levels of 20:0 relative to 18:0 AND lower levels of 18:0 relative to 18:2.)
Which of the following statements regarding plasmid cloning vectors is correct? A) Circular plasmids do not require an origin of replication to be propagated in E. coli. B) Foreign DNA fragments up to 45,000 base pairs can be cloned in a typical plasmid. C) Plasmids do not need to contain genes that confer resistance to antibiotics. D) Plasmid vectors must carry promoters for inserted gene fragments. E) The copy number of plasmids may vary from a few to several hundred.
E) The copy number of plasmids may vary from a few to several hundred.
Which statement regarding plasmid-cloning vectors is CORRECT? A) Circular plasmids do not require an origin of replication to be propagated in E. coli. B) Foreign DNA fragments up to 45,000 base pairs can be cloned in a typical plasmid. C) Plasmids do not need to contain genes that confer resistance to antibiotics. D) Plasmid vectors must carry promoters for inserted gene fragments. E) The copy number of plasmids may vary from a few to several hundred.
E) The copy number of plasmids may vary from a few to several hundred.
What kind of bond can link a prenyl anchor to a polypeptide? A) an ester bond to an internal serine B) an amide bond to a glycine C) a thioester to a cysteine D) an ester bond to the C-terminus E) a thioether bond to a cysteine side chain
E) a thioether bond to a cysteine side chain
Which transporter will move lipids from the cytosolic leaflet to the outer leaflet of a plasma membrane? A) a flippase B) a floppase C) a scramblase D) both a flippase and a floppase E) both a floppase and a scramblase
E) both a floppase and a scramblase
What kind of bond can link a palmitoyl anchor to a polypeptide? A) an ester bond to an internal serine B) an amide bond to a glycine C) a thioester to a cysteine D) an ester bond to the C-terminus. E) both an ester bond to an internal serine and a thioester to a cysteine
E) both an ester bond to an internal serine and a thioester to a cysteine
Humans make which omega-3 polyunsaturated fatty acid from alpha-linolenic acid (ALA)? A) eicosapentaenoic acid (EPA) B) arachidonic acid (ARA) C) docosahexaenoic acid (DHA) D) both eicosapentaenoic acid (EPA) and arachidonic acid (ARA) E) both eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA)
E) both eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA)
Which phospholipid head group is positively charged at pH 7? A) serine B) ethanolamine C) choline D) both serine and ethanolamine E) both ethanolamine and choline
E) both ethanolamine and choline
When a tissue sample is homogenized in a extractant composed of chloroform, methanol, and water, followed by addition of more water to separate the liquid phases, which molecules will remain in the methanol/water phase? A) lipids B) proteins C) sugars D) both lipids and proteins E) both proteins and sugars
E) both proteins and sugars
Which process does NOT require a protein facilitator? A) simple diffusion B) ionophore-mediated diffusion C) a primary active uniport D) a passive antiporter E) both simple diffusion and ionophore-mediated diffusion
E) both simple diffusion and ionophore-mediated diffusion
Choline-containing lipids are enriched in the outer leaflet of erythrocyte plasma membranes. This includes: A) cardiolipin. B) phosphatidylinositol. C) sphingomyelin. D) phosphatidylcholine. E) both sphingomyelin and phosphatidylcholine.
E) both sphingomyelin and phosphatidylcholine
Identify the molecule(s) derived from sterols. A) arachidonic acid B) gangliosides C) phosphatidylglycerol D) prostaglandins E) cortisol
E) cortisol
56. Glycoproteins A) are only found in bacteria. B) are extremely homogeneous. C) are typically less than 1% carbohydrate by weight. D) are assembled under strict genetic control. E) exhibit microheterogeneity.
E) exhibit microheterogeneity
Which step is NOT involved in neurotransmitter release at a synapse? A) creation of a fusion pore B) hemifusion induced by zipping and lateral tension on the bilayers C) v-SNARE binding to t-SNARE D) pore widening and release of neurotransmitter E) flippase-mediated movement of phosphatidylserine from the inner to the outer leaflet
E) flippase-mediated movement of phosphatidylserine from the inner to the outer leaflet
26. Alcohols react with aldehydes to form A) hemiketals. B) lactones. C) lactams. D) glycosides. E) hemiacetals.
E) hemiacetals.
55. Which of the following is an example of a heteropolysaccharide? A) cellulose B) chitin C) starch D) glycogen E) hyaluronic acid
E) hyaluronic acid
Which way is NOT a means of inserting DNA into a cell? A) transformation B) transfection C) transduction D) electroporation E) ligation
E) ligation
44. Which of the following is a disaccharide? A) amylose B) saccharin C) aspartame D) amylopectin E) none of the above
E) none of the above
Which lipid compound is NOT at least partially made from the condensation of isoprene units? A) sterols B) limonene C) beta-carotene D) vitamin E E) phosphatidylinositol
E) phosphatidylinositol
A hydropathy plot is used to: A) determine the water-solubility of a protein. B) deduce the quaternary structure of a membrane protein. C) determine the water content of a native protein. D) extrapolate for the true molecular weight of a membrane protein. E) predict whether a given protein sequence contains membrane-spanning segments.
E) predict whether a given protein sequence contains membrane-spanning segments.
Bacterial cells change the fluidity of their lipid membranes to adapt to growth at lower temperatures by increasing the synthesis of: A) cholesterol. B) long-chain fatty acids and increasing the saturation of their membrane lipids. C) both long- and short-chain fatty acids. D) long-chain fatty acids and decreasing the saturation of their membrane lipids. E) short-chain fatty acids and decreasing the saturation of their membrane lipids.
E) short-chain fatty acids and decreasing the saturation of their membrane lipids.
The technique known as two hybrid analysis for detecting interacting gene products depend on: A) activation of DNA polymerase by the nearby binding of hybridizing protein complexes. B) direct binding of a Gal4p activation domain to a DNA sequence in the promoter region. C) having a promoter that responds directly to one of the two proteins whose interactions is being measured. D) hybridization of DNA segments corresponding to the two genes being examined. E) stimulation of transcription by interaction of two Gal4p domains via fused protein sequences.
E) stimulation of transcription by interaction of two Gal4p domains via fused protein sequences.
The technique known as two hybrid analysis for detecting interacting gene products depend on: A) activation of DNA polymerase by the nearby binding of hybridizing protein complexes. B) direct binding of a Gal4p activation domain to a DNA sequence in the promoter region. C) having a promoter that responds directly to one of the two proteins whose interactions is being measured. D) hybridization of DNA segments corresponding to the two genes being examined. E) stimulation of trasncription by interaction of two Gal4p domains via fused protein sequences
E) stimulation of trasncription by interaction of two Gal4p domains via fused protein sequences
43. Which of the following is the most abundant disaccharide? A) lactose B) cellulose C) α-amylose D) maltose E) sucrose
E) sucrose
Common features found in a cloning plasmid used for protein do NOT include: A) a polylinker. B) an origin of replication. C) an antibiotic resistance marker(s). D) a ribosome binding site. E) telomeric ends.
E) telomeric ends.
In the laboratory, recombinant plasmids are commonly introduced into bacterial cells by: A) electrophoresis—a gentle low-voltage gradient draws the DNA into the cell. B) infection with a bacteriophage that carries the plasmid. C) microinjection. D) mixing plasmids with an extract of broken cells. E) transformation—heat shock of the cells incubated with plasmid DNA in the presence of CaCl2.
E) transformation—heat shock of the cells incubated with plasmid DNA in the presence of CaCl2.
An electrogenic Na+ transporter: A) catalyzes facilitated diffusion of Na+ from a region of high Na+ concentration to one of lower Na+ concentration. B) must catalyze an electron transfer (oxidation-reduction) reaction simultaneously with Na+ transport. C) must transport both Na+ and a counterion (Cl-, for example). D) transports Na+ against its concentration gradient. E) transports Na+ without concurrent transport of any other charged species.
E) transports Na+ without concurrent transport of any other charged species.
ABC transporters are NOT known to facilitate moving: A) cancer drugs out of cancer cells. B) antibiotics out of bacteria. C) membrane lipids from the inner leaflet to the outer leaflet. D) chloride ions in the lung. E) vitamin E into lipocytes.
E) vitamin E into lipocytes.
N-linked oligosaccharides can be covalently linked to proteins at which amino acid? A) Asp B) Ser C) Ala D) Tyr E) Asn
E- Asn = Asparagine
Glycoproteins A) are only found in bacteria. B) are extremely homogeneous. C) are typically less than 1% carbohydrate by weight. D) are assembled under strict genetic control. E) exhibit microheterogeneity.
E- Exhibit microheterogeneity- enzymatically generated
Uronic acids A) are aldoses where the aldehyde is oxidized to a carboxylic acid. B) are aldoses where the 1° alcohol is oxidized to a carboxylic acid. C) can be found in the pyranose or furanose forms. D) A and C are both correct. E) B and C are both correct.
E- are aldoses where the primary alcohol is oxidized to carboxylic acid & can be found in the pyranose, furanose or linear forms
What is an enantiomer of glucose? What is an epimer of glucose? What is a non-epimer diastereomer of glucose?
Enantiomers differ in configuration at all chiral centers, therefore, are non-superimposable images; ie. D-Glucose ad L-glucose Diastereomers differ in configuration at one or more, but not all, chiral centers; ie. D-mannose and D-galactose or D-glucose and D-altrose Epimers are a class of diastereomers that differ in their configuration at only one chiral center; ie. D-glucose and D-galactose or D-glucose and D-mannose All are optical isomers - rotate the plane of polarized light due to chiral centers - as opposed to cis/trans isomers
Polar molecules cannot easily pass through the cell membrane, but hydrophobic molecules can easily pass through the membrane. The two molecules shown in the diagram both have effects that include raising blood pressure. Comparing two molecules to the right, which statement is true?
Ephedrine can more easily pass through the cell membrane than epinephrine
When ΔG for a system is zero, the system is at ______________________.
Equilibrium
For the oligoribonucleotide pACGUAC: A) the nucleotide at the 3' end has a phosphate at its 3' hydroxyl. B) the nucleotide at the 3' end is a purine. C) the nucleotide at the 5' end has a 5' hydroxyl. D) the nucleotide at the 5' end has a phosphate on its 5' hydroxyl. E) the nucleotide at the 5' end is a pyrimidine.
For the oligoribonucleotide pACGUAC: D) the nucleotide at the 5' end has a phosphate on its 5' hydroxyl.
For the process of solute transport, the constant Kt is: A) analogous to Ka for ionization of a weak acid. B) analogous to Km for an enzyme-catalyzed reaction. C) analogous to Vmax for an enzyme reaction D) proportional to the number of molecules of glucose transporter per cell. E) the maximum rate of glucose transport.
For the process of solute transport, the constant Kt is: B) analogous to Km for an enzyme-catalyzed reaction.
From the abbreviated name of the compound Gal(beta1-->4)Glc, we know that: A) C-4 of glucose is joined to C-1 of galactose by a glycosidic bond. B) the compound is a D-enantiomer. C) the galactose residue is at the reducing end. D) the glucose is in its pyranose form. E) the glucose residue is the anomer.
From the abbreviated name of the compound Gal(beta1-->4)Glc, we know that: A) C-4 of glucose is joined to C-1 of galactose by a glycosidic bond.
Select the statement that best matches the following: Sarcomere Functional unit of the myofibril. Major component of the thick filament of the myofibril. Major component of the thin filament of the myofibril. Calcium binding protein. Chemical energy source for muscle contraction.
Functional unit of the myofibril.
What are the roles of proteins such as Grb2, SOS, Ras, and various protein kinases involved in coupling activated RTK to downstream cellular targets such as transcription factors in the nucleus?
GRB2 exists in complex with SH2 domain and SOS exchange factor, GRB2 binds to activate RTK -> SOS binds to inner membrane RAS -> starts phosphorylation cascade
How does the difference in Structure play a role in the function of Hemoglobin and the function of Myoglobin?
Hb has 2-Alpha and Beta subunits held together with electrostatic interactions. These multiple subunits give Hb Quaternary structure. Myoglobin is a monomer and does not have quaternary structure. Hb exhibits allosteric interactions and myoglobin does not bc it is a monomeric protein with a Single Heme O2 binding site. Hb exhibits cooperativity & Myo doesn't. Hb transports and readily gives up O2 to Respiring tissues from the lungs. Myoglobin facilitates O2 transport in actively respiring muscle.
Which of the following statements is FALSE with respect to hemoglobin's transition from the T state to the R state? BPG is not required to stabilize the R state. The Fe2+ ion is pulled into the plane of the heme prosthetic group when oxygen binds to hemoglobin in the T state. Helix F changes its secondary structure in response to oxygen binding. Contacts between side chains in the different subunits of hemoglobin change upon binding of oxygen to one subunit.
Helix F changes its secondary structure in response to oxygen binding. This statement is false. While the relative position of Helix F does change in response to oxygen binding, the secondary structure of the helix is unaltered.
Hemoglobin glycation is a process where _______ is _______ attached to hemoglobin. A) glycerol; covalently B) glucose; enzymatically C) glucose; non-enzymatically D) N-acetyl-galactosamine; enzymatically E) galactose; non-enzymatically
Hemoglobin glycation is a process where _______ is _______ attached to hemoglobin. C) glucose; non-enzymatically
Which of the statements below about hemoglobin and myoglobin's oxygen binding is INCORRECT: The p50 of hemoglobin is nearly 10 times higher than that of myoglobin. The Hill coefficient (n) increases with the degree of cooperativity of a reaction: A Hill coefficient of 1 (n = 1) indicates no cooperativity, a Hill coefficient < 1 (n < 1) indicates negative cooperativity and a Hill coefficient > 1 (n > 1) indicates positive cooperativity. The reason hemoglobin has a sigmoidal or S-shaped oxygen binding curve whereas myoglobin has a hyperbolic oxygen binding curve is because hemoglobin is a tetramer whereas myoglobin is a monomer. Myoglobin has a higher affinity for oxygen than hemoglobin. Hemoglobin has a Hill coefficient > 1 whereas myoglobin has a Hill coefficient < 1. In any binding system, a sigmoidal curve is diagnostic of a cooperative interaction between binding sites whereas a hyperbolic binding curve is an indication of a lack of cooperativity.
Hemoglobin has a Hill coefficient > 1 whereas myoglobin has a Hill coefficient < 1
Which of the following occurs in hemoglobin when blood pH is lowered? The proximal histidine becomes charged at lower pH, which weakens the binding of heme in its pocket. Histidine side chains at the subunit interface are charged at lower pH, forming salt bridges that stabilize the T state. The distal histidine becomes charged at lower pH, resulting in a lower affinity of the heme. Hemoglobin binds BPG with reduced affinity because histidine side chains in the central cavity of hemoglobin are charged at lower pH.
Histidine side chains at the subunit interface are charged at lower pH, forming salt bridges that stabilize the T state.
Describe briefly how noncovalent interactions contribute to the three-dimensional shapes of RNA molecules.
Hydrogen-bonding in regions of complementarity within an RNA chain can result in regions of double helix that are stabilized by base-stacking. Breaks in complementary regions can result in loops and bulges that together with the helical regions, can generate a precise three-dimensional structure.
What are some of the biochemical effects of the oligosaccharide portions of glycoproteins?
Hydrophilic carbohydrates can alter the polarity and solubility of the proteins. Steric and charge interactions may influence the conformation of regions of the polypeptide and protect it from proteolysis.
During muscle contraction, the ___ of myofibrils contract and the _____ move closer together due to the movement of myosin thick filaments along actin thin filaments.
I bands; z disks
Parallel lines on a Lineweaver-Burk plot indicate
I or II, III I - an increase in Km II - decrease in Km III - decrease in Vmax
Compounds that function as "mixed inhibitors"
I, II, III I - interfere with substrate binding to the enzyme II - bind to the enzyme reversibly III - can bind to the enzyme/substrate complex
Enzyme activity in cells is controlled by which of the following
I, II, III, IV I - covalent modifications II - modulation of expression levels III - feedback inhibition IV - allosteric effectors
Which group of amino acids would be most likely to be found in the core of a protein folded into a three-dimensional structure and soluble in water?
I, M,and V
In DNA sequencing by the Sanger (dideoxy) method: A) radioactive dideoxy ATP is included in each of four reaction mixtures before enzymatic synthesis of complementary strands. B) specific enzymes are used to cut the newly synthesized DNA into small pieces, which are then separated by electrophoresis. C) the dideoxynucleotides must be present at high levels to obtain long stretches of DNA sequence. D) the role of the dideoxy CTP is to occasionally terminate enzymatic synthesis of DNA where Gs occur in the template strands. E) the template DNA strand is radioactive.
In DNA sequencing by the Sanger (dideoxy) method: D) the role of the dideoxy CTP is to occasionally terminate enzymatic synthesis of DNA where Gs occur in the template strands.
In comparison with DNA-DNA double helices, the stability of DNA-RNA and RNA-RNA helices is: A) DNA-DNA > DNA-RNA > RNA-RNA. B) DNA-DNA > RNA-RNA > DNA-RNA. C) RNA-DNA > RNA-RNA > DNA-DNA. D) RNA-RNA > DNA-DNA > DNA-RNA. E) RNA-RNA > DNA-RNA > DNA-DNA.
In comparison with DNA-DNA double helices, the stability of DNA-RNA and RNA-RNA helices is: E) RNA-RNA > DNA-RNA > DNA-DNA.
In double-stranded DNA: A) only a right-handed helix is possible. B) sequences rich in A-T base pairs are denatured less readily than those rich in G-C pairs. C) the sequence of bases has no effect on the overall structure. D) the two strands are parallel. E) the two strands have complementary sequences.
In double-stranded DNA: E) the two strands have complementary sequences.
Which of the following statements is FALSE? As pH decreases, the O2 binding curve of hemoglobin shifts to the right, because a greater proportion of hemoglobin molecules exist in the T-state at a given pO2. Actively respiring tissues have a relatively low pH and low pO2, which favors the T-state of hemoglobin. In fetal hemoglobin the central cavity is lined with more histidines than in adult hemoglobin, which results in preferential stabilization of the R-state. Fetal hemoglobin has a weaker affinity for BPG than maternal hemoglobin, resulting in a shift of the oxygen-binding curve to the left.
In fetal hemoglobin the central cavity is lined with more histidines than in adult hemoglobin, which results in preferential stabilization of the R-state This statement is false. Fetal hemoglobin has fewer histidine residues positioned in the central cavity than adult hemoglobin and this results in preferential stabilization of the R-state
Fetal hemoglobin has a higher affinity for oxygen than maternal hemoglobin. Which of the following statements correctly outlines the mechanism behind this observation? In fetal hemoglobin, the residue Ser143 is mutated to His143, and so the protein binds BPG with lower affinity. In fetal hemoglobin, the residue His143 is mutated to Ser143, and so the protein binds BPG with lower affinity. In fetal hemoglobin, the residue Ser143 is mutated to His143, and so the protein binds BPG with greater affinity. In fetal hemoglobin, the residue His143 is mutated to Ser143, and so the protein binds BPG with greater affinity.
In fetal hemoglobin, the residue His143 is mutated to Ser143, and so the protein binds BPG with lower affinity. The mutation of His143 to Ser143 reduces the number of positively charged groups available to form salt bridges with BPG. This reduces the affinity of hemoglobin for BPG and thus the T (low-affinity) state of hemoglobin is less stable.
Describe qualitatively how the tm for a double-stranded DNA depends upon its nucleotide composition.
In general, the higher the proportion of G and C, the higher the melting temperature, tm. More thermal energy is required to break the three hydrogen bonds holding G---C pairs than to break the two hydrogen bonds holding A=T pairs.
Mouse DNA hybridizes more extensively with human DNA than with yeast DNA. Explain by describing the factor or factors that determine extent of hybridization.
In general, the more similar the sequences in two DNA molecules are, the more readily they will hybridize. Because the evolutionary distance between mouse and yeast is greater than that between mouse and human, mouse and human DNA sequences are more similar than those of mouse and yeast.
In glycoproteins, the carbohydrate moiety is always attached through the amino acid residues: A) asparagine, serine, or threonine. B) aspartate or glutamate. C) glutamine or arginine. D) glycine, alanine, or aspartate. E) tryptophan, aspartate, or cysteine.
In glycoproteins, the carbohydrate moiety is always attached through the amino acid residues: A) asparagine, serine, or threonine.
In living cells, nucleotides and their derivatives can serve as: A) carriers of metabolic energy. B) enzyme cofactors. C) intracellular signals. D) precursors for nucleic acid synthesis. E) all of the above.
In living cells, nucleotides and their derivatives can serve as: E) all of the above.
In nucleotides and nucleic acids, syn and anti conformations relate to: A) base stereoisomers. B) rotation around the phosphodiester bond. C) rotation around the sugar-base bond. D) sugar pucker. E) sugar stereoisomers.
In nucleotides and nucleic acids, syn and anti conformations relate to: C) rotation around the sugar-base bond.
In one catalytic cycle, the Na+/K+ ATPase transporter transports: A) 2 Na+ out, 3 K+ in, and converts 1 ATP to ADP + Pi. B) 3 Na+ out, 2 K+ in, and converts 1 ATP to ADP + Pi. C) 3 Na+ in, 2 K+ out, and converts 1 ATP to ADP + Pi. D) 1 Na+ out, 1 K+ in, and converts 1 ATP to ADP + Pi. E) 2 Na+ out, 3 K+ in, and converts 1 ADP + Pi to ATP.
In one catalytic cycle, the Na+/K+ ATPase transporter transports: B) 3 Na+ out, 2 K+ in, and converts 1 ATP to ADP + Pi.
One critical function of chondroitin sulfate is to act as a lubricant in skeletal joints by creating a gel-like medium that is resilient to friction and shock. This function seems to be related to a distinctive property of chondroitin sulfate: the volume occupied by the molecule is much greater in solution than in the dehydrated solid. Why is the volume so much larger in solution?
In solution, the negative charges on chondroitin sulfate repel each other and force the molecule into an extended conformation. The polar molecule also attracts many water molecules (water of hydration), further increasing the molecular volume. In the dehydrated solid, each negative charge is counterbalanced by a counterion, such as Na+, and the molecule collapses into its condensed form.
In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share which one of the following properties? A) The distance between the two glycosidic (base-sugar) bonds is the same in both base pairs, within a few tenths of an angstrom. B) The molecular weights of the two base pairs are identical. C) The number of hydrogen bonds formed between the two bases of the base pair is the same. D) The plane of neither base pair is perpendicular to the axis of the helix. E) The proton-binding groups in both base pairs are in their charged or ionized form.
In the Watson-Crick model for the DNA double helix (B form) the A-T and G-C base pairs share which one of the following properties? A) The distance between the two glycosidic (base-sugar) bonds is the same in both base pairs, within a few tenths of an angstrom.
In the Watson-Crick model of DNA structure (now called B-form DNA): A) a purine in one strand always hydrogen bonds with a purine in the other strand. B) A-T pairs share three hydrogen bonds. C) G-C pairs share two hydrogen bonds. D) the 5' ends of both strands are at one end of the helix. E) the bases occupy the interior of the helix.
In the Watson-Crick model of DNA structure (now called B-form DNA): E) the bases occupy the interior of the helix.
In the Watson-Crick model of DNA structure: A) both strands run in the same direction, 3' 5'; they are parallel. B) phosphate groups project toward the middle of the helix, where they are protected from interaction with water. C) T can form three hydrogen bonds with either G or C in the opposite strand. D) the distance between the sugar backbone of the two strands is just large enough to accommodate either two purines or two pyrimidines. E) the distance between two adjacent bases in one strand is about 3.4 Å.
In the Watson-Crick model of DNA structure: E) the distance between two adjacent bases in one strand is about 3.4 Å.
In the Watson-Crick structure of DNA, the: A) absence of 2'-hydroxyl groups allows bases to lie perpendicular to the helical axis. B) adenine content of one strand must equal the thymine content of the same strand. C) nucleotides are arranged in the A-form. D) purine content (fraction of bases that are purines) must be the same in both strands. E) two strands are parallel.
In the Watson-Crick structure of DNA, the: A) absence of 2'-hydroxyl groups allows bases to lie perpendicular to the helical axis.
In the chemical synthesis of DNA: A) the dimethoxytrityl (DMT) group catalyzes formation of the phosphodiester bond. B) the direction of synthesis is 5' to 3'. C) the maximum length of oligonucleotide that can be synthesized is 8-10 nucleotides. D) the nucleotide initially attached to the silica gel support will become the 3' end of the finished product. E) the protecting cyanoethyl groups are removed after each step.
In the chemical synthesis of DNA: D) the nucleotide initially attached to the silica gel support will become the 3' end of the finished product.
Plasma membrane channels are classified as which of the following: Peripheral membrane proteins because they are not amphipathic Integral membrane proteins because they are not amphipathic Integral membrane proteins because they contain hydrophobic regions that can span the phospholipid bilayer Peripheral membrane proteins because they contain hydrophobic regions that can span the phospholipid bilayer
Integral membrane proteins because they contain hydrophobic regions that can span the phospholipid bilayer
Integrins are: A) membrane proteins that are involved in ion transport. B) membrane proteins that are involved in sugar transport. C) membrane proteins that mediate cell adhesion. D) proteins of the extracellular matrix that bind to cell surface proteins. E) proteins that are found at the membrane-cytoplasm interface.
Integrins are: C) membrane proteins that mediate cell adhesion.
How does the sliding filament model explain the shortening of the sarcomere during muscle contraction? Interdigitating thin filaments slide past each other. Interdigitating thick and thin filaments compress by forming coiled coils. Interdigitating thick filaments slide past each other. Interdigitating thick and thin filaments slide past each other.
Interdigitating thick and thin filaments slide past each other. This accounts for the shortening of the sarcomere during muscle contraction
When drawing a Hworth perspective formula from a Fischer projection, which statement is true regarding anomers?
Is is alpha is the hydroxyl group on the anomeric carbon is on the opposite side of the ring as the C6.
During vigorous exercise, the pH of blood passing through skeletal muscle decreases. How does this decrease affect the behaviour of hemoglobin? It decreases O2 binding to hemoglobin, because it decreases the binding of BPG. It increases O2 binding to hemoglobin, because it increases the binding of BPG. It decreases O2 binding to hemoglobin, because it increases the binding of BPG. It increases O2 binding to hemoglobin, because it decreases the binding of BPG.
It decreases O2 binding to hemoglobin, because it increases the binding of BPG. As pH decreases, certain histidine side chains become positively charged and hemoglobin binds more BPG. This stabilizes the T state of the protein and decreases O2 binding (% saturation).
Which of the following is TRUE about the distal histidine of hemoglobin? It is not conserved in myoglobin. It forms a strong covalent bond with the Fe2+ atom coordinated by heme. It prevents helix F from moving in response to oxygen binding. It forms a hydrogen bond with bound oxygen. It covalently bonds heme into the hemoglobin subunit.
It forms a hydrogen bond with bound oxygen. The distal histidine (His E7) has no affect on helix F. It is the proximal histidine that forms the coordination bond with the iron in the heme.
Which statement is NOT correct concerning 2,3-bisphosphoglycerate (BPG)
It increases the affinity of hemoglobin for oxygen.
Reaction 1 has a delta G of -12.3 kJ/mol, and reaction 2 has a delta G of 23.4 kJ/mol. Which statement is true of these two reactions?
It is impossible to know which reaction occurs faster with this information.
RNA Hair pins
It occurs when two regions of the same strand, usually complementary in nucleotide sequence when read in opposite directions, base-pair to form a double helix that ends in an unpaired loop. The resulting structure is a key building block of many RNA secondary structures. As an important secondary structure of RNA, it can direct RNA folding, protect structural stability for messenger RNA (mRNA), provide recognition sites for RNA binding proteins, and serve as a substrate for enzymatic reactions.
In what way does an uncompetitive inhibitor bind to an enzyme?
It reversibly binds to the enzyme-substrate complex but does not bind to the free enzyme
What property of the waxy cuticles that cover plant leaves makes the cuticles impermeable to water?
Long, saturated acyl chains, nearly solid at air temperature, form a hydrophobic layer in which a polar compound such as H2O cannot dissolve or diffuse.
At pH 7, converting a glutamic acid to theta-carboxyglutamate will have what effect on the overall charge of the protein containing it?
It will become more negative
Protein X binds reversibly to ligand Y such that X + Y=XY, and the molar concentrations of X, Y and XY are known. Which of the following represents the dissociation constant (K) for this reaction? K = [X][Y]/[XY] K = [XY]/[X][Y] K = [X] + [Y]/[X + Y] K = [XY]/[Y] K could not be determined with the information provided
K = [X][Y]/[XY]
When the kcat / KM ratio is at its upper limit, it is referred to as
Kinetic perfection.
Determine the Km and Vmax from the following graph
Km = [33]; Vmax = 167/s
Reducing Sugars
Lactose, Starch, glucose, ribose, starch
Describe the monosaccharide units and their linkages in the common disaccharides and polysaccharides
Lactose: (b1 -> b4) glycosidic linkage between galactose and glucose Sucrose: (a1 ->b2) glycosidic linkage between glucose and fructose Starch: mix of a-amylose [(a1 ->a4) glucose units] and amylopectin [(a1 ->a6] branched linkage to a-amylose every ~30 residues] Glycogen: more branched amylopectin primary structure, every ~10 units Cellulose: (b1 ->b4) glucose links Chitin: (b1 ->b4) N-acetlyglucosamine links
Proteins that bind to specific carbohydrates are called ______. A) pectins B) oligonucleotides C) glycosaminoglycans D) lectins E) chitins
Lectin
Which of the following is NOT one of the rules that defines the symmetry model of allosterism? An allosteric protein is an oligomer of symmetrically related subunits. Each subunit can exist in two conformational states, R and T, which are in equilibrium. The ligand can bind to a subunit in either conformation. Only the conformational change alters the affinity for ligand. Ligand binding induces a conformational change in the subunit to which it binds.
Ligand binding induces a conformational change in the subunit to which it binds.
Why does lowering the ionic strength of a solution of double-stranded DNA permit the DNA to denature more readily (for example, to denature at a lower temperature than at a higher ionic strength)?
Lower ionic strength reduces the screening of the negative charges on the phosphate groups by positive ions in the medium. The result is stronger charge-charge repulsion between the phosphate, which favors strand separation.
Enzymes accelerate the rate of a chemical reaction by __________________ the activation energy of the reaction.
Lowering
Which of the following describes the Bohr effect?
Lowering the pH and increasing the concentration of HCO3- results in the release of O2 from oxyhemoglobin.
What is the difference between Allosteric enzyme and M-M enzyme kinetics?
M-M kinetics is represented by a Hyperbolic curve bc they undergo Increase in Rate of Reaction at the Increase of the Concentration of Substrate until it reaches Saturation where the Rate of reaction becomes Independent of the Concentration of Substrate, Allosteric Enzyme Kinetics is represented by a Sigmoidal curve bc they undergo a Rapid Increase in Rate if Reaction once the Concentration of Substrate Increases until it reaches the Maximum Rate of Reaction.
Select the statement that best matches the following: Myosin Functional unit of the myofibril. Major component of the thick filament of the myofibril. Major component of the thin filament of the myofibril. Calcium binding protein. Chemical energy source for muscle contraction.
Major component of the thick filament of the myofibril.
Select the statement that best matches the following: Actin Functional unit of the myofibril. Chemical energy source for muscle contraction. Major component of the thick filament of the myofibril. Major component of the thin filament of the myofibril. Calcium binding protein.
Major component of the thin filament of the myofibril.
Match the type of bond with the role below: ___ links base to pentose in nucleotide ___ joins adjacent nucleotides in one strand ___ joins complementary nucleotides in two strands ___ difference between a nucleoside and a nucleotide (a) phosphodiester (b) N-glycosidic (c) phosphate ester (d) hydrogen
Match the type of bond with the role below: b) N-glycosidic- links base to pentose in nucleotide a) phosphodiester- joins adjacent nucleotides in one strand d) hydrogen- joins complementary nucleotides in two strands c) phosphate ester- difference between a nucleoside and a nucleotide
Shown below are statements matching scientists with their accomplishments. Which of the statements below is INCORRECT: Entry field with correct answer Joseph Barcroft: In 1921 he anticipated the existence of BPG as a factor that decreased the oxygen affinity of hemoglobin. Christian Bohr: In 1904 he reported the release of protons upon oxygen binding by hemoglobin. Max Perutz: In 1945 hypothesized and in 1949 proved that sickle-cell anemia was the result of a mutant hemoglobin that had a less negative ionic charge than normal adult hemoglobin. This was the first evidence that a disease could result from an alteration in the molecular structure of a protein. Daniel Koshland: Proposed the sequential model of allosterism. Jacques Monod: Formulated the symmetry model of allosterism along with Jeffries Wyman and Jean-Pierre Changeux.
Max Perutz: In 1945 hypothesized and in 1949 proved that sickle-cell anemia was the result of a mutant hemoglobin that had a less negative ionic charge than normal adult hemoglobin. This was the first evidence that a disease could result from an alteration in the molecular structure of a protein. Linus Pauling did this
Membrane proteins: A) are sometimes covalently attached to lipid moieties. B) are sometimes covalently attached to carbohydrate moieties. C) are composed of the same 20 amino acids found in soluble proteins. D) diffuse laterally in the membrane unless they are anchored E) have all of the properties listed above.
Membrane proteins: E) have all of the properties listed above.
What distinguishes monoclonal antibodies from the antibodies produced in a typical immune response. Monoclonal antibodies have somewhat lower affinity for their antigens. Monoclonal antibodies come from a clonal line of immortalized lymphocytes, and so they form an identical population. Monoclonal antibodies come from memory B cells. Monoclonal antibodies have much higher affinity for their antigens.
Monoclonal antibodies come from a clonal line of immortalized lymphocytes, and so they form an identical population.
Explain why all mono- and disaccharides are soluble in water.
Monosaccharides and disaccharides are soluble in water because these compounds have many hydroxyl groups, each of which can hydrogen bond with water. (See chapter 4.)
A plant breeder has developed a new frost-resistant variety of tomato that contains higher levels of unsaturated fatty acids in membrane lipids than those found in standard tomato varieties. However, when temperatures climb above 95 °F, this frost-resistant variety dies, whereas the standard variety continues to grow. Provide a likely explanation of the biochemical basis of increased tolerance to cold and increased susceptibility to heat of this new tomato variety.
More unsaturated fatty acids will cause an increase in membrane fluidity because unsaturated fatty acids contain "kinks" and cannot pack as tightly as saturated fatty acids. At cold temperatures, the fluidity increase from the extra unsaturated fatty acids counterbalances the tendency of lipids to solidify at low temperature. At high temperatures, the fluidizing effects of the extra unsaturated fatty acids add to the fluidizing effect of higher temperature, and the membrane of the new plant loses its integrity.
Which statement is TRUE of lipids?
Most are simply polymers of isoprene.
Which of the following conclusions about the human genome is false?
Most of the proteins found in humans are unique to vertebrates
Which of the following conclusions about the human genome is false? - About 80% of the genome is transcribed to RNA. - Most of the proteins found in humans are unique to vertebrates. - Nearly half of the human genome consists of repetitive DNA sequences. - The genomes of any two people are likely to be 99.9% identical.
Most of the proteins found in humans are unique to vertebrates.
Movement of water across membranes is facilitated by proteins called: A) annexins. B) aquaporins. C) hydropermeases. D) selectins. E) transportins.
Movement of water across membranes is facilitated by proteins called: B) aquaporins.
O- only aka universal donor has no antigens
Mr. Jones's injuries are just as severe. He has lost a liter and half of blood on the scene. He also requires blood. His blood type screening revealed he is O- Which blood types he is able to accept
No, even if the antibody would be present it would not have Rh antigen
Mrs. Chase if A-, Mr. Chase is B+, and their first child is B+. If Mrs. Chase's second child was Rh negative, would it be at risk for (HDN)? Why?
Because anti-B is too large to travel through to child
Mrs. Chase if A-, Mr. Chase is B+, and their first child is B+. Why didn't Mrs. Chase's Anti-B antibodies attack the first child's B antigens?
She wasn't introduced to the Rh factor (can only be introduced via trauma like a placenta tear)
Mrs. Chase if A-, Mr. Chase is B+, and their first child is B+. Why wasn't her first child affected? Can you think of a situation where the first child would be affected?
No, no antigens to attack B+, B-, O+, O-
Ms. Brown is going to have total hip surgery in a week. You are called in to do a blood type examination. Her blood type was revealed to be type B+. The blood center calls you and tells you that they only have Rh-negative blood on hand. Would giving this person Rh-negative blood be a problem? Why? Which blood types can she receive?
Which of the following statements about the structure of myoglobin is FALSE? A heme prosthetic group is tightly bound to myoglobin via a coordination bond. Myoglobin contains all three types of secondary structure. Myoglobin contains a heme prosthetic group that is slotted into a hydrophobic pocket between -helix E and -helix F. The tertiary structure of myogobin is a compact, roughly spherical shape
Myoglobin contains all three types of secondary structure. Myoglobin contains only two types of secondary structure, -helices and loops. It contains no β-sheet
Which of the following statements most accurately explains why hemoglobin is able to deliver oxygen to myoglobin in the tissues? The iron in the heme group of myoglobin is Fe3+, which has a higher affinity for oxygen. Myoglobin has a hyperbolic oxygen binding curve, whereas hemoglobin has a sigmoidal oxygen binding curve. The presence of BPG in the red blood cells shifts the equilibrium towards the R state of hemoglobin. The pH of tissue/muscle is always higher than that of blood, which aids hemoglobin in giving up its oxygen.
Myoglobin has a hyperbolic oxygen binding curve, whereas hemoglobin has a sigmoidal oxygen binding curve. The sigmoidal binding curve illustrates hemoglobin's ability to adopt a low affinity state. This enables it to transfer oxygen to myoglobin which always binds oxygen with high affinit
Describe the process by which "old" serum glycoproteins are removed from the mammalian circulatory system.
Newly synthesized serum glycoproteins bear oligosaccharide chains that end in sialic acid. With time, the sialic acid is removed. Glycoproteins that lack the terminal sialic acid are recognized by asialoglycoprotein receptors in the liver, internalized, and destroyed.
how are complex RNA structures stabilized?
Non-Watson-Crick Base-Pair Interactions
What is the major difference between gated and non-gated ion channels? Give an example of two different gating signals.
Non-gated channels are always open; gated channels open in response to a signal. Two possible signals are the presence of a ligand or a change in membrane poential.
Molecular Mechanisms of Oxidative and Chemical Mutagenesis
Oxidative damage • hydroxylation of guanine • mitochondrial DNA is most susceptible • Chemical Deamination • Chemical alkylation • methylation of guanine
Which of the following statements is FALSE regarding the interaction of oxygen with myoglobin? Oxygen is a homoallosteric effector of myoglobin. Oxygen binds at the 6th coordination position of the Fe2+ ion in the heme. Oxygen is a ligand of myoglobin. Oxygen binds reversibly and with high affinity to the heme prosthetic group.
Oxygen is a homoallosteric effector of myoglobin. This statement is false. Myoglobin is not an allosteric protein
Why is a hydropathy plot useful, and what are its limitations?
Peaks on a hydropathy plot indicate areas of high hydrophobicity, which may signal the presence of transmembrane helices or other integral membrane protein segments. However, because water soluble proteins have hydrophobic interiors, it is possible to get hydrophobic areas for proteins that are not membrane associated.
Peripheral membrane proteins: A) are generally noncovalently bound to membrane lipids. B) are usually denatured when released from membranes. C) can be released from membranes only by treatment with detergent(s). D) may have functional units on both sides of the membrane. E) penetrate deeply into the lipid bilayer.
Peripheral membrane proteins: A) are generally noncovalently bound to membrane lipids.
Give an example of an enzyme showing cooperative Kinetics.
Phosphofructokinase-I is a tetrameric allosteric enzyme. The substrate, Fructose 6-Phosphate binds to the enzyme in a Positively cooperative manner. PFK-I shows cooperative kinetic bc it is sensitive to the energy level of the cell so it is most active at low levels of ATP and least active at High levels of ATP. Fructose 2, 6-biphosphate is the most potent allosteric activator of PFK-I and activates the enzyme by favoring the T (inactive) to R (active) transition which enhances it affinity for substance fructose 6-phosphate and reduces its affinity for ATP.
Which statement is NOT true?
Phospholipase B1 hydrolyzes the fatty acid from the 2-position on the glycerol backbone.
Draw the structure of a biological membrane as proposed by the fluid mosaic model. Indicate the positions and orientations of phospholipids, cholesterol, integral and peripheral membrane proteins, and the carbohydrate moieties of glycoproteins and glycolipids.
Phospholipids and sterols are found in both faces of the lipid bilayer. Integral membrane proteins penetrate or span the lipid bilayer, but peripheral membrane proteins associate at the membrane surface with lipid head groups or integral membrane proteins. The carbohydrate moieties of glycolipids and glycoproteins are invariably on the outside face of the plasma membrane.
Which of the following best describes the composition of the plasma membrane of an animal cell? Cholesteryl esters, proteins, and a small but significant amount of triglycerides A lipid bilayer formed mainly from cholesterol with protein attached to both sides Phosphoprotein and cholesterol Phospholipids, sphingolipids, cholesterol, and protein, with some carbohydrate
Phospholipids, sphingolipids, cholesterol, and protein, with some carbohydrate
List the common membrane lipids found in cellular membrane?
Phospholipids,cholestrol,integral proteins,carbohydrates
The manufacture of chocolates containing a liquid center is an interesting application of enzyme engineering. The flavored liquid center consists largely of an aqueous solution of sugars rich in fructose to provide sweetness. The technical dilemma is the following: the chocolate coating must be prepared by pouring hot melted chocolate over a solid (or almost solid) core, yet the final product must have a liquid, fructose-rich center. Suggest a way to solve this problem. (Hint: Sucrose is much less soluble than a mixture of glucose and fructose.)
Prepare the core as a semisolid slurry of sucrose and water. Add a small amount of sucrase (invertase), and quickly coat the semisolid mixture with chocolate. After the chocolate coat has cooled and hardened, the sucrase hydrolyzes enough of the sucrose to form a more liquid center: a mixture of fructose, glucose, and sucrose. .
A tightly bound cofactor for an enzyme is often called a(n) _____.
Prosthetic group
Two proteins bind to the same ligand, and protein A has half of its binding sites occupied when the ligand concentration is 0.5 mM, while protein B has half of its binding sites occupied when the ligand concentration is at 0.3 mM. Which protein binds the ligand more strongly, and what is the dissociation constant for that protein-ligand interaction?
Protein B binds more strongly, and Kd=0.3 mM.
What is the Bohr effect and how do the effects of CO2 and 2, 3-biphosphoglycerate (BPG) on oxygen-dissociation of Hb contribute to?
Pure Hb has a High affinity (attraction) for O2. BPG, CO2 and H+ ions serve as Negative allosteric effectors of Hb. They reduce the affinity (attraction) of Hb for O2, stabalizing the T (inactive) form of the protein and shifting the oxygen-dissociation curve to the Right. This is the Bohr effect. An example of the Bohr effect would be Carbon Monoxide poisoning. It binds to the Hb instead of the O2 and your body does not get the O2 you need.
Structurally, myoglobin and hemoglobin are very similar proteins. In which of the following levels of structure do they differ most? Tertiary structure. Quaternary structure. Primary structure. Secondary structure.
Quaternary structure. Myoglobin does not have quaternary structure whereas hemoglobin does.
It is impossible for RNA to store genetic information, because
RNA can store genetic information
8 7
RNA duplexes are considerably more stable than DNA duplexes of comparable sequence. Although the physical basis for this thermal stability is not understood, it means that even though the A=U base pairs of double-stranded RNA are weaker than the A=T base pairs of double-stranded DNA, the melting point of the RNA duplex will be higher than that of the DNA duplex.
Which present-day observable piece of evidence supports the "RNA world" hypothesis?
RNA molecules participate in biologically significant reactions,RNA can serve as an information-carrying molecule, and RNA nucleotides catalyze peptide bond formation.
Summarize the various members of the RTK family, their ligands, and functions
RTK -> Ligands -> Principal Fxn 1) IR -> insulin, insulin-like growth factors (IGFs) -> glucose homeostasis 2) EGFR (ErbB1/HER1) -> emidermal growth factor (EGF) -> cell growth and poliferation 2) PDGFR -> platelet-derived growth factor -> cell growth and differentiation 3) FGFR -> fibroblast growth factor -> cell growth and development 4) VEGFR -> Vascular endothelial growth factor (VEGF) -> vasculature development 5) HGFR (Met) -> Hepatocyte growth factor -> embryonic development 6)NGFR (TrkA) -> nerve growth factor -> neuronal development 7)EphR (Ephs) -> ephrin -> cell adhesion and migration
The scientists who used x-ray crystallography to shed light on the three-dimensional structure of DNA were:
Rosalind Franklin and Maurice Wilkins
Advantages to using triacylglycerols, rather than polysaccharides, to store energy include which reason?
The carbon atoms of triacylglycerols are more reduced, and since triacylglycerols are hydrophobic, excess water does not need to be stored along with them.
Enzyme E is responsible for conversion of substrate X to product U. As a result of this conversion electrons are transported to a coenzyme (FAD) within enzyme E. In order for the reaction to be completed, a second substrate NAD+ must also bind to enzyme E and collect stored electrons (which converts it to product, NADH). The graph below shows the data while varying X, with fixed concentrations of NAD+. What type of multi-substrate mechanism does enzyme E utilize
Sequential - Random
anti-A test serum
Serum used to test blood samples. If the sample contains A antigens, it will clot.
anti-B test serum
Serum used to test blood samples. If the sample contains B antigens, it will clot.
anti-Rh test serum
Serum used to test blood samples. If the sample is Rh+, it will clot.
Which of the following statements about sickle cell anemia is FALSE? In sickle cell anemia, hemoglobin molecules aggregate to form long fibers that distort the shape of the red blood cell. The mutation in sickle cell anemia replaces a hydrophilic surface residue with a non-polar residue. Sickle cell anemia is a consequence of a conservative mutation in the β-globin gene. Sickle cell anemia is a genetic disease.
Sickle cell anemia is a consequence of a conservative mutation in the β-globin gene. A mutation that significantly affects the folding or function of a protein cannot be considered conservative
Allosteric enzymes can be identified because the plot of initial velocity, V0, versus substrate concentration, S, is not hyperbolic but __________________ -shaped.
Sigmodial
The difference between the stretching ability of silk and wool fibers, low and high ability to stretch, respectively, is due to their protein components. Which statement CORRECTLY attributes the secondary structure contributions to this stretch ability?
Silk is mainly beta sheets; wool is mainly alpha helices.
If a reaction is exergonic at specific reactant concentrations, it is considered _____.
Spontaneous
Why does DNA contain thymine rather than uracil? What would the long-term consequence be if DNA contained uracil bases?
Spontaneous deamination of cytosine in DNA results in the formation of uracil bases - if uracil were normally present in DNA, the cell repair mechanisms would be unable to distinguish between uracil that was meant to be at that position, and uracil that had formed as a result of deamination. As uracil would pair with adenine in the next round of replication, eventually all G-C pairs would be replaced by A-T pairs
What is the common strategy by which catalysis occurs?
Stabilization of transition state
Allosteric activators
Stabilize conformations with higher substrate affinity
Starch and glycogen are both polymers of: A) fructose. B) glucose1-phosphate. C) sucrose. D) alpha-D-glucose. E) beta-D-glucose.
Starch and glycogen are both polymers of: D) alpha-D-glucose.
The enzyme furanase catalyzes the reversible hydration of furamic acid to l-maltate, but it will not catalyze the hydration of maleic acid, the cis isomer of furamic acid. This is an example of:
Stereospecificity
Which statement is NOT true of sterols? A) sterols are commonly found in bacterial membranes B)cholesterol is a sterol that is commonly found in mammals C)Sterols are precursors of steroid hormones D) sterols have a structure that includes four fused rings
Sterols are commonly found in bacterial membranes
Which statement is NOT true of sterols?
Sterols are commonly found in bacterial membranes.
Compare and contrast symport and antiport. Which term best describes the transport system mediated by the Na+K+ ATPase?
Symport and antiport are both types of cotransport systems in which two solutes move through the membrane simultaneously. In symport, both move in the same direction; in antiport, one solute goes in one direction, the other in the opposite direction. The Na+K+ ATPase of the plasma membrane is an antiport system. It moves K+ in and Na+ out in a ratio of 2 K+ per 3 Na+. Neither of the two ions can be transported unless the other is present, which is characteristic of cotransport systems.
What are the three main classes of facilitated transport?
TCC = transporters, carriers, and channels facilitated transport = facilitated diffusion = passive-mediated transport
What are the factors affecting DNA denaturation?
Temperature, pH
The "energy carrier" ATP is an example of a(n): A) deoxyribonucleoside triphosphate B) di-nucleotide C) peptide D) ribonucleotide E) ribonucleoside triphosphate
The "energy carrier" ATP is an example of a(n): E) ribonucleoside triphosphate
Smith and Wilcox found that sample A had 136 counts/min of 32P; sample B had 3,740 counts/min. Did the nuclease cleavage leave the phosphate on the 5′ or the 3′ end of the DNA fragments? Explain your reasoning.
The 5′ end. If the phosphate were left on the 3′ end, the kinase would incorporate significant 32P as it added phosphate to the 5′ end; treatment with the phosphatase would have no effect on this. In this case, samples A and B would incorporate significant amounts of 32P. When the phosphate is left on the 5′ end, the kinase does not incorporate any 32P: it cannot add a phosphate if one is already present. Treatment with the phosphatase removes 5′ phosphate, and the kinase then incorporates significant amounts of 32P. Sample A will have little or no 32P, and B will show substantial 32P incorporation—as was observed.
A solution of DNA is heated slowly until the tm is reached. What is the likely structure of the DNA molecules at this temperature?
The DNA molecules are partially denatured; in each molecule approximately 50% of the DNA is single-stranded and 50% is double-helical. The single-stranded regions, which appear as "bubbles" within the molecules, are those which denatured at lower temperatures because of their higher content of A-T base pairs.
The DNA oligonucleotide abbreviated pATCGAC: A) has 7 phosphate groups. B) has a hydroxyl at its 3' end. C) has a phosphate on its 3' end. D) has an A at its 3' end. E) violates Chargaff's rules.
The DNA oligonucleotide abbreviated pATCGAC: B) has a hydroxyl at its 3' end.
The reference compound for naming D and L isomers of sugars is: A) fructose. B) glucose. C) glyceraldehyde. D) ribose. E) sucrose.
The reference compound for naming D and L isomers of sugars is: C) glyceraldehyde.
What are the two conformations of hemoglobin? The T state (the conformation of deoxyhemoglobin) and the R state (the conformation of oxyhemoglobin). The R state (the conformation of deoxyhemoglobin) and the T state (the conformation of oxyhemoglobin). The T state (the conformation of dideoxyhemoglobin) and the R state (the conformation of deoxyhemoglobin). The T state (the conformation of myoglobin) and the R state (the conformation of deoxyhemoglobin).
The T state (the conformation of deoxyhemoglobin) and the R state (the conformation of oxyhemoglobin).
Which of the following statements about the T and R states of hemoglobin is FALSE? The R state has a smaller central cavity than the T state. In the R state, the Fe2+ ion lies in the plane of the heme. The T state is less stable than the R state at lower pH. The T state has a lower affinity for oxygen than the R state.
The T state is less stable than the R state at lower pH. This statement is false. Lower pH reflects an increased concentration of H+ ions, and the T state of hemoglobin is stabilized under these conditions.
The following data were collected under conditions indicated in the graph below during the time period of 0-5 seconds. Upon plotting the Lineweaver-Burk plot, the information given in the table below was determined. Based on this available information which of the following is FALSE X-intercept -0.002 Y-intercept 0.005 Slope. 2.50
The Vmax equals 200 M/s
Km is
The [S] that half-saturates the enzyme
The alkaline hydrolysis of RNA does not produce: A) 2'- AMP. B) 2',3'-cGMP. C) 2'-CMP. D) 3',5'-cAMP. E) 3'-UMP.
The alkaline hydrolysis of RNA does not produce: D) 3',5'-cAMP.
Why can sugar form at least two different glycosides?
The anomeric C atom undergo condensation with either the OH group from another alcohol to form an O-glycosidic bond or with an NH or NH2 group from an amine to form an N-glycosidic bond
Why can anomers of monosaccharides readily interconvert whereas epimers do not?
The anomers freely interconvert at thermodynamic equilibrium
The biochemical property of lectins that is the basis for most of their biological effects is their ability to bind to: A) amphipathic molecules. B) hydrophobic molecules. C) specific lipids. D) specific oligosaccharides. E) specific peptides.
The biochemical property of lectins that is the basis for most of their biological effects is their ability to bind to: D) specific oligosaccharides.
Which of the following statements conflicts with the fluid mosaic model? The cell membrane is static in structure. Membrane components can be derived from multiple biomolecules. Hydrophobic interactions stabilize the lipid bilayer. Proteins are asymmetrically distributed within the cell membrane.
The cell membrane is static in structure.
The compound that consists of ribose linked by an N-glycosidic bond to N-9 of adenine is: A) a deoxyribonucleoside. B) a purine nucleotide. C) a pyrimidine nucleotide. D) adenosine monophosphate. E) adenosine.
The compound that consists of ribose linked by an N-glycosidic bond to N-9 of adenine is: E) adenosine.
One of the adaptations to high altitude is an increase in the concentration of BPG in red blood cells. What effect does this have on the oxygen binding curve of hemoglobin and why? The curve is shifted to the left because hemoglobin has a lower K (dissociation constant). The curve is shifted to the right, because hemoglobin has a lower affinity for oxygen. The curve is shifted to the right, because hemoglobin has tighter oxygen binding. The curve is shifted to the left because hemoglobin binds oxygen more tightly.
The curve is shifted to the right, because hemoglobin has a lower affinity for oxygen.
The difference between a ribonucleotide and a deoxyribonucleotide is: A) a deoxyribonucleotide has an —H instead of an —OH at C-2. B) a deoxyribonucleotide has β configuration; ribonucleotide has the β configuration at C-1. C) a ribonucleotide has an extra —OH at C-4. D) a ribonucleotide has more structural flexibility than deoxyribonucleotide. E) a ribonucleotide is a pyranose, deoxyribonucleotide is a furanose.
The difference between a ribonucleotide and a deoxyribonucleotide is: A) a deoxyribonucleotide has an —H instead of an —OH at C-2.
Why do polar substances dissolve in water while nonpolar substances do not?
The dipolar character of polar solvents (water) enables it to weaken attractive forces between polar ions by surrounding each ion to neutralize its charge - hydration/solvation The hydrophobic effect causes nonpolar substances to aggregate in polar solvents (water) to cause the least disruption of water's extensive network
Which of the following is NOT a role of histidine in hemoglobin? Protonated histidine residues aid in BPG binding. The distal histidine occupies the 6th coordination position of Fe2+. Histidine residues become protonated as part of the Bohr effect. The proximal histidine occupies the 5th coordination position of Fe2+
The distal histidine occupies the 6th coordination position of Fe2+ This statement does not describe a role for histidine in hemoglobin. The 6th coordination position of the Fe(II) ion is occupied reversibly by oxygen.
The double helix of DNA in the B-form is stabilized by: A) covalent bonds between the 3' end of one strand and the 5' end of the other. B) hydrogen bonding between the phosphate groups of two side-by-side strands. C) hydrogen bonds between the riboses of each strand. D) nonspecific base-stacking interaction between two adjacent bases in the same strand. E) ribose interactions with the planar base pairs.
The double helix of DNA in the B-form is stabilized by: D) nonspecific base-stacking interaction between two adjacent bases in the same strand.
Explain why the absorption of UV light by double-stranded DNA increases (the hyperchromic effect) when the DNA is denatured.
The double-helical structure is stabilized by hydrogen bonding between complementary bases on opposite strands and by base stacking between adjacent bases on the same strand. Base stacking in nucleic acids causes a decrease in the absorption of UV light (relative to the non-stacked structure). On denaturation of DNA, the base stacking is lost and UV absorption increases.
Which of the following statements correctly describes the interaction between an allosteric protein and an allosteric effector? The effector binds non-specifically to one subunit and through induced fit initiates cooperativity between the subunits. The effector binds reversibly at a specific site on one subunit of the protein, causing a global change in conformation. The effector activates the protein by causing it to switch from its T (low affinity) to R (high affinity) form. The effector binds covalently at a specific site on the protein, causing a global change in shape.
The effector binds reversibly at a specific site on one subunit of the protein, causing a global change in conformation.
Which of the following is true under the following conditions: the enzyme concentration is 5 nM, the substrate concentration is 5 mM, and the Km is 5 uM?
The enzyme is saturated with substrate.
Describe one biological advantage of storing glucose units in branched polymers (glycogen, amylopectin) rather than in linear polymers.
The enzymes that act on these polymers to mobilize glucose for metabolism act only on their nonreducing ends. With extensive branching, there are more such ends for enzymatic attack than would be present in the same quantity of glucose stored in a linear polymer. In effect, branched polymers increase the substrate concentration for these enzymes.
What is the role of entropy in the hydrophobic effect?
The exclusion of nonpolar groups from polar surroundings so as to maximize the entropy of water molecules by minimizing nonpolar surface area to increase water's degree of freedom/movement is the basis of the hydrophobic effect
The experiment of Avery, MacLeod, and McCarty in which nonvirulent bacteria were made virulent by transformation was significant because it showed that: A) bacteria can undergo transformation. B) genes are composed of DNA only. C) mice are more susceptible to pneumonia than are humans. D) pneumonia can be cured by transformation. E) virulence is determine genetically.
The experiment of Avery, MacLeod, and McCarty in which nonvirulent bacteria were made virulent by transformation was significant because it showed that: B) genes are composed of DNA only.
The fluidity of a lipid bilayer will be increased by: F) decreasing the number of unsaturated fatty acids. C) decreasing the temperature. G) increasing the length of the alkyl chains. D) increasing the temperature. E) substituting 18:0 (stearic acid) in place of 18:2 (linoleic acid).
The fluidity of a lipid bilayer will be increased by: D) increasing the temperature.
The fluidity of the lipid side chains in the interior of a bilayer is generally increased by: A) a decrease in temperature. B) an increase in fatty acyl chain length. C) an increase in the number of double bonds in fatty acids. D) an increase in the percentage of phosphatidyl ethanolamine E) the binding of water to the fatty acyl side chains.
The fluidity of the lipid side chains in the interior of a bilayer is generally increased by: C) an increase in the number of double bonds in fatty acids.
How is Hemoglobin an example of cooperativity?
The function of Hb, which is only present in RBC's is to pick up large amounts of Oxygen in the lungs & deliver it to muscles/tissues that need O2. It has a Low binding affinity for O2 in Active tissue, readily giving up O2. It has a Low binding affinity for O2 in the Lungs, readily receiving O2 for delivery. Normal Hb binds 1 moleculeof O2 to a Heme prosthetic (Co-factor) group in a Positively Cooperative manner. The Binding of 1 molecule of O2 to a subunit in De-oxygenated Hb increases the likelihood that other O2 molecules will bind to adjacent Hb subunits.
Which of the statements below about hemoglobin's oxygen binding is INCORRECT: Entry field with correct answer The hemoglobin tetramer can bind 4 molecules of oxygen and because of its positive cooperativity, the fourth O2 molecule binds with 4-fold greater affinity than the first. In any binding system, a sigmoidal ligand binding curve (like hemoglobin's for O2) indicates an allosteric effect where there is cooperative interaction between binding sites and generally indicates that a protein has more than one subunit. The binding of oxygen to hemoglobin in an example of positive cooperativity: Oxygen binding favors the T --> R transition switching hemoglobin from the low affinity for oxygen T-state to the high affinity for oxygen R-state. Hemoglobin's sigmoidal oxygen binding curve is due to the T --> R transition: The sigmoidal curve results because of the switch from a low affinity oxygen binding hyperbolic curve in the T-state to a high affinity oxygen binding hyperbolic curve in the R-state. Oxygen binding causes a change in the quaternary structure of hemoglobin where hemoglobin changes quaternary structure from the T (tense) state that has a low affinity of oxygen to the R (relaxed) state that has a higher affinity of oxygen. The T --> R transition in hemoglobin subunits explains the difference in the oxygen affinities of oxy- and deoxyhemoglobin. The cooperative binding of O2 by hemoglobin is an example of an allosteric effect (Greek: allos, other stereos, solid or space). Allosteric effects, in which the binding of a ligand at one site affects the binding of another ligand at another site, generally require interactions among subunits of oligomeric proteins.
The hemoglobin tetramer can bind 4 molecules of oxygen and because of its positive cooperativity, the fourth O2 molecule binds with 4-fold greater affinity than the first. The false statement is "The hemoglobin tetramer can bind 4 molecules of oxygen and because of its positive cooperativity, the fourth O2 molecule binds with 4-fold greater affinity than the first." In fact, because of the beneficial effects of positive cooperativity, the fourth O2 molecule binds with 100-fold greater affinity than the first.
Which ends of a water molecule bare a partial positive and a partial negative charge? What is its van der Waals radius, and what is it's significance?
The hydrogen ends bare the partial positive charge while the lone pairs of the oxygen end bare the partial negative charge. The van der Waals radius is 1.4A; two water molecules cannot get closer to each other than 2r
What is Cooperativity?
The influence that the binding ligand of one subunit has on the binding ligand to another subunit of an Oligometric (exclusively identical polypeptide chains) protein. Is a type of behavior where a number of seemingly identical independent components act collectively, in unison or near-unison. Implies some sort of communication among seemingly independent components. In paticular, cooperativity refers to Bind-Dissociation reactions at equilibrium.
What conclusion can be drawn concerning an inhibitor if the Vmax is the same in the presence and absence of the inhibitor?
The inhibitor can be overcome with sufficiently high concentrations of substrate.
The inner (plasma) membrane of E. coli is about 75% lipid and 25% protein by weight. How many molecules of membrane lipid are there for each molecule of protein? (Assume that the average protein is Mr 50,000 and the average lipid is 750.) A) 1 B) 50 C) 200 D) 10,000 E) 50,000
The inner (plasma) membrane of E. coli is about 75% lipid and 25% protein by weight. How many molecules of membrane lipid are there for each molecule of protein? (Assume that the average protein is Mr 50,000 and the average lipid is 750.) C) 200
Which of these statements about the composition of membranes is true?
The inner and outer membranes of mitochondria have different protein compositions.
Which of these statements about the composition of membranes is true? All biological membranes contain cholesterol. Free fatty acids are major components of all membranes. The inner and outer membranes of mitochondria have different protein compositions. The lipid composition of all membranes of eukaryotic cells is essentially the same.
The inner and outer membranes of mitochondria have different protein compositions.
Which statement concerning the tautomeric forms of bases such as uracil is CORRECT?
The lactam form predominates at neutral pH.
Consider a hypothetical hemoglobin-like molecule with a Hill coefficient (constant) of 1 and the same p50 value as normal hemoglobin. Choose the statement below that best describes the two proteins. There is a cooperative interaction between oxygen-binding sites in both the hypothetical and normal hemoglobins. The hypothetical hemoglobin has a greater oxygen affinity than normal hemoglobin. The oxygen binding curve for the hypothetical hemoglobin is hyperbolic, and the curve for normal hemoglobin is sigmoidal. The two hemoglobins would be able to deliver about the same amount of oxygen to the tissues. At pO2 less than p50, normal hemoglobin has a greater YO2 value.
The oxygen binding curve for the hypothetical hemoglobin is hyperbolic, and the curve for normal hemoglobin is sigmoidal.
The phosphodiester bonds that link adjacent nucleotides in both RNA and DNA: A) always link A with T and G with C. B) are susceptible to alkaline hydrolysis. C) are uncharged at neutral pH. D) form between the planar rings of adjacent bases. E) join the 3' hydroxyl of one nucleotide to the 5' hydroxyl of the next.
The phosphodiester bonds that link adjacent nucleotides in both RNA and DNA: E) join the 3' hydroxyl of one nucleotide to the 5' hydroxyl of the next.
What is the biological advantage to an organism that stores its carbohydrate reserves as starch or glycogen rather than as an equivalent amount of free glucose?
The polymers are essentially insoluble and contribute little to the osmolarity of the cell, thereby avoiding the influx of water that would occur with the glucose in solution. They also make the uptake of glucose energetically more feasible than it would be with free glucose in the cell.
A newly-identified protein has a sigmoidal curve in a graph of fractional saturation versus ligand concentration. What can be deduced about this protein? The protein has primary, secondary and tertiary structure, but not quaternary. The protein binds the ligand cooperatively. The protein has a constant high affinity for the ligand. The dissociation constant (K) of the ligand is low.
The protein binds the ligand cooperatively. A sigmoidal-shaped binding curve typically indicates cooperative binding behaviour
A newly-identified protein shows a sigmoidally-shaped curve in a graph of fractional saturation versus ligand concentration. Which of the following statements about that protein is TRUE? Entry field with correct answer The protein does NOT bind the ligand cooperatively. The protein undergoes conformational changes in quaternary structure when the ligand binds. When the ligand binds to one subunit, the affinity of the other subunits for the same ligand remains the same. The ligand binds irreversibly at a specific site on the protein, causing a global change in shape.
The protein undergoes conformational changes in quaternary structure when the ligand binds.
How can you predict whether it will be thermodynamically favorable for an apolar substance to move from one side of a membrane to the other?
The rate of diffusion of a a substance is directly proportional to the concentration difference across the membrane and its solubility in the apolar lipid core.
At substrate concentrations much lower than the enzyme concentrations
The rate of reaction is expected to be directly proportional to substrate concentration
The plasma membrane of an animal cell consists of 45% by weight of phospholipid and 55% protein. What is the mole ratio (moles of lipid/moles of protein) if the average molecular weight of phospholipids is 750 and the average molecular weight of membrane proteins is 50,000?
The ratio of moles lipid/moles protein is about 55. In 100 g of membrane, there are 45 g/750 g·mol-1 = 0.06 mol phospholipid, and 55 g/50,000 g·mol-1 = 1.1 10-3 mol protein. So lipid/protein = 0.06/0.0011 = 55.
(Equation) Which of the following is (are) TRUE
The reaction is zero order with respect to [S] if [S] >> [E]
An extremely efficient enzyme called "efficase" catalyzes the conversion of "A" to "B." A researcher decides to mutate the enzyme in order to try to improve its performance. Following active site mutations, a significant reduction in the value of Km and Vmax was observed. Which of the following may have occured
The reverse reaction (breakdown of EA to E + A) was favored, slowing the Vmax
The ribonucleotide polymer (5')GTGATCAAGC(3') could only form a double-stranded structure with: A) (5')CACTAGTTCG(3'). B) (5')CACUAGUUCG(3'). C) (5')CACUTTCGCCC(3'). D) (5')GCTTGATCAC(3'). E) (5')GCCTAGTTUG(3').
The ribonucleotide polymer (5')GTGATCAAGC(3') could only form a double-stranded structure with: D) (5')GCTTGATCAC(3').
The shortest alpha helix segment in a protein that will span a membrane bilayer has about _____ amino acid residues. A) 5 B) 20 C) 50 D) 100 E) 200
The shortest alpha helix segment in a protein that will span a membrane bilayer has about _____ amino acid residues. B) 20
The specificity of the potassium channel for K+ over Na+ is mainly the result of the: A) differential interaction with the selectivity filter protein. B) hydrophobicity of the channel. C) phospholipid composition of the channel. D) presence of carbohydrates in the channel. E) presence of cholesterol in the channel.
The specificity of the potassium channel for K+ over Na+ is mainly the result of the: A) differential interaction with the selectivity filter protein.
What is the relationship between the strength of an acid and its pKa value?
The strength of an acid is expressed in terms of quantity by pKa, which is analogous to pH pKa = -logKa [H+] = Ka[HA]/[A-] pH = pKa + log[A-]/[HA] (only for weak acids and bases) pH = pKa @ 50% dissociation, when [HA] = [A-]
6. The DNA below is transcribed from right to left. Label the template and cording strands and write the sequence of the RNA synthesized. (4%) (5')ACTTCGGATCGTTAAGGCCGCTTTCTGT(3') (3')TGAAGCCTAGCAATTCCGGCGAAAGACA(5')
The top one is the template 5' ACAGAAAGCGGCCUUAACGAUCCGAAGU3'
The type of membrane transport that uses ion gradients as the energy source is: A) facilitated diffusion B) passive transport. C) primary active transport. D) secondary active transport. E) simple diffusion.
The type of membrane transport that uses ion gradients as the energy source is: D) secondary active transport.
The type of motion least common in biological membranes is: A) flip-flop diffusion of phospholipid from one monolayer to the other. B) lateral diffusion of individual lipid molecules within the plane of each monolayer. C) lateral diffusion of membrane proteins in the bilayer. D) lateral diffusion of protein molecules in the lipid bilayer E) random motion of the fatty acyl side chains in the interior of the phospholipid bilayer.
The type of motion least common in biological membranes is: A) flip-flop diffusion of phospholipid from one monolayer to the other.
At equilibrium in solution, D-glucose consists of a mixture of its anomers. Which statement most accurately describes the solution?
The β-anomer predominates over the α-anomer by a ratio of approximately 2:1.
Which feature allows certain lipid molecules to be used as colorful pigments in plants and animals?
Their conjugated bond structures allow absorption of visible light.
Which statement about actin is not true? Actin can bind ATP. Actin filaments are polar (the ends can be distinguished). Actin is a common protein in nonmuscle cells. There are two actin genes, one for F-actin and one for G-actin. Monomeric G-actin polymerizes to form F-actin.
There are two actin genes, one for F-actin and one for G-actin.
Summarize the structures and physical properties of fatty acids, triglycerides, phospholipids, sphingolipids, and steroids
These are the 5 major classes of lipids: PFaSST Fatty Acids: carboxylic acids with long aliphatic (chain not ring) tail, saturated and unsaturated; naturally occurring have even # of C atoms Triglycerides/Triglycerols: fatty acid esterfied derivatives of glycerol; 3 tails Phospholipids: fatty acid derivatives of phosphoglycerol with only 2 esterfied fatty acid chains; highly amphiphilic due to phosphate group Sphingolipids: ceramides are fatty acid (1 chain) amides of shpingosine (an amino alcohol) with the fatty acid on the NH3 group, sphingolipids is when one of the OH groups is esterfied to a variable X functional group: P.S. phosphocholine/ethanolamine -> sphyingomyelins O.G. oligosaccharide -> gangliosides M.C. monosaccharide -> cerebrosides Stereolipids: derivatives of sterane comprised of four non-planar rings A-D fused together
Which statement is TRUE of enzyme catalysts?
They can increase the reaction rate for a given reaction by a thousand-fold or more.
Which statement about intrinsically disordered proteins is true?
They can interact with multiple protein-binding partners and are central to protein interaction networks.
Which statement about Type II endonucleases is FALSE?
They cleave and ligate DNA.
What is the primary role of nonmuscle actin in eukaryotic cells? They form microfilaments that are part of the cytoskeleton. They form a protective barrier on the surface of the cell. They are stored to provide a source of energy. They are stored in organelles, for future use in muscle function.
They form microfilaments that are part of the cytoskeleton.
Why are ruminant animals like cows able to digest cellulose?
They have a stomach compartment that houses symbiotic microorganisms that can hydrolyze cellulose.
How do enzymes exhibit cooperativity?
They have multiple subunits and multiple active sites. Subunits and enzymes may exist in one of (2) states: [T] a low-affinity state and [R] a high-affinity relaxed state. Binding of the substrate encourages the transition of other surrounding subunits from the T state to the R state, which increases the likelihood of substrate binding in these other subunits. Conversely, Loss of substrate can encourage the transition from the R state to the T state and promote dissociation of the substrates from the remaining subunits. The R-state and T-state configurations provide regulation of Cell Metabolism.
Following several experiments, the data presented on the graph below was obtained. What can you determine from this graph
This data may have been collected both in absence (solid line) and presence (dashed line) of a mixed (noncompetitive) inhibitor
A protein is found to extend all the way through the membrane of a cell. Describe this protein in terms of the location of particular types of amino acid side chains in its structure and its ability to move within the membrane.
This integral membrane protein associates with the lipid bilayer through hydrophobic interactions between domains containing many hydrophobic amino acids and the fatty acyl chains of membrane lipids. Polar and charged residues are located on portions of the protein that protrude out of either face of the membrane. The protein is free to diffuse laterally in the plane of the membrane, but cannot move across the lipid bilayer.
Why does the concentration of BPG in red blood cells increase when humans are exposed to high altitudes? To allow hemoglobin to bind more oxygen at lower partial pressures of oxygen. To induce the production of more red blood cells. To neutralize the increased concentration of hydrogen ions produced when muscle works harder at high altitudes. To allow hemoglobin to release more oxygen at lower partial pressures of oxygen.
To allow hemoglobin to release more oxygen at lower partial pressures of oxygen. When the partial pressure of oxygen in the lungs is low, the oxygen-saturation of hemoglobin is reduced. This means that there is less total oxygen available for release in the tissues. One way to compensate for this shortfall is to ensure that hemoglobin releases relatively more oxygen in the tissues than usual and this is achieved by increasing the concentration of BPG in the red blood cells.
Describe two ways a plant can adjust the components of its cell membranes to keep them as fluid as possible on a cold winter morning.
To compensate for the solidifying effect of low temperature on membrane lipids, it can synthesize and place in the membrane (1) a greater proportion of unsaturated fatty acids and (2) shorter-chain fatty acids. Both increase the fluidity of the lipid bilayer.
Which bond(s) in α-D-glucose must be broken to change its configuration to β-D-glucose? Which bond(s) to convert D-glucose to D-mannose? Which bond(s) to convert one "chair" form of D-glucose to the other?
To convert α-D-glucose to β-D-glucose, the bond between C-1 and the hydroxyl on C-5 must be broken and reformed in the opposite configuration. To convert D-glucose to D-mannose, either the —H or the —OH on C-2 must be broken and reformed in the opposite configuration. Conversion between chair conformations does not require bond breakage; this is the critical distinction between configuration and conformation.
To possess optical activity, a compound must be: A) a carbohydrate. B) a hexose. C) asymmetric. D) colored. E) D-glucose.
To possess optical activity, a compound must be: C) asymmetric.
Why do amphiphiles form highly ordered micelles or bilayers in water?
To shield their hydrophibic groups while exposing their hydrophillic groups, driven by the hydrophobic effect
1. __ : Helps to position the RNA polymerase correctly at the promoter, to aid in separate the two DNA strands, and to release RNA polymerase from the promoter.
Transcription factors
Compounds that resemble the transition state of a catalyzed reaction and inhibit enzyme activity are called ____________________________.
Transition state analogs
11 20
Treat a suspension of the bacteria as follows: Add lactose at a concentration well above the Kt, so that virtually every molecule of galactoside transporter binds lactose. Next, add nonradiolabeled NEM and allow it to react with all available —SH groups on the cell surface. Remove excess lactose by centrifuging and resuspending the cells, then add radiolabeled NEM. The only Cys residues now available to react with NEM are those in the transporter protein. Dissolve the membrane proteins in sodium dodecylsulfate (SDS), and separate them on the basis of size by SDS gel electrophoresis. The Mr of the labeled band should represent that of the galactoside transporter.
What is the basic subunit structure of immunoglobulins? Two identical light chains and two identical heavy chains. Two identical light chains. Two identical heavy chains. One light chain and one heavy chain.
Two identical light chains and two identical heavy chains.
Double stranded DNA molecules can be cleaved at specific recognition sites by
Type II restriction endonucleases.
In this type of inhibition, the inhibitor can only bind to the ES complex to form an ESI complex.
Uncompetitive
How does a receptor tyrosine kinase phosphorylate itself?
Upon ligand binding, the receptors dimerize or undergo a conformation change to bring their TK (tyrosine kinase) domain close enough together to phosphorylate each other
radiation induced Mutagenesis
Uv light- induces dimerization of pyrimidines; may be main mechanism for skin cancers ionizing energy-x&y rays cause ring openings and strand breaking
Compare the structures of ice and water with respect to the number and geometry of hydrogen bonds
Water is sp3 hybridized with a tetrahedral geometry. The supreme attractive force of hydrogen bonding renders water a liquid at room temperature. Structure of ice: each molecule interacts tetrahedrally with four other neighboring molecules; H-bonds are highly stable/static; water expands on freezing due to this regular "open" network of hydrogen boding, lowering the density of ice Structure of water: each molecule engages in rings of 3-mer, 4-mer, or 5-mer molecules; H-bonds are highly unstable/dynamic; this rather "loose" network of hydrogen bonding allows the molecules to pack more tightly together, raising the density of the liquid
When a bacterium such as E. coli is shifted from a warmer growth temperature to a cooler growth temperature, it compensates by: A) increasing its metabolic rate to generate more heat. B) putting longer-chain fatty acids into its membranes. C) putting more unsaturated fatty acids into its membranes. D) shifting from aerobic to anaerobic metabolism. E) synthesizing thicker membranes to insulate the cell.
When a bacterium such as E. coli is shifted from a warmer growth temperature to a cooler growth temperature, it compensates by: . C) putting more unsaturated fatty acids into its membranes.
When double-stranded DNA is heated at neutral pH, which change does not occur? A) The absorption of ultraviolet (260 nm) light increases. B) The covalent N-glycosidic bond between the base and the pentose breaks. C) The helical structure unwinds. D) The hydrogen bonds between A and T break. E) The viscosity of the solution decreases.
When double-stranded DNA is heated at neutral pH, which change does not occur? B) The covalent N-glycosidic bond between the base and the pentose breaks.
What is Positive cooperativity?
When enzymes or receptors that have multiple binding sites increase the affinity of binding sites. Positive cooperativity increases the Enzyme-substrate binding.
What is Negative cooperativity?
When enzymes or receptors with multiple binding sites decrease their affinity of the binding sites. Decrease enzyme-substrate binding.
When the linear form of glucose cyclizes, the product is a(n): A) anhydride. B) glycoside. C) hemiacetal. D) lactone. E) oligosaccharide.
When the linear form of glucose cyclizes, the product is a(n): C) hemiacetal.
When two carbohydrates are epimers: A) one is a pyranose, the other a furanose. B) one is an aldose, the other a ketose. C) they differ in length by one carbon. D) they differ only in the configuration around one carbon atom. E) they rotate plane-polarized light in the same direction.
When two carbohydrates are epimers: D) they differ only in the configuration around one carbon atom.
Which of following is an anomeric pair? A) D-glucose and D-fructose B) D-glucose and L-fructose C) D-glucose and L-glucose D) alpha-D-glucose and beta-D-glucose E) alpha-D-glucose and beta-L-glucose
Which of following is an anomeric pair? D) alpha-D-glucose and beta-D-glucose
Which of the following are possible base compositions for single-stranded RNA? %A %G %C %T %U A) 5 45 45 0 5 B) 25 25 25 0 25 C) 35 10 30 0 25 D) all of the above E) none of the above
Which of the following are possible base compositions for single-stranded RNA? D) all of the above
Which of the following deoxyoligonucleotides will hybridize with a DNA containing the sequence (5')AGACTGGTC(3')? A) (5')CTCATTGAG(3') B) (5')GACCAGTCT(3') C) (5')GAGTCAACT(3') D) (5')TCTGACCAG(3') E) (5')TCTGGATCT(3')
Which of the following deoxyoligonucleotides will hybridize with a DNA containing the sequence (5')AGACTGGTC(3')? B) (5')GACCAGTCT(3')
Which of the following is a palindromic sequence? A) AGGTCC TCCAGG B) CCTTCC GCAAGG C) GAATCC CTTAGG D) GGATCC CCTAGG E) GTATCC CATAGG
Which of the following is a palindromic sequence? D) GGATCC CCTAGG
Which of the following is an epimeric pair? A) D-glucose and D-glucosamine B) D-glucose and D-mannose C) D-glucose and L-glucose D) D-lactose and D-sucrose E) L-mannose and L-fructose
Which of the following is an epimeric pair? B) D-glucose and D-mannose
Which of the following is not true of all naturally occurring DNA? A) Deoxyribose units are connected by 3',5'-phosphodiester bonds. B) The amount of A always equals the amount of T. C) The ratio A+T/G+C is constant for all natural DNAs. D) The two complementary strands are antiparallel. E) Two hydrogen bonds form between A and T.
Which of the following is not true of all naturally occurring DNA? C) The ratio A+T/G+C is constant for all natural DNAs.
Which of the following monosaccharides is not a carboxylic acid? A) 6-phospho-gluconate B) gluconate C) glucose D) glucuronate E) muramic acid
Which of the following monosaccharides is not a carboxylic acid? C) glucose
Which of the following monosaccharides is not an aldose? A) erythrose B) fructose C) glucose D) glyceraldehyde E) ribose
Which of the following monosaccharides is not an aldose? B) fructose
Which of the following pairs is interconverted in the process of mutarotation? A) D-glucose and D-fructose B) D-glucose and D-galactose C) D-glucose and D-glucosamine D) D-glucose and L-glucose E) alpha-D-glucose and beta-D-glucose
Which of the following pairs is interconverted in the process of mutarotation? E) alpha-D-glucose and beta-D-glucose (Mutarotation is the porcess in which one ring form (say the alpha anomer) opens biefly into the linear form, then closes again to produce the beta anomer.)
Which of the following statements about starch and glycogen is false? A) Amylose is unbranched; amylopectin and glycogen contain many (alpha1-->6) branches. B) Both are homopolymers of glucose. C) Both serve primarily as structural elements in cell walls. D) Both starch and glycogen are stored intracellularly as insoluble granules. E) Glycogen is more extensively branched than starch.
Which of the following statements about starch and glycogen is false? C) Both serve primarily as structural elements in cell walls. (Starch and glycogen are storage molecules! Hence the granules and the toughness of chitin and cellulose!)
Which of the following statements concerning the tautomeric forms of bases such as uracil is correct? A) The all-lactim form contains a ketone group. B) The lactam form contains an alcohol group. C) The lactam form predominates at neutral pH. D) They are geometric isomers. E) They are stereoisomers.
Which of the following statements concerning the tautomeric forms of bases such as uracil is correct? C) The lactam form predominates at neutral pH.
Which of these is a general feature of the lipid bilayer in all biological membranes? A) Individual lipid molecules are free to diffuse laterally in the surface of the bilayer. B) Individual lipid molecules in one face (monolayer) of the bilayer readily diffuse (flip-flop) to the other monolayer. C) Polar, but uncharged, compounds readily diffuse across the bilayer. D) The bilayer is stabilized by covalent bonds between neighboring phospholipid molecules. E) The polar head groups face inward toward the inside of the bilayer.
Which of these is a general feature of the lipid bilayer in all biological membranes? A) Individual lipid molecules are free to diffuse laterally in the surface of the bilayer.
Which of these statements about facilitated diffusion across a membrane is true? A) A specific membrane protein lowers the activation energy for movement of the solute through the membrane. B) It can increase the size of a transmembrane concentration gradient of the diffusing solute. C) It is impeded by the solubility of the transported solute in the nonpolar interior of the lipid bilayer. D) It is responsible for the transport of gases such as O2, N2, and CH4 across biological membranes. E) The rate is not saturable by the transported substrate
Which of these statements about facilitated diffusion across a membrane is true? A) A specific membrane protein lowers the activation energy for movement of the solute through the membrane.
Which of these statements about the composition of biological membranes is false? A) In a given eukaryotic cell type (e.g., a hepatocyte), all intracellular membranes have essentially the same complement of lipids and proteins. B) The carbohydrate found in membranes is virtually all part of either glycolipids or glycoproteins. C) The plasma membranes of the cells of vertebrate animals contain more cholesterol than the mitochondrial membranes. D) The ratio of lipid to protein varies widely among cell types in a single organism. E) Triacylglycerols are not commonly found in membranes
Which of these statements about the composition of biological membranes is false? A) In a given eukaryotic cell type (e.g., a hepatocyte), all intracellular membranes have essentially the same complement of lipids and proteins.
Which of these statements is generally true of integral membrane proteins? A) A hydropathy plot reveals one or more regions with a high hydropathy index. B) The domains that protrude on the cytoplasmic face of the plasma membrane nearly always have covalently attached oligosaccharides. C) They are unusually susceptible to degradation by trypsin. D) They can be removed from the membrane with high salt or mild denaturing agents. E) They undergo constant rotational motion that moves a given domain from the outer face of a membrane to the inner face and then back to the outer.
Which of these statements is generally true of integral membrane proteins? A) A hydropathy plot reveals one or more regions with a high hydropathy index.
Which one of the following is true of the pentoses found in nucleic acids? A) C-5 and C-1 of the pentose are joined to phosphate groups. B) C-5 of the pentose is joined to a nitrogenous base, and C-1 to a phosphate group. C) The bond that joins nitrogenous bases to pentoses is an O-glycosidic bond. D) The pentoses are always in the β-furanose forms. E) The straight-chain and ring forms undergo constant interconversion.
Which one of the following is true of the pentoses found in nucleic acids? D) The pentoses are always in the β-furanose forms.
Why is it surprising that the side chains of tryptophan residues in proteins can interact with lectins? A) because the side chain of tryptophan is hydrophilic and lectins are hydrophobic. B) because the side chain of tryptophan is (-) charged and lectins are generally (+) charged or neutral. C) because the side chain of tryptophan can make hydrogen bonds and lectins cannot. D) because the side chain of tryptophan is hydrophobic and lectins are generally hydrophilic. E) none of the above.
Why is it surprising that the side chains of tryptophan residues in proteins can interact with lectins? D) because the side chain of tryptophan is hydrophobic and lectins are generally hydrophilic.
Max Perutz's investigation of the structure of hemoglobin primarily utilized_____. X-ray crystallography NMR spectroscopy genomics mass spectrometry genetic engineering
X-ray crystallography
The Watson and Crick model of a double-helical structure for DNA was based, in part, on evidence from
X-ray diffraction.
In the plot below, can the Km be determined? If so, what is its value
Yes, it is 30 mM
How would you separate concentration-dependent and concentration-independent components of Free Energy?
You would define a standard FREE ENERGY CHARGE by determining the standard free energy: Delta (G) prime *Which is the free energy change where all reactants are at a standard concentration (which has been set at 1 mole/liter).
BLANK DNA is a left-handed double helical structure
Z
The most striking difference between A-, B-, and Z- form DNA is that:
Z-form is left handed.
Assume a first order reaction, the rate of the reaction 2A --> B is dependent on
[A]
The following question refers to the overall transformation: __B__5. For the reaction, the steady state assumption assumes that
[ES] is constant
In order for an enzymatic reaction obeying the Michaelis-Menten equation to reach 3/4 of its maximum velocity
[S] would need to be 3Km
what value of [S] as a fraction of Km is required to obtain 20% Vmax?
[S]= 0.25 Km
How does an aldose differ from a ketose?
aldose = carbonyl group is an aldehyde (HCO) ketose = carbonyl group is a ketone (RCO)
A solution of the heteropolysaccharide ____ can be heated and cooled to form a 3D matrix that traps water and supports the electrophoretic separation of nucleic acids.
agarose
Cellulose is
a linear polymer of glucose with β(14) linkages
Which of the following statements is FALSE? In its interaction with hemoglobin, oxygen is: reversibly bound. homoallosteric effector. a prosthetic group. bound at the 6th coordination position of the Fe(II) ion in the heme. a ligand.
a prosthetic group.
DNA sequencing by the chain-termination method utilizes DNA polymerase I to make a complementary copy of the target or template DNA molecule. A reaction with a 20 bp template and dideoxyadenosine nucleotides as terminators results in the production of a 5 bp fragment. Based on this result, we can conclude that the template contains
a thymine at position 16
DNA sequencing by the chain-termination method utilizes DNA polymerase I to make a complementary copy of the target or template DNA molecule. A reaction with a 20 bp template and dideoxyadenosine nucleotides as terminators results in the production of a 5 bp fragment. Based on this result, we can conclude that the template contains
a thymine at position 16
If you were attempting to design a new drug for the treatment of a disease by interfering with enzyme activity in the disease-causing organism, which type of inhibitor would likely be the most effective?
a transition state analog that is an irreversible inhibitor.
8. (6%) What happens in automated Sanger DNA sequencing reaction if you a) forget to add all ddNTPs? b) Add too much ddNTPs ? c) forget to add dNTPs? d) forget to add dGTP?
a) The polymerase will synthesize the whole strand without any breaks, but you will not detect any product at all because there are no short fragments and there is no detectable molecule. b) The polymerase will "stop" too early, thus each reaction will not be extended to full length c) Essentially, no reaction will occur, with the exception of incorporating the first ddNTP. Thus, you will see nothing. d) The polymerase reaction will proceed up to the first complementary C in the sequence and then terminate. Thus, you will see at best a very short strand of DNA sequence
Maltose monomers
a-Glucose + a-glucose via an a-1 --> 4 bond
What are the two types of secondary structures that occur in transmembrane proteins?
a-helical = signal transduction (receptors) and energy generation (proton pumps) b-barrel = passive diffusion of nutrients, slts, and water though closed hollow channel
Myoglobin's secondary structure is primarily composed of ______________. parallel β-sheets antiparallel β-sheets a-helices Ω-loops polyproline helices
a-helices
When a preparation of mitochondrial membranes was treated with high salt (0.5 M NaCl), it was observed that 40% of the total protein in this preparation was removed or solubilized. What kind of membrane proteins are in this soluble extract, and what forces normally hold them to the membrane? (b) What kind of proteins constitute the insoluble 60%, and what forces hold these proteins in the membrane?
a. peripheral membrane proteins b. integral membrane proteins
Consider the transport of glucose into an erythrocyte by facilitated diffusion. When the glucose concentrations are 5 mM on the outside and 0.1 mM on the inside, the free-energy change for glucose uptake into the cell is: (These values may be of use to you: R = 8.315 J/mol·K; T = 298 K; 9 (Faraday constant) = 96,480 J/V; N = 6.022 1023/mol.)
about 10 kJ/mol.
Consider the transport of K+ from the blood (where its concentration is about 4 mM) into an erythrocyte that contains 150 mM K+. The transmembrane potential is about 60 mV, inside negative relative to outside. The free-energy change for this transport process is: (These values may be of use to you: R = 8.315 J/mol.K; T = 298 K; 9 (Faraday constant) = 96,480 J/V; N = 6.022 1023/mol.)
about 15 kJ/mol.
The functional differences, as well as differences in three-dimensional structures, between two different enzymes from E. coli result directly from their different:
amino acid sequences
Which term BEST describes the cholesterol molecule?
amphipathic
Which term BEST describes the polarity of membrane lipids?
amphipathic
Certain plasmids contain genes that confer resistance to
ampicillin
Certain plasmids contain genes that confer resistance to ______.
ampicillin
Both α(1-4) and α(1-6) bonds can be found in the plant product ___
amylopectin
Which of these polysaccharides is a branched polymer?
amylopectin
fatty acids are attached to sphingosine by what type of chemical linkage?
an amide linkage
In molecular cloning, transformed organisms must be identified. One common method for accomplishing this involves the inclusion of ________ in the plasmid.
an antibiotic resistance gene
In molecular cloning, transformed organisms must be identified. One common method for accomplishing this involves the inclusion of ____ in the plasmid
an antibiotic resistance gene
Which of the following increases the affinity of hemoglobin for O2? an increase in BPG concentration the formation of N-terminal carbamates an increase in pH a decrease in pH an increase in CO2 concentration
an increase in pH
A protein with a high percentage of aspartate and glutamate residues would be BEST purified and concentrated with which type of column?
anion exchange
The transformation of a monosaccharide into its ____ occurs easily and does not require the assistance of a catalyst
anomer
The monosaccharides alpha-D-galactose and beta-D-galactose are
anomers
agglutination
antigen + antibody clump together
If the gene for myoglobin is "knocked out" in mice, the mice: have larger lungs. respire extremely rapidly have dark brown muscle tissue. appear normal, with lighter colored muscle tissue. have their growth stunted.
appear normal, with lighter colored muscle tissue. have their growth stunted.
Movement of water across membranes is facilitated by proteins called:
aquaporins
Peripheral membrane proteins: are generally noncovalently bound to membrane lipids. can be released from membranes only by treatment with detergent(s). may have functional units on both sides of the membrane. penetrate deeply into the lipid bilayer.
are generally noncovalently bound to membrane lipids.
in glycoproteins, the carbohydrate moiety is always attached through the amino acid residues:
asparagine, serine, or threonine
Nonsteroidal antiinflammatory drugs (NSAIDs) inhibit the synthesis of which signaling lipids from arachidonic acid?
both prostaglandins and thromboxanes
The specificity of the potassium channel for K+ over Na+ is mainly the result of the:
differential interaction with the selectivity filter protein.
in most cases in order for an informational carbohydrate to become a biologically active molecule, it must:
be covalently joined to a protein or lipid
Why is it important to maintain biological molecules in a buffered solution?
because biological molecules with ionizable groups (capable of dissociting to yield an ion) are sensitive to changes in pH
which compound can be cleaved in half to generate a molecule important in vision?
beta-carotene
BPG stands for biphenylglycine. boronylphenylglutamate. bisphosphoglycerate. bisphenylglycerol. betapropylglutamine.
bisphosphoglycerate.
Which phospholipid head group is positively charged at pH 7?
both ethanolamine and choline
The similarities of gene sequences and metabolic pathways across the three domains of life are evidence of:
both evolution and a common ancestor
Chymotrypsin catalyzes the cleavage of proteins at peptide bonds adjacent to aromatic amino acid residues by using which catalytic mechanism?
both general acid-base catalysis and covalent catalysis
When two genes in an organism share detectable sequence similarity, those genes or their gene products are said to be:
both homologues and paralogues.
Goal of the lab
calculate the relative mobility of acid phosphatase in comparison to the mobility of blue dextran
the relationship between delta Gnot and delta G is best described as:
differing from standard state to physiological or actual concentrations of reactants and products
Myoglobin's primary physiological role is to facilitate oxygen ________. storage metabolism binding reduction diffusion
diffusion
What feature do Tay-Sachs disease, Fabry disease, and Niemann-Pick disease have in common?
defects in enzymes responsible for breaking down membrane lipids in the lysozomes
The biological role of restriction enzymes is to:
degrade foreign DNA that enters a bacterium
What is the relationship (equation) between deltaG, deltaG*, and the concentration of reactants and products? *= STP
deltaG = deltaG* + RTlnKeq under non-equilibrium settings Keq = concentrations of products/reactants
Why do changes in both enthalpy and entropy determine the spontaneity of a process?
deltaG* = deltaH* - TdeltaS* = measure of thermodynamic potential (spontaneity) thermodynamically favorable (spontaneous, deltaG < 0) rxns are under: enthalpic control if deltaH < 0 and TdeltaS < 0 entropic control if deltaH > 0 and Tdelta > 0 both controls if deltaH < 0 and TdeltaS > 0
What is the relationship between energy (U), heat (q) and work (w)?
deltaU = q - w change in internal energy of the system (delta U) is equal to the amount of heat exchanged/added minus the amount of work done
In living organisms, genetic information is most often stored in the form of
deoxyribonucleic acid.
To make an DNA copy of a RNA sequence, you need the reverse transcriptase enzyme and an oligonucleotide orimer made of which nucleotide?
deoxythymine
epimers
diastereomers that differ at one chiral center ex. Glucose and Galactose
Which technique used to analyze lipids is the fastest but may not be the most accurate?
direct mass spectrometry
Humans maintain a nearly constant level of hemoglobin by continually synthesizing and degrading it. This is an example of a(n):
dynamic steady state.
Glucose transport into erythrocytes is an example of:
facilitated diffusion.
The ratio of A+T to G+C is constant for DNA from all organisms
false
You are working in a laboratory trying to design a drug that specifically binds to the surface of certain cells. To which membrane lipid constituents should your drug bind in order to achieve this specificity?
gangliosides
Tay-Sachs disease is the result of a genetic defect in the metabolism of:
gangliosides.
The two strands of the helix are aligned parallel to one another
false-antiparallel
What regulatory mechanism relies on inhibition of the first step of the pathway by the final product of the pathway?
feedback inhibition
Within the sequence of steps in the Perutz mechanism explaining Hb's cooperative binding of O2, listed following in no particular order, select the position in the order in which the step "Residues at the alpha-beta interfaces move, and ion pairs involving the C-terminal residues are broken" occurs: - His F8 is pulled towards the heme. - Residues at the - interfaces move, and ion pairs involving the C-terminal residues are broken. - Oxygen binds to deoxyhemoglobin. - Helix F tilts and is translated by about 1 Angstrom. - Fe(II) is pulled into the plane of the porphyrin. fourth third fifth second first
fifth
Within the sequence of steps in the Perutz mechanism explaining Hb's cooperative binding of O2, listed following in no particular order, select the position in the order in which the step "Helix F tilts and is translated by about 1 Angstrom" occurs: - His F8 is pulled towards the heme. - Residues at the - interfaces move, and ion pairs involving the C-terminal residues are broken. - Oxygen binds to deoxyhemoglobin. - Helix F tilts and is translated by about 1 Angstrom. - Fe(II) is pulled into the plane of the porphyrin. first fourth fifth second third
fourth
Which types of membrane lipids make up 70 to 80% of the total membrane lipids in vacular plants?
galactolipids
Which types of membrane lipids make up 70% to 80% of the total membrane lipids in a vascular plant?
galactolipids
A compound containing N-acetylneuraminic acid (sialic acid) is:
ganglioside GM2.
Which technique would you NOT use to separate and/or analyze lipids in a laboratory?
gel electrophoresis
Which molecule is MOST commonly used as a backbone the linkage of three fatty acids to form fats?
glycerol
Of the 20 standard amino acids, only ____ is not optically active. The reason is that its side chain ____.
glycine; is a hydrogen atom.
Which of the following is an example of a heteropolysaccharide?
glycosaminoglycan
the basic structure of a proteoglycan consists of a core protein and a:
glycosaminoglycan
Which types of membrane lipids are modified to determine blood type in humans?
glycosphingolipids
which types of membrane lipids are modified to determine blood type in humans?
glycosphingolipids
What do palindromic sequences cause?
hairpins and cruciforms
The DNA oligonucleotide abbreviated pATCGAC:
has a hydroxyl at its 3' end.
Membrane proteins: are sometimes covalently attached to lipid moieties. are sometimes covalently attached to carbohydrate moieties. are composed of the same 20 amino acids found in soluble proteins. diffuse laterally in the membrane unless they are anchored have all of the above
have all of the above
Muscle contraction is triggered in response to an increase in the cytoplasmic Ca2+ concentration. in response to a decrease in the cytoplasmic Ca2+ concentration. in response to an increase in the cytoplasmic cAMP concentration. in response to a decrease in the cytoplasmic cAMP concentration. in response to an increase in the cytoplasmic titin concentration.
in response to an increase in the cytoplasmic Ca2+ concentration.
Which of the following questions must the criminalist be prepared to answer when examining dried blood?
is it blood? from what species? How closely can human blood be associated with a single individual? What does the splatter pattern tell me about how the blood got there? ALL
Z DNA features
is left-handed and the backbone is zigzagged, accounting for the name "Z DNA."
The term specific activity differs from the term activity in that specific activity:
is the ativity (enzyme units) in a milligram of protein.
Vmax for an enzyme-catalyzed reaction:
is twice the rate observed when the concentration of substrate is equal to the Km.
List hormones produced by the pancreas and adrenal glands, what types of molecules are these hormones?
islets of Langerhans (2% of pancreas) secrete metabolic hormones such as insulin and glucagon which are macromolecular molecules (peptides and proteins) adrenal glands release steroids such as cortisol and aldosterone which are micromolecular molecules
DNA polymerase from Thermus aquaticus is used in PCR because..?
it is stable at high temperatures
DNA polymerase from Thermus aquaticus is used in PCR because
it is stable at high temperatures.
Michaelis and Menten assumed that the overall reaction for an enzyme catalyzed reaction can be written as whatever. Using this reaction, the rate of breakdown of the enzyme-substrate complex can be described by the expression:
k-1[ES] + k2 [ES]
The most common tautomeric form of the purine and pyrimidine bases in nucleic acids is the:
keto form
Calculate the weight in grams of a double-helical DNA molecule stretching from Earth to the moon (~320,000 km). The DNA double helix weighs about 1 × 10−18 g per 1,000 nucleotide pairs; each base pair extends 3.4 Å. For an interesting comparison, your body contains about 0.5 g of DNA.
km to anstram (1nm to A) angstram to bp (i bp is 3.4 A) bp to g (1x10^-18 per 1000 bp)
10. In the group II intron, the intron released itself through a ____ intermediate with a 2'-5'- phosphodiester bond.
lariat-like
Why is lateral diffusion of membrane lipids faster than transverse diffusion?
lateral diffusion is fast because the lipid tails are under constant motion due to free rotation about the c-C bond transverse diffusion is slow due to thermodynamic constraints that would require the polar head to momentarily go through the apolar tails to flip to the other side; and there would be steric clashes
Based on the form of the cyclic sugar shown below in a Haworth projection, which Fischer projection formula could have formed this structure?
left side: OH, H, H. right side: H, OH, OH.
By convention, the sequence of nucleotide residues in a nucleic acid is written ___________ starting with the ____ end.
left to right; 5'
By convention, the sequence of nucleotide residues in a nucleic acid is written ___________ starting with the ____ end.
left to right; 5ʹ
By convention, the sequence of nucleotide residues in a nucleic acid is written ___________ starting with the ____ end.
left to write, 5'
How do the physical properties of glycosaminoglycans and similar molecules relate to their biological roles?
linear structure, cell walls and exoskeletons
The study and classification of the complete set of lipids produced in an organisms is called:
lipidomics.
Hemoglobin S, the variant responsible for the misshapen red blood cells characteristic of the disease sickle-cell anemia, is potentially advantageous to heterozygotes because it confers some level of resistance to the disease _________. rickets AIDS cyanosis polycythemia malaria
malaria
If you wanted to analyze membrane lipids from a biological sample, which solvent would MOST effectively extract those lipids?
methanol
The pH of a blood sample is 7.4, while gastric juice is pH 1.4. The blood sample has:
one million times lower [H+] than the gastric juice.
Why is this statement false. Peripheral membrane proteins may have part of its polypeptide on both sides of the membrane.
only associate with polar heads on one side chain
Why is this statement false. All biological membranes contain cholesterol
only in animals
Hemerythrin and hemocyanin are: human mutant hemoglobins with decreased oxygen affinity. hemoglobin variants that are found in animals at high altitude. synthetic derivatives of hemoglobin's heme group used in artificial blood substitutes. oxygen transport proteins found in invertebrates. tetrameric hemoglobin derivatives containing only -chains (4 tetramers).
oxygen transport proteins found in invertebrates.
In an aqueous solution, protein conformation is determined by two major factors. One is the formation of the maximum number of hydrogen bonds. The other is the:
placement of hydrophobic amino acid residues within the interior of the protein
Which types of lipids would NOT have their fatty acids completely hydrolyzed by treatment with acid or alkali?
plasmalogens
Small circular DNA molecules used to carry foreign DNA fragments are called ________.
plasmids
A protein is found to extend all the way through the membrane of a cell. Describe this protein in terms of the location of particular types of amino acid side chains in its structure and its ability to move within the membrane.
polar and uncharged residues are located on portions of the protein that protrudes out of face membrane
Which enzymes are NOT amonf the six internationally accepted classes of enzymes?
polymerases
Nonsteroidal antiinflammatory drugs (NSAIDS) like aspirin and ibuprofen act by blocking production of:
prostaglandins
Why is this statement false. In a given eukaryotic cell type (e.g., a hepatocyte), all intracellular membranes (membranes of organelles) have essentially the same composition of lipids and proteins.
proteins are a variety of structural and functional
When a bacterium such as E. coli is shifted from a warmer growth temperature to a cooler growth temperature, it compensates by:
putting more unsaturated fatty acids into its membranes.
When a bacterium such as E. coli is shifted from a warmer growth temperature to a cooler growth temperature, it compensates the fluidity in the membrane by: increasing its metabolic rate to generate more heat. putting longer-chain fatty acids into its membranes. putting more unsaturated fatty acids into its membranes. shifting from aerobic to anaerobic metabolism.
putting more unsaturated fatty acids into its membranes.
Is cytosine a purine or a pyrimidine?
pyrimidine
Cytosine and Uracil are both examples of
pyrimidines
Cytosine, uracil, and thymine are derivatives of...
pyrimidines
Within the sequence of steps in the Perutz mechanism explaining Hb's cooperative binding of O2, listed following in no particular order, select the position in the order in which the step "Fe(II) is pulled into the plane of the porphyrin" occurs: - His F8 is pulled towards the heme. - Residues at the - interfaces move, and ion pairs involving the C-terminal residues are broken. - Oxygen binds to deoxyhemoglobin. - Helix F tilts and is translated by about 1 Angstrom. - Fe(II) is pulled into the plane of the porphyrin. second third fourth fifth first
second
Why do glycerophospholipids and sphingolipids - but not fatty acids - form bilayers?
single-tailed amphiphilic detergents and fatty acids aggregate into higher ordered micelles double-tailed amphiphilic molecules like phospholipids and oligosaccharides aggregate into higher ordered bicelles and not micelles because of unfavorable steric clashes in the double tail
Gel electrophoresis generally separates nucleic acids on the basis of
size
Gel electrophoresis generally separates nucleic acids on the basis of...?
size
What size protein spreads out more?
smaller proteins (because they take longer to move through the gel)
Allosteric activators
stabilize conformations with higher substrate affinity
The technique known as two hybrid analysis for detecting interacting gene products depend on:
stimulation of trasncription by interaction of two Gal4p domains via fused protein sequences.
Proteins areclassified within families or superfamilies based on similarities in:
structure and/or function
The Gibbs-Free energy of activation is the difference between the:
substrate and the transition state
The most abundant disaccharide is
sucrose
DNA sequencing using the Sanger method (chain-termination) requires:
template, primer, DNA polymerase, dNTPs, ddNTP
DNA sequencing using the Sanger method requires
template, primer, DNA polymerase, dNTPs, ddNTPs --a.k.a the chain terminating method --technique using dideoxynucleotides that yields a collection of daughter strands of different lengths
Hemoglobin's p50 value is about ______ as great as myoglobin's p50 value. Entry field with correct answer one-tenth half twice ten times twenty times
ten times
Myoglobin and a single chain of hemoglobin have similar ______ structures. primary secondary tertiary quaternary none of the above
tertiary
When the ribosome forms a peptide bond, which two atoms form a covalent bond?
the amino nitrogen and carboxylic acid carbon.
What are sticky-ends?
the base pairs are cleaved in a way that has on strand longer than its opposing strand
What are blunt-end fragments?
the base pairs are taken apart in an even manor --down the middle
make sure that
the buffer meniscus never drains low enough to expose the top of the packed beads
The Bohr effect refers to the decrease in affinity of Hb for O2 when the pH goes down the decrease in affinity of Hb for O2 when the pH goes up the increase in the affinity of Hb for O2 when the O2 concentration goes up the decrease in affinity of Hb for O2 when the BPG concentration goes up the decrease in affinity of Hb for O2 when the BPG concentration goes down
the decrease in affinity of Hb for O2 when the pH goes down
For enzymes in which the slowest (rate-limiting) step is the reaction k2 ES → P Km becomes equivalent to:
the dissociation constant, Kd, for the ES complex
Protein kinases are involved in
the phosphorylation of a wide variety of proteins
Why is RNA less stable than DNA in solution?
the presence of 2'-Hydroxyl (-OH) group on every nucleotide of RNA makes it labile and easily degradable/ more likely to undergo hydrolysis or autohydrolysis. Also, the extra methyl group on Thiamine makes DNA more stable than RNA which contains Uracil. -While DNA contains deoxyribose, RNA contains ribose (in deoxyribose there is no hydroxyl group attached to the pentose ring in the 2' position). These hydroxyl groups make RNA less stable than DNA because it is more prone to hydrolysis.
Experiments on denaturation and renaturation after the reduction and reoxidation of the -S-S- bonds in the enzyme ribonuclease (RNase) have shown that:
the primary sequence of RNase is sufficient to determine its specific secondary and tertiary structure.
Nucleotides play a central role in living organisms because
they mediate transport of energy within the cell they are involved in oxidation-reduction rxns they are involved in intracellular signaling they function as building blocks for nucleic acids
In larger scale operations
they use automation including pumps to regulate flow rate, and an in-line spectrophotometer that monitors absorbance of the eluate, as well as a fraction collector that delivers measured amounts of liquid into a series of test tubes
Muscle contraction is directly caused by structural changes in actin. structural changes in myosin. thick and thin filaments sliding past each other. structural changes in the Z disk. None of the above is correct.
thick and thin filaments sliding past each other.
Within the sequence of steps in the Perutz mechanism explaining Hb's cooperative binding of O2, listed following in no particular order, select the position in the order in which the step "His F8 is pulled towards the heme" occurs: - His F8 is pulled towards the heme. - Residues at the - interfaces move, and ion pairs involving the C-terminal residues are broken. - Oxygen binds to deoxyhemoglobin. - Helix F tilts and is translated by about 1 Angstrom. - Fe(II) is pulled into the plane of the porphyrin. third fifth first second fourth
third
Knowledge about the tautomeric forms of the bases of nucleic acids is needed...?
to understand H-bonding between the complementary bases
Genomic DNA is ______, resulting in the production of _________.
transcribed; mRNA
mRNA, tRNA and rRNA are all made by the process of
transcription
In the laboratory, recombinant plasmids are commonly introduced into bacterial cells by:
transformation: heat shock of the cells incubated with plasmid DNA in the presence of CaCL2.
Experiments by Avery and colleagues proved that DNA was the substance that _____ a nonpathogenic pneumococcus strain into a virulent strain.
transformed
Experiments by Avery and colleagues proved that DNA was the substance that ________________ a non-pathogenic pneumococcus strain into a virulent strain.
transformed
Transfer RNA molecules are involved in
translation
Transfer RNA molecules are involved in...?
translation
Transfer RNA molecules are involved in:
translation
An electrogenic Na+ transporter:
transports Na+ without concurrent transport of any other charged species
Which technique is NOT commonly used to analyze lipid composition?
x-ray crystallography
Which polysaccharide is found in a helically coiled conformation?
α-amylose
Starch is a mixture of:
α-amylose and amylopectin
What group is attached to the pyrimidine ring in thymine and is not present in uracil?
—CH3
Replication of Genetic Code
• Strand separation occurs first. • Each strand serves as a template for the synthesis of a new strand. • Synthesis is catalyzed by enzymes known as DNA polymerases. • A newly made DNA molecule has one daughter strand and one parent strand.
