BSCI170 final set 1

Phospholipids are special because they are amphipathic - what does that mean?

They have a hydrophilic, polar head and two hydrophobic fatty acid tails

In a multicellular eukaryote such as yourself, there are many different kinds of cells with many different functions and shapes. What makes one cell so different from another?

They make different transcription factors and express different genes

If two elements that have a noticeable difference in electronegativity form a covalent bond together, which of the following will be true?

They will have unequal sharing of electrons

When does osmosis happen?

When solutes can't diffuse

In addition to "uses energy," what other criterion can be used to recognize active transport?

When the proteins are traveling against the concentration gradient.

All of these molecules have __________ covalent bonds, resulting from the high ____________ of oxygen or nitrogen.

polar, electronegativity

Atoms are composed of a nucleus made from protons and neutrons surrounded by clouds of electrons. Those electrons are organized into layers called... what?

shells

In atoms electrons are distributed into _____ within which they occur as pairs in domains called _______ .

shells, orbitals

Where exactly does the Calvin Cycle occur in this organelle?

stroma

Which of the following solutions is isotonic relative to a solution of 1.0 M glucose?

0.5 M Na+ + 0.5 M Cl-

A eukaryotic gene is transcribed producing the following pre-mRNA: 5'-GGUAUGCCCAGAGAAAUGCAUGCGCCGUCUUAAAAUAC-3' After processing the mature mRNA looks like the following: 5'-GpppGGUAUGCCCAGAGAAACUUAAAAUACAAAAAAAAAAAA-3' Question: What structures have been added to the mature mRNA?

5 prime cap and 3 prime poly-A-tail

Consider the following eukaryotic gene that codes for a small peptide and has one intron: 5' CTGTATACTGATGACTAGCGATGAATCCCGGGCGTT TTCGGTTGCT AGCCC 3'3' GACATATGACTACTGATCGCTACTTAGGGCCCGCAAAAGCCAACGATCGGG 5' The mature mRNA made from the above gene is: 5'capGCGAUGAAUUUUUCGGUCUAGCCAAAAAAAAAAAAAAAAAA3' What is the sequence for the intron that was removed from the pre-mRNA by splicing?

5' CCCGGGCG 3'

If you are given the sequence of one strand of a DNA double helix as: 3'-AATCGTC-5' Which of the following is the correct second strand?

5'-TTAGCAG-3'

If you were to observe that gut cells are using a Na+-Sucrose symport protein to bring the sugar sucrose into cells against it's concentration gradient, and Na+ concentrations are high outside the cell, what additional transport protein would you conclude must also be in gut cells.

A sodium ion pump

The products of the light reactions are:

ATP and NADPH

What are talking about when we discuss metabolism in this class?

All of the chemical reactions in an organism

Your cells need to be able to control just about every aspect of metabolism, much of which involves regulating enzyme activity using _______ that bind to an enzyme at _________ .

Allosteric effectors, the allosteric site

Why are some elements chemically reactive and tend to combine with other elements to form molecules?

Because they have unpaired electros

Which one of the following will you always associate with catabolic reactions?

Breaking molecules down

Which of the following structures would be found in ALL cells?

DNA

Briefly explain what happens during the carbon fixation phase of the Calvin cycle.

During carbon fixation a molecule of CO2 is added to a molecule of RuBP by the enzyme Rubisco, resulting in a pair of three carbon molecules.

What is the name of the process that oxidizes NADH under aerobic conditions?

Electron transport chain

Which of the following makes eukaryotic transcription different from prokaryotic transcription?

Eukaryotes require basal transcription factors

Briefly explain the difference in initiation of transcription between prokaryotes and eukaryotes, focusing on how RNA polymerase interacts with the TATA box.

Eukaryotes require basal transcription factors, while prokaryotic RNA polymerase interacts directly with the TATA box.

What Big Idea is best represented by the following example: The Covid-19 virus is experiencing frequent changes to its DNA over time, creating variants that differ from the "original" as a result of these mutations.

Evolution

Oil glands secrete large quantities of triglycerides and other lipids from vesicles made by the Golgi onto the surface of your skin. What type of transport is being used?

Exocytosis

Passive transport using membrane proteins is called:

Facilitated diffusion

When ligand binds and activates a receptor, the intracellular signal is amplified by what mechanism?

G-protein activation

What very important molecule is the direct product of photosynthesis?

G3P

Which of the following pathways occurs in the cytoplasm of the cell?

Glycolysis

Primary structure of polypeptides consists of series of amino acids covalently connected by peptide bonds. When we digest protein we must break those peptide bonds to separate the individual amino acids, what do we call the kind of reaction (in general) being used?

Hydrolysis

The Second Law of Thermodynamics says the universe is always... what?

Increasing in entropy

An important part of understanding how enzymes work is the concept of induced fit. Briefly describe what that means.

Induced fit describes a continual change in an enzyme's conformation and shapes in response to substrate binding.

______ are molecules that prevent an enzyme from working by ______

Inhibitors, changing the shape of the active site

Why is the first half of glycolysis called the "investment phase" while the second half of glycolysis is called the "payout phase?"

It costs two ATP to get started, but eventually four ATP are made for a net gain of two ATP.

Which of the following properties would most reliably indicate something is a living organism?

It is made of cells

Which of the following is true for facilitated diffusion?

It requires transmembrane proteins

What do all enzymes do?

Lower activation energy

Let's stretch our brain muscles a bit! What happens to the rate of ATP synthesis if the pH of the thylakoid lumen decreases?

Lower pH means more H+ ions, which means greater power for ATP synthase!

Based on your experience so far, which of the following would be considered an anabolic process?

Making an H+ ion gradient

During cellular respiration, the mitochondria converts malate (C4H6O5) into oxaloacetate (C4H4O5). Which of the following is true?

Malate has been oxidized

Consider the following mRNA: 5'-GCCAGGUUGC AUG CAG AGA GGG GCC UGA AGG CUU AAAAAA-3' What polypeptide will be made by translating the RNA?

Met Gln Arg Gly Ala

5'-GpppGGUAUGCCCAGAGAAACUUAAAAUACAAAAAAAAAAAA-3' Question: What polypeptide will be made when the mRNA above is translated?

Met Pro Arg Glu Thr

What molecule is the final electron acceptor for the light reactions?

NADP+

Which of the following is definitely part of the endomembrane system?

Nuclear envelope

Which of the following will pass through a phospholipid bilayer freely without assistance from transport proteins?

Oxygen (O2)

What is the purpose of splitting of water (photolysis) in the light reactions?

Photolysis resupplies electrons to PSII.

What is the higher energy electron donor for the electron transport chain in the first half of the light reactions?

Photosystem II

Any atom will have a nucleus that has positive charge from ______ , surround by particles with negative charge called ______ .

Protons, Electrons

In the light reactions, electrons power an electron transport chain to do what work?

Pump H+ ions

What enzyme unwinds the DNA during transcription?

RNA polymerase

Hydrogen bonding between backbone amino and carbyl groups of amino acids in newly made polypeptides makes the polymer form helix and sheet shapes. What LEVEL of protein structure is this?

Secondary

Which of the following would describe a negative delta G reaction?

Spontaneus

Which feature of the Watson-Crick model of DNA allowed you to answer the previous question?

Strict base pairing

How does the ribosome "know" what amino acid to to add next when building a polypeptide?

The correct tRNA hydrogen bonds to the next codon

During the transition step, pyruvate is converted to acetyl-CoA and one carbon dioxide is released. Where does the CO2 come from?

The decarboxylation of pyruvate

Which of the following statements would you expect to be true if you know that two atoms are joined by a non-polar covalent bond?

The elements are similar in electronegativity

As concisely as you can manage, define "diffusion."

The passive movement of molecules or particles from an area of higher concentration to a place of lower concentration.

What is the function of the promoter in gene expression?

The promoter recruits RNA polymerase to the gene

What property do all lipids have in common?

They are hydrophobic

What very import limitation is shared by both RNA polymerases and DNA polymerases?

They can only add nucleotides to the 3'-end

An example of this is DNA, which is composed of a string of ______ monomers.

nucleotide

What is ONE way you can recognize leading strand daughter DNA in a figure of a replication fork?

leading strand daughter DNA is synthesized with the 3'-end towards the fork AND it is one long strand

What is the function of ribosomes in cells?

make proteins

Answer the following questions about the element nitrogen, which has an atomic number of 7. 1. How many valence electrons will nitrogen have? 2. How many unpaired valence electrons will nitrogen have? 3. How many bonds should nitrogen make in a molecule?

1. Nitrogen will have 5 valence electrons 2. Nitrogen will have 3 unpaired valence electrons 3. Nitrogen should make 3 bonds.

The Calvin Cycle occurs in three stages- list them in order

1. carbon fixation 2. reduction phase 3. regeneration phase

What are two things that are required in living cells to make positive delta G reactions "go"?

1. enzymes 2. reaction coupling

If a cell needs to perform an anabolic reaction that requires +12.1 kcal/mole of free energy to work, it will need to use how many ATP?

2

Just by looking at the formula for hydrogen sulfide (H2S) you can immediately tell the element sulfur must have _______ unpaired valence electrons

2

What are the products of glycolysis starting from one glucose molecule?

2 pryuvate 2 ATP 2 NADH

If you transcribe a DNA template strand that has the following sequence: 5'-AATCGCATATG-3' What will be the sequence on the RNA?

3'-UUAGCGUAUAC-5'

If you have a piece of double stranded DNA with 18% "A", what percent "C" would you expect to see?

32%

The molecule silicon dioxide is SiO2. Knowing this, without looking at a periodic table, you can immediately conclude that the element silicon has how many unpaired valence electrons?

4

Name ONE organelle that was likely acquired by endosymbiosis?

mitochondria

As an experiment you drop a piece of potato into a 40% salt solution (which is very salty!). Which of the following outcomes would you expect?

Your potato would become smaller from losing water

Translation stops when...

a release factor binds to a stop codon in the A site

Where is chemical energy stored in molecules?

bonds

Peptides are also large biological molecules made using reactions called ___________ because they remove water.

dehydration synthesis

Entropy is a measure of...

disorder

The element magnesium is a flammable metal while hydroxide is in corrosive drain cleaner - both are very dangerous. However, when these are put together to make the molecule magnesium hydroxide, we get "milk of magnesia" which is a medicine that makes your upset tummy feel better. 1) What Big Idea is this an example of?

emergent properties

In your own words, what does the First Law of Thermodynamics tell us about energy?

energy is neither created nor destroyed

We break down these polymers into monomer units using ________ reactions because they add water back.

hydrolysis

We can assume that all of these molecules that we have been talking about on this page are _________ , meaning that they are soluble in water.

hydrophilic

A eukaryotic gene is transcribed producing the following pre-mRNA: 5'-GGUAUGCCCAGAGAAAUGCAUGCGCCGUCUUAAAAUAC-3' After processing the mature mRNA looks like the following: 5'-GpppGGUAUGCCCAGAGAAACUUAAAAUACAAAAAAAAAAAA-3' Question: There are nucleotides in the pre-mRNA that are missing in the mature mRNA (bolded). What is the block of nucleotides called? Why don't we see them in the mature mRNA?

introns. we don't see them in the mRNA because they are removed by RNA splicing as RNA matures since they don't carry information to build a protein