Ch. 15-16 DNA Replication & Genetic Code

What would be the consequence(s) for DNA synthesis if primase were defective?

Both leading and lagging strand synthesis would be incomplete Primase is required to synthesize the RNA primers on both the leading and lagging strands (all DNA polymerases require a primer).

RNA primers must be present on which strand during DNA synthesis?

Both leading and lagging strands

The enzyme that can replicate DNA is called

DNA polymerase

What would be the consequence(s) for DNA synthesis if DNA ligase were defective?

Lagging strand synthesis would be incomplete; leading strand synthesis would be largely unaffected. Without DNA ligase activity, Okazaki fragments on the lagging strand would not be joined together; leading strand synthesis would be largely unaffected.

As the two parental (template) DNA strands separate at a replication fork, each of the strands is separately copied by a DNA polymerase III (orange), producing two new daughter strands (light blue), each complementary to its respective parental strand. Because the two parental strands are antiparallel, the two new strands (the leading and lagging strands) cannot be synthesized in the same way.

Leading Strand: -made continuously -only one primer needed -daughter strand elongates toward replication fork Lagging Strand -daughter strand elongates away from replication fork -made in segments -multiple primers needed both -synthesized 5' to 3'

the short sections of DNA that are synthesized on the lagging strand of the replicating DNA.

Okazaki fragments

After replication is complete, the new DNAs, called __________, are identical to each other.

daughter DNA

Consider the consequences of a mutation in the DNA template sequence 5'ATG3' to 5'TTG3': What is (a) the resulting change in the mRNA codon and (b) the effect on the corresponding amino acid?

(a) CAU to CAA; (b) His to Gln

Mutant N. crassa cells that cannot make arginine on their own must be supplied with arginine to grow. For the metabolic pathway shown in Figure 16.1, if a mutant lacked enzyme 2, would it still be able to grow if it were provided with (a) ornithine or (b) citrulline in its diet?

(a) No; (b) Yes Citrulline, but not ornithine, can still be converted to arginine even if enzyme 2 is lacking.

In contrast to the leading strand, the lagging strand is synthesized as a series of segments called Okazaki fragments. The diagram below illustrates a lagging strand with the replication fork off-screen to the right. Fragment A is the most recently synthesized Okazaki fragment. Fragment B will be synthesized next in the space between primers A and B.

1) pol III binds to 3' end of primer B 2) pol III moves 5' to 3', adding DNA nucleotides to primer B 3) pol I binds to 5' end of primer A 4) pol I replaces primer A with DNA 5) DNA ligase links fragments A and B

Assuming that each replication fork moves at a rate of 500 base pairs per second, how long would it take to replicate the E. coli chromosome (with 4.6 million base pairs) from a single origin of replication?

4600 seconds

What is a metabolic pathway?

A series of steps in which enzymes work one at a time to convert a compound to a related compound If any step of the pathway is not completed, the final compound is not synthesized.

Each codon shown below specifies an amino acid. For which one is it possible that a change in a single base could create a stop codon?

AAA Changing the first base from A—>U creates the stop codon UAA.

What are the steps (in the correct order) that link a change in the base sequence of a gene to a change in the phenotype of an organism like a mouse or a human?

DNA—>RNA—>Protein This is the central dogma, which summarizes the flow of information in cells from DNA (genes) to proteins. For genes that encode RNAs that do not function as mRNAs, only the DNA—>RNA step occurs.

Identify the start and stop codons in the mRNA sequence 5'-UAUCCAUGGCACUUUAAAC-3'. What is the resulting amino acid sequence?

Start codon: AUG; stop codon: UAA; protein: Met-Ala-Leu-stop The start codon is AUG, and there are three possible stop codons: UAA, UAG, and UGA.

A mutation that prevented DNA ligase from functioning would result in what effect on DNA synthesis?

The leading strand would continue to be synthesized, but lagging strand synthesis would be incomplete. DNA ligase seals the gaps between Okazaki fragments

Which statement is correct concerning DNA synthesis catalyzed by DNA polymerases?

The new DNA strand is synthesized in the 5'—>3' direction; the template strand is read in the 3'—>5' direction. DNA synthesis by DNA polymerases always proceeds in the 5'—>3' direction, using a complementary, antiparallel strand as template

The DNA double helix is composed of two strands of DNA; each strand is a polymer of DNA nucleotides. Each nucleotide consists of a sugar, a phosphate group, and one of four nitrogenous bases. The structure and orientation of the two strands are important to understanding DNA replication.

a) 5' end b) hydrogen bond c) 3' end d) deoxyribose sugar e) nitrogenous base f) phosphate group g) 3' end h) 5' end The DNA double helix is constructed from two strands of DNA, each with a sugar-phosphate backbone and nitrogenous bases that form hydrogen bonds, holding the two strands together. Each DNA strand has two unique ends. The 3' end has a hydroxyl (-OH) group on the deoxyribose sugar, whereas the 5' end has a phosphate group. In the double helix, the two strands are antiparallel, that is, they run in opposite directions such that the 3' end of one strand is adjacent to the 5' end of the other strand.

The diagram below shows a bacterial replication fork and its principal proteins.

a. Breaks hydrogen bonds, unwinding DNA double helix. b. Synthesizes RNA primers on leading and lagging strands. c. Replaces RNA primers with DNA nucleotides. d. Catalyzes phosphodiester bond formation, joining DNA fragments. e. Lagging strand f. Leading strand g. Relaxes supercoiled DNA. h. Coats single-stranded DNA. i. Synthesizes DNA 5' to 3' on leading and lagging strands.

As DNA replication continues and the replication bubble expands, the parental double helix is unwound and separated into its two component strands. This unwinding and separating of the DNA requires three different types of proteins: helicase, topoisomerase, and single-strand binding proteins.

helicase: binds at the replication fork, breaks H-bonds between bases topoisomerase: binds ahead of the replication fork, breaks covalent bonds in DNA backbone single-strand binding protein: binds after the replication fork, prevents H-bonds between bases

Which strand of DNA is synthesized toward the middle of the replication bubble?

lagging strand DNA polymerase can only work in the 5' to 3' direction.

The new DNA strand that grows continuously in the 5' to 3' direction is called the

leading strand

In Figure 16.7b, what would be the base sequence of the mRNA and the amino acid sequence of the protein if the bottom DNA strand serves as the template for transcription?

mRNA: 5'AUGCUGGAGGGGGUUAGACAU3' Protein: Met-Leu-Glu-Gly-Val-Arg-His

During DNA replication, an open section of DNA, in which a DNA polymerase can replicate DNA, is called a

replication fork