EXAM 1 BIO

If a DNA molecule contains 30% Cytosine, how much Uracil will it contain? (Hint: You need to take your time to read this question carefully. It is about DNA, not RNA.) Question options: 30% 0% 20% 40%

0%

The difference between deoxyribose and ribose lies in the ______ carbon of the sugar unit. 1' None 2' 5'

2'

The largest number of codons that specify a single amino acid is: (Hint: Look at the codon table carefully.) Question options: 4 6 2 1

6

Which of the following double stranded DNA molecules would maintain its double helical structure longer as temperature increases? Question options: A DNA molecule that has more guanine and cytosine nucleotides. A DNA molecule that has more adenine and thymine nucleotides. Both DNA molecules would be equally stable under conditions of increasing temperature.

A DNA molecule that has more guanine and cytosine nucleotides.

Which bond links amino acids together in polypeptides? Question options: A peptide bond. A hydrogen bond. An aminoacyl bond. A phosphodiester bond.

A peptide bond.

What is wobble? How many codons stop translation? Do codons control transcription? What does UTR mean? In an mRNA where are UTRs found? Are stop codons translated? Is the mRNA sequence before the AUG translated? How many reading frames are there in an mRNA? What are the key steps in translation?

Base pairing between the 3rd base in the codon and anticodon is sometimes relaxed. 3 no a terminator does UnTranslated Region (UTR) is before the start and after the stop codons. No no three tRNA charging, initiation, polypeptide elongation, termination

What are the weakest types of bonds in DNA? Question options: Bonds between the nitrogenous base and deoxyribose sugar Bonds between nucleotides on complementary strands Bonds between the deoxyribose sugar and phosphate groups Bonds between the P and O groups in the backbone

Bonds between nucleotides on complementary strands

Which of the following types of organisms consist of cells? A. bacteria B. yeast C. plants D. animals E. All living organisms are based on cells.

E

Most proteins retain metabolic activity when denatured. Question options:TrueFalse

False

Prokaryotic DNA is synthesized in the nucleus Question options:TrueFalse

False

The phosphodiester bonds in DNA break apart easily, allowing for DNA replication. Question options:TrueFalse

False

Theories typically rely on a single hypothesis tested several times; theories do not take into consideration multiple hypotheses. True False

False

In the initiation step of translation, the first amino acid in the new polypeptide chain is: Question options: Leu. Arg. Ala. Met.

Met.

Which one of the following components of an amino acid differs from one amino acid to another? Question options: The carboxyl group The amino group The side chain (i.e., the R-group) The central carbon atom The hydrogen atom opposite the R group

The side chain (i.e., the R-group)

What important feature of non-covalent bonds makes them important for life? The strength of non-covalent bonds in the cellular environment keeps atoms bound tightly together. This allows information, stored in DNA, to be passed from one generation to the next over eons. None of the answers are correct. The weakness of non-covalent bonds in the cellular environment, allows interactions between molecules to be made, broken, and reformed easily. This allows cells to dynamically react to the environment. Non-covalent bonds are only found in salts. Because salts do not exist in cells, non-covalent bonds are not important for life.

The weakness of non-covalent bonds in the cellular environment, allows interactions between molecules to be made, broken, and reformed easily. This allows cells to dynamically react to the environment.

Select all stop codons. Question options: UAG UAA UGA AUG

UAG UAA UGA

A young girl is staring at the raindrops running down her window. She notices that the raindrops remain more or less intact, even as they cascade down the windowpane. This is a result of: hydrogen bonds between water molecules. covalent bonds between water molecules. ionic bonds between water molecules. polar covalent bonds between water molecules. oxygen bonds between water molecules.

hydrogen bonds between water molecules.

In a DNA double helix the complementary strands are held together by: Question options: phosphodiester bonds. proteins. hydrogen bonds. peptide bonds.

hydrogen bonds.

Water readily dissolves compounds that are referred to as _____. hydrophilic hydrophobic nonpolar aqueous solvent

hydrophilic

Which bonds rely on the attraction of full or partial positive and negative charges? Select all that apply. ionic bonds hydrogen bonds covalent bonds

ionic bonds hydrogen bonds

What differentiates isotopes of the same element? charge protons neutrons electrons

neutrons

Which of the following brings amino acids to the ribosome for use in translation? Question options: mRNA rRNA tRNA siRNA

tRNA

During transcription, the sequence of the primary transcript (i.e., the newly produced RNA) matches (Select all that apply): Question options: the non-template strand, but T is replace with U. the nonsense stand, but T is replaced with U. the template strand, but T is replaced with U. the sense strand, but T is replaced with U.

the non-template strand, but T is replace with U. the sense strand, but T is replaced with U.

The RNA transcript runs from _____ and matches ______. (Select all that apply). Question options: the sense (i.e., non-template) DNA strand 5' to 3' 3' to 5' the template DNA strand

the sense (i.e., non-template) DNA strand 5' to 3'

During a peptide bond formation _______ molecule is released. Question options: none water oxygen hydrogen

water

Two major types of protein secondary structures are referred to as: Question options: Residual and permanent. Elementary and primary. Ionic and covalent. α helix and β sheet. Amino and carboxyl.

α helix and β sheet.

In a ribbon model of a polypeptide, broad arrows indicate: Question options: β sheets disulfide linkages α helices All of these choices are correct β sheets and α helices

β sheets

Which number represents the pH of a solution with the highest concentration of hydrogen ions? 11.5 9.1 4.5 1.0 7.0

1.0

Which one of the following pairs would be classified as isotopes of each other? Question options: Na+ and Cl- C and Si H and H+ 12C and 13C

12C and 13C

How many water molecules would be produced in making a polypeptide that is 14 amino acids long? (Hint: First figure out how many waters would be produced by joining two amino acids together. Then do the same for three amino acids. Once you understand the pattern the question is straightforward.) Question options: 0 14 13 28

13

If a DNA molecule contains 30% thymine (T), how much guanine (G) will it contain? (Hint: If you see a question you recognize, make sure to slow down and read it with extra care. Professors like to reuse questions, but slightly alter them so the answer is different.) Question options: 20% 40% 30% 10%

20%

How many functional tRNAs (ignoring those in mitochondria) are found in human cells? How many nucleotides make up the anti-codon? What enzyme puts the correct amino acid on a tRNA? What is an uncharged tRNA? What is a charged tRNA? How many tRNA synthases exist in human cells? Does it surprise you that the number of tRNA synthases equals the number of amino acids? What does the phrase 'anti-codons are anti-parallel and complementary to codons' mean?

22? Noting that rRNAs always have an anti-codon loop and bind an amino acid, be able to recognize a cartoon of a tRNA regardless of how it is drawn. group of 3 nucleotides aminoacyl-tRNA synthetases Uncharged tRNAs lack an amino acid. Charged tRNAs covalently bind an amino acid. Appreciate that tRNA synthase charges tRNA. 20 no A binds to T or U and G binds to C. Anticodons run from 5 to 3 while condons run from 3 to 5

At which end of a DNA or RNA strand (the 5' or 3') are new nucleotides added? If shown a picture of DNA's chemical structure, be able to point to the site of new nucleotide addition. Be sure to know the three parts of a nucleotide (also covered in the last lecture). Do the two strands in DNA run in the same 5' to 3' direction? What does anti-parallel mean?

3 Base Phosphate Sugar no running in opposite direction Note if both strands had a parallel arrangement, they would they both run 5' to 3' going from left to right.

When RNA is transcribed from the DNA template strand, new nucleotides are added at the: Question options: 3' end. C-terminus. 5' end. N-terminus.

3' end.

A template DNA strand contains 30% A, 20%T, 27% G, and 23% C. The RNA transcript contains: (Hint: You will need to think carefully about the difference between the sense strand and the template strand of DNA, the nucleotides found in DNA and RNA, and the pairings between different types of nucleotides.) Question options: 30% U, 20% A, 27% C, and 23% G. 30% A, 20% U, 27% G, and 23% C. 30% T, 20% A, 27% C, and 23% G. 30% A, 20% T, 27% G, and 23% C.

30% U, 20% A, 27% C, and 23% G.

An RNA molecule is synthesized in which direction? Question options: 3' end to 5' end 5' end to 4' end 3' end to 3' end 5' end to 3' end

5' end to 3' end

The most common isotope of oxygen has 8 protons and an atomic mass of 16. How many neutrons are present in the oxygen nucleus? 2 6 8 10

8

The most common isotope of oxygen has zero net charge, 8 protons and an atomic mass of 16. How many electrons are present in the orbitals around an atom of oxygen? 6 4 8 10 2

8

An mRNA coding sequence is 30 nucleotides long. The first codon is 5'-AUG-3' and the last codon is 5'-UGA-3'. How many amino acids (AA) does it encode? (Hint: Look at the codon table to decode these sequences.) Question options: 29 AA 10 AA 30 AA 9 AA

9 AA

In a deoxyribonucleotide, what chemical group is found at the 2' carbon of the sugar component? (Hint: Slow down here and look at the numbering of the sugar in your lecture notes.) Question options: One or more phosphate groups A hydrogen atom A hydroxyl group An amino group An oxygen

A hydrogen atom

What is a cistron? What does polycistronic mean? Are multiple proteins made at the same time from a strand of polycistronic mRNA in prokaryotes? How do eukaryotic and prokaryotic cells differ in terms of the process of transcription?

A segment of DNA, equivalent to a gene, specifies a single functional unit, such as a protein. (Cistron just means gene). Polycistronic means multiple genes. yes prokaryotes can do it faster and simultaneously while eukaryotes canr

The first codon in every protein is ___ in DNA and ___ in mRNA (select two choices). Question options: ATG UAC UAA AUG

ATG, AUG

If you are given an anti-codon in the format 3' - UAC - 5' be able to write the codon it binds to noting the 5' and 3' ends of the codon. What is always the first codon? What amino acid does the first codon encode? What is the first amino acid in every protein? Given that there are three nucleotides in a codon and four different types of nucleotides, how many codons are there? What does the phrase, 'codons are unambiguous' mean? What does the phrase, 'the code is redundant' mean? How does redundancy arise?

AUG MET (methionine) Met 64 Unambiguous: a specific codon codes for only one AA. The code is redundant: different codons lead to the production of the same AA. Wobble explains redundancy. Base pairing between the 3rd base in the codon and anticodon is sometimes relaxed. In the 3rd position of a codon,the rule that A binds to T andG binds to C can be broken.

The strands in a DNA molecule are: (Select all that apply.) Covalently bonded to each other Perpendicular Antiparallel Complementary Identical

Antiparallel Complementary

New amino acids add to a peptide at its: Question options: C terminus. 3' end. 5' end. N terminus.

C terminus.

The discovery that DNA from killed virulent bacterial can transform live harmless bacteria into virulent forms means that DNA (Hint: See text book.) Question options: Is double stranded Is transcribed into RNA Contains information that controls an organism's traits Code for proteins

Contains information that controls an organism's traits

What describes the Central Dogma of Biology? Question options: DNA -> RNA -> Protein RNA -> DNA -> Protein Protein -> DNA -> RNA DNA -> Protein -> RNA

DNA -> RNA -> Protein

Which one of the following macromolecules is defined by a physical property instead of a chemical structure? Question options: Polysaccharides Nucleic acids Monosaccharides Proteins Lipids

Lipids

Using the codon table translate the following sequence into amino acids: 5' AUG ACU UCA CAU AAU GGU GGA UAG-3'. Question options: MTSQGHG MASHGGH MTSHNGG None

MTSHNGG

What is the overall charge of the phosphate groups in ATP molecules found in cells (where the pH is approximately 7)? Negative Neutral Positive None of the above

Negative

Which atom is the most electronegative: (Hint see the color coded table in the lecture.) Nitrogen Oxygen Hydrogen Carbon

Oxygen

Deoxyribonucleic acid is directly involved in? Question options: the storage of information. cell-to-cell communication. biological catalysis. energy storage.

The storage of info

Methyl groups are hydrophobic. True/False

True

Polycistronic mRNAs encode multiple proteins. Question options:TrueFalse

True

Some RNA molecules possess catalytic activity. Question options:TrueFalse

True

The codons in mRNA specify the amino acids that are used to make a protein. Some amino acids are specified by just one codon, whereas others are specified by multiple codons. Question options:TrueFalse

True

The base uracil pairs with _______ Question options: adenine. cytosine. guanine. thymine.

adenine.

A tRNA contains: Question options: a stop codon and Shine-Dalgarno sequence. a ribosome binding site and 5ʹ cap. an amino acid attachment site and a start codon. an amino acid attachment site and an anticodon loop. an anticodon loop and promoter binding site.

an amino acid attachment site and an anticodon loop.

Which option does not possess the ability to synthesize proteins? a viral particle that has infected a bacterial cell a human cell a bacterial cell an isolated virus

an isolated virus

Aminoacyl tRNA synthetases: Question options: attach aminos to growing peptide chains in the ribosome. attach amino acids to uncharged tRNAs. mediate the binding of tRNA anticodons to mRNA codons. attach anticodons to uncharged tRNAs.

attach amino acids to uncharged tRNAs.

An atom of iron has 26 protons, 30 neutrons and 28 electrons. What is its atomic number? a. 2 b. 26 c. 56 d. 84

b

According to the phylogenetic tree shown in the figure, the primate MOST closely related to humans is the: Hint: See textbook for more detail about phylogenetic trees. Question options: gorilla. lemur. chimpanzee. gibbon. orangutan.

chimpanzee.

Of the given types of bonds between atoms, which is the strongest? hydrogen bond ionic bond covalent bond van der Waals forces

covalent bond

A pair of shared valence electrons is referred to as a(n): covalent bond. hydrogen bond. hydrophobic effect. ionic bond. van der Waals interaction.

covalent bond.

An atom of carbon has 6 protons, 6 neutrons and 6 electrons. What is its atomic mass? a. 0 b. 1 c. 6 d. 12

d

The ability of atoms to attract electrons is referred to as: van der Waals attraction. hydrophobicity. cohesion. potential energy. electronegativity.

electronegativity.

RNA processing occurs in: Question options: both prokaryotic and eukaryotic cells. eukaryotes only. prokaryotes only. viruses only. both prokaryotes and viruses.

eukaryotes only.

A major difference between eukaryotic cells and prokaryotic cells is that: eukaryotic cells have a nucleus and prokaryotic cells do not. prokaryotic cells have a nucleus and eukaryotic cells do not. neither eukaryotic cells nor prokaryotic cells have a nucleus. both eukaryotic cells and prokaryotic cells have a nucleus.

eukaryotic cells have a nucleus and prokaryotic cells do not.

A pair of atoms joined by a polar covalent bond: is unlikely to form hydrogen bonds with water. mixes well with non-polar solvents. has a slight positive charge on one atom and a slight negative charge on the other. has the charge spread evenly across both atoms.

has a slight positive charge on one atom and a slight negative charge on the other.

Ribose differs from deoxyribose in that a ribose: Question options: is missing a hydroxyl group. has an extra hydroxyl group. has an extra phosphate group. is missing a phosphate group.

has an extra hydroxyl group.

During transcription, the template DNA strand and the RNA: (Select all that apply.) Question options: have an anti-parallel configuration. are bound together by covalent bonds. have a parallel configuration. are bound together by hydrogen bonds.

have an anti-parallel configuration. are bound together by hydrogen bonds.

Fill in the blanks: Polar covalent bonds allow ______ substances to interact with water. hydrophobic hydrophobic and hydrophilic hydroneutral hydrophilic

hydrophilic

Translation refers to the process in a cell where information: Question options: in a DNA double strand is used to synthesize RNA. in a single RNA strand is used to synthesize DNA. in a single RNA strand is used to synthesize a protein. in a protein is used to synthesize RNA.

in a single RNA strand is used to synthesize a protein.

The designation of a magnesium ion as Mg+2 indicates an atom that has: gained two protons and is negatively charged. lost two electrons and is positively charged. lost two electrons and is negatively charged. two more protons than neutrons. gained two protons and is positively charged.

lost two electrons and is positively charged.

Which statement is correct about translation? Question options: mRNA is read 3' to 5', and the first amino acid is at the C terminus mRNA is read 5' to 3', and the first amino acid is at the C terminus mRNA is read 5' to 3', and the first amino acid is at the N terminus mRNA is read 3' to 5', and the first amino acid is at the N terminus

mRNA is read 5' to 3', and the first amino acid is at the N terminus

Which functional group contains only nonpolar covalent bonds? methyl phosphate amino sulfhydryl

methyl

MOST of life's diversity is: acellular. microbial. terrestrial. aerobic. aquatic.

microbial.

Is RNA commonly found in a double-stranded configuration? Can base-pairing occur in RNA? If you see a sequence of nucleotides, tell if it is from DNA or RNA. What is the function of transcription? What is the sense strand? What is the non-template strand? What is the template strand? Does RNA assemble in the 3' to 5' direction? The lecture states the RNA transcript is complementary to the DNA template; what does this mean?

no single strand yes XX taking dna and making rna the strand that runs 5-3 that is identical to the rna that is being made the sense strand the strand used to make rna yes that's the direction of transcription The rules: RNA: U binds A, A binds T, G binds C, and C binds G

How do you number the carbons in a five-carbon sugar? Why are prime symbols used in the numbering of carbons in the sugars of nucleotides? Which three bases are pyrimidines (knowing the single letter code is fine). What is the defining feature of pyrimidines? Which two bases are purines (knowing the single letter code is fine). What is the defining feature of purines?

on each carbon to tell sugars and bases apart Cytosine Thymine Uracil (pyr=fire/ cut firewood) single ring adenine guanine double ring

•What are the differences between peptides, poly-peptides, and proteins? •What are the four levels of protein structure? •What type of bonds are central for the primary, secondary, tertiary, and quaternary structures? •What level of structure is associated with alpha helixes and beta sheets? •What type of bond forms alpha helixes and beta sheets? •Does the formation of alpha helixes and beta sheets involve R groups? •What sort of bonds hold the tertiary structure of proteins together?

peptides are a a chain of 10-50 AAs polypeptides are a long chain of AAs that make up a functional unit proteins are multiple long chains that form together to make one functional unit primary,secondary,tertiary,quaternary secondary hydrogen bonds no ionic,hydrogen,covalent,hydrophobic exclusion

Which functional group typically has a negative charge at the pH of the cell? phosphate amino sulfhydryl methyl

phosphate

At some point in their life cycle, all cells have a _____, whereas not all cells have a(n) _____. nucleus; nuclear membrane plasma membrane; nuclear membrane nucleus; plasma membrane nucleus; cytoplasm plasma membrane; RNA or DNA

plasma membrane; nuclear membrane

The oxygen and hydrogens of a water molecule contains what type of bond? Question options: ionic hydrogen van der Waals interactions polar covalent

polar covalent

Peptide bonds form between amino acids to stabilize the __________ structure of a protein. Question options: secondary primary quaternary tertiary

primary

Aminoacyl tRNA synthase (ARS) is involved in which step of translation? Question options: Termination Initiation tRNA charging Polypeptide elongation

tRNA charging

Which statement accurately describes a polar covalent bond? (Note: for the 'incorrect answers' you should know the type of bond that is described.) the unequal sharing of electrons between an atom with a partial positive charge and an atom with a partial negative charge the equal sharing of electrons between atoms of identical or similar electronegativities. None of the other answer options is correct. the interaction of a hydrogen atom connected to an atom with a high electronegativity and an electronegative atom of another molecule the interaction of an atom with very high electronegativity and an atom with very low electronegativity

the unequal sharing of electrons between an atom with a partial positive charge and an atom with a partial negative charge

The language of nucleic acids is converted to the language of amino acids during the process known as : Hint: See textbook for more detail about the central dogma. translation. replication transcription. central dogma.

translation.

As part of their normal function, many proteins bind to DNA briefly and then release it again. Which types of bonds might be involved in these transient protein-DNA interactions? (Select all that apply.) (Hint: Understanding that some types of bonds are easy to break and reform, while others are not is key point in this section of the class.) Question options: Covalent van der Waals forces (aka London dispersion forces) Ionic Hydrogen

van der Waals forces (aka London dispersion forces) Ionic Hydrogen

In a DNA strand, successive nucleotides are linked by: Question options: Hydrogen bonds Peptide bonds Base stacking 3'-5' phosphodiester bonds

3'-5' phosphodiester bonds

What anti-codon is found on tRNATYR ? (Hint, TYR stands for tyrosine, has the one-letter code Y, and its codon is 5'-UAC-3'. The most straightforward approach will be to write out the codon on a piece of paper, including the 5' and 3' ends, and then based on this write out the anti-codon including the 3' and 5' ends.) Question options: 3'-AUG-5' 5'-AUG-3' 3'-UAC-5' 5'-UAC-3'

3'-AUG-5'

You are examining the DNA sequence below. What is the sequence and the direction on the complementary strand? 5'-GCTGA-3' 3'-GCTGA-5' 5'-CGACT-3' 3'-TCAGC-5' 3'-CGACT-5'

3'-CGACT-5'

A single-stranded DNA sequence may be written as: 5'-ATGC-3'. Which of the following could be written to represent the same single-stranded sequence? (Hint: Here I am asking about just a single strand of DNA. This is not a question about creating the complementary DNA strand.) Question options: 5'-CGTA-3'. 3'-TACG-5'. 3'-CGTA-5'. 3'-ATGC-5'

3'-CGTA-5'.

Which end of an mRNA, the 5' or 3', is the first to enter and exit a ribosome? Which sites on a ribosome (E, P, or A) do charged tRNAs enter and uncharged tRNAs exit? Do ribosomes move along mRNA? By how many nucleotides do they advance when they move? What is the difference between poly-cistronic and mono-cistronic mRNA? What are the Shine-Dalgarno sequences? Which end of a protein emerges from a ribosome? What happens during termination?

5 prime A site enter E site exit yes 3 multiple geans vs one gene Ribosome binding site 5' transcription stops

You are examining the DNA sequence below. What is the sequence and the direction on the complementary strand? 5'-CTGAGT-3' Question options: 5'-CTGAGT-3' 5'-TGAGTC-3' 5'-ACTCAG-3' 5'-GACTCA-3'

5'-ACTCAG-3'

You are examining the DNA sequence below. What is the sequence and the direction on the complementary DNA strand? 3'-GTAC-5' Question options: 5'-CATG-3' 3'-GTAC-5' 5'-GTAC-3' 5'-CAUG-3'

5'-CATG-3'

You are examining the DNA sequence below, what is the sequence and the direction on the complementary strand? 3'-GACTCG-5' Question options: 5'-GCTCAG-3' 5'-GACTCG-3' 5'-CTGAGC-3' 5'-CGAGTC-3'

5'-CTGAGC-3'

A single-stranded DNA sequence may be written as: 3'-AGGTACT-5'. Which of the following could be written to represent the same single-stranded sequence? (Hint: Here I am asking about a single strand of DNA. This is not a question about creating a complementary DNA strand. Whenever you see something underlined, pay close attention.) Question options: 3'-TCCATGA-5' 5'-TCATGGA-3' 5'-TCCATGA-3' 5'-AGGTACT-3' 3'-TCATGGA-5

5'-TCATGGA-3'

In a nucleotide, the phosphate is attached to the _____ carbon of the sugar, and the base is attached to the _____ carbon of the sugar. Question options: 5'; 3' 5'; 1' 3'; 5' 1'; 5' 2'; 3'

5'; 1'

Carbon-14 (also written as 14C) is an isotope of carbon that possesses: 6 protons, 8 neutrons, and 2 electrons. 8 protons, 6 neutrons, and 2 electrons. 6 protons, 2 neutrons, and 6 electrons. 6 protons, 6 neutrons, and 2 electrons. 6 protons, 8 neutrons, and 6 electrons.

6 protons, 8 neutrons, and 6 electrons.

All organisms use which of the following molecules to carry out cellular work such as growth and moving DNA none of the answer choices is correct ATP membranes RNA

ATP

Which of the following CORRECTLY describes the complementary base pairing of adenine in both DNA and RNA? Question options: Adenine pairs with cytosine in DNA and with guanine in RNA. Adenine pairs with uracil in DNA and with thymine in RNA. Adenine pairs with guanine in DNA and with cytosine in RNA. Adenine pairs with thymine in DNA and with uracil in RNA. Adenine pairs with thymine in both DNA and RNA.

Adenine pairs with thymine in DNA and with uracil in RNA.

Santiago Elena and Richard Lenski (A professor at MSU) performed long-term artificial selection experiments with bacteria. Over time, the bacteria evolved an ability to use succinate as a food source. Which of the following is a conclusion of these experiments? (See text book). Bacteria can evolve over time. Natural selection can occur in the laboratory. All of the answer options are correct. Bacteria can evolve an improved ability to use succinate. Evolution can occur in the laboratory.

All of the answer options are correct.

Which one of the following can contribute to a protein's tertiary structure? Question options: Covalent bonds Hydrogen bonds All of the other answer options are correct. Ionic bonds

All of the other answer options are correct.

Proteins can be used for which of the following cellular roles? Question options: Cell signaling All of these answers are correct Biological catalysis Structural support Cell communication

All of these answers are correct

What causes denaturation of a protein? (Hint: Make sure to pick the 'most' correct answer.) Question options: Acidic environments (i.e., pH < 2). All of these answers are correct. High heat (i.e., >212 F or 100ºC) Basic environments (i.e., ph > 9)

All of these answers are correct.

Single covalent bonds between carbon atoms (Hint: See the textbook for more information about rotation.) Allow a molecule to twist and turn into many different arrangements Are strong enough to support long chains of carbon atoms All of these choices are correct Allow free rotation of the carbon atoms around the bond

All of these choices are correct

The structural diversity of carbon-based molecules is determined by which of the following properties? Question options: The orientation of those bonds in the form of a tetrahedron All of these choices are correct The ability of carbon to form four covalent bonds The ability of those bonds to rotate freely

All of these choices are correct

Which of the following is not a macromolecule? Proteins Lipids Amino acids Nucleic acids carbs

Amino Acids

Which functional groups are found at the beginning and end of a protein? Question options: Amino group at the beginning, Carboxyl group at the end. Amino group at the beginning, Amino group at the end. Carboxyl group at the beginning, Amino group at the end. Carboxyl group at the beginning, Carboxyl group at the end.

Amino group at the beginning, Carboxyl group at the end.

•Be able to find the amino group, carboxyl group, R group, and central carbon of an amino acid regardless of how drawn. •Know that in skeletal formulas, each vertex is a carbon, and H groups are not drawn unless they bind an element besides C. •Know that a dehydration reaction forms peptide bonds. •If shown a peptide bond, be able to draw in the partial charges based on an understanding of electronegativity. •Memorize that there is an amino group at the beginning of proteins, and it is called the N-terminus. •Memorize that there is a carboxyl group at the end of proteins, and it is called the C-terminus.•Note that in proteins and amino acids, the backbone is the same, and the R groups vary •Based on an understanding of electronegativity, be able to look at an R-group and tell if it contains non-polar or polar covalent bonds. Based on this, be able to infer if it forms H-bonds, is hydrophilic, or hydrophobic. •If shown a ribbon diagram of a protein, be able to point out an alpha helix or beta sheet. •Note that amino and carboxyl groups are ionized (i.e., have a plus or minus charge) at physiological pH (i.e., pH 7).•If you see a ring with double bonds, it is aromatic.

Appreciate that proteins do virtually everything in cells, except for storing genetic information, and forming a lipid bilayer. •Understand that chemicals like morphine work by binding to the R-groups of AAs and then changing the protein's shape.•Based on the structure of a molecule and the amino acids in a protein, be able to predict how changes in one will alter their interactions.70 •Appreciate that mutations in genes change the sequence of amino acids in a protein. As a result, the chemical groups and structure of the protein can change. This can decrease, increase, or have no effect on the structure and function of a protein.

A hypothesis is: A. an unproven theory. B. a tentative idea or question that can be tested by experiments. C. a verifiable observation. D. an experiment that leads to a prediction. E. a mathematical description of an observation

B

Sometimes an error occurs and an adenine is paired to a cytosine. Why is this interaction less stable than an adenine-thymine or cytosine-guanine base pair? (Hint: This is a hard question and the idea was not directly covered in class. To answer it, you need to look at the structures of A and C and think about how they fit together to make a base-pair.) Question options: Because an ionic bond cannot be formed between the two. Because the phosphate groups of the two bases repel each other. Because the charges on the bases repel one another. Because the chemical groups that form hydrogen bonds are in the wrong positions.

Because the chemical groups that form hydrogen bonds are in the wrong positions.

Because of hydrogen bonding, water is uniquely suited for its central role in life. Many hydrophilic molecules interact freely with water, but a number of hydrophobic molecules are important for life, too. How does the interaction between water and hydrophobic molecules help to organize biological systems? Because cells are not pure water—in that they have many substances dissolved within them—the hydrophilic/hydrophobic effect has a limited role in biological organization. The ionic bonds between water molecules cause hydrophobic molecules to associate with each other and not with water molecules. Because water molecules preferentially associate with each other, they force hydrophobic molecules to associate with each other and not with water molecules. None of the other answer options is correct.

Because water molecules preferentially associate with each other, they force hydrophobic molecules to associate with each other and not with water molecules.

Because of hydrogen bonding, water is uniquely suited for its central role in life. Many hydrophilic molecules interact freely with water, but a number of hydrophobic molecules are important for life, too. How does the interaction between water and hydrophobic molecules help to organize biological systems? (Hint: look back at Class 2). Question options: The ionic bonds between water molecules cause hydrophobic molecules to associate with each other and not with water molecules. Because water molecules preferentially associate with each other, they force hydrophobic molecules to associate with each other and not with water molecules. None Because cells are not pure water (they have many substances dissolved within them), the hydrophilic/hydrophobic effect has a limited role in biological organization.

Because water molecules preferentially associate with each other, they force hydrophobic molecules to associate with each other and not with water molecules.

When carrying out a controlled experiment, it is important to: A. change multiple variables at once to see the full effect of the variables. B. exclude data that does not support your hypothesis. C. change only one variable at a time. D. All of these choices are correct.

C

Which of the following reflects the process of science? A) Observation → hypothesis formulation → experiment → prove or disprove hypothesis B) Observation → experiment → hypothesis formulation → prove or disprove hypothesis C) Observation → hypothesis formulation → experiment → support or refute hypothesis D) Observation → experiment → hypothesis formulation → support or refute hypothesis

C

In translation, new monomers are added at the: Question options: 5' end. N-terminus. C-terminus. 3' end.

C-terminus.

At physiological pH (i.e., pH 7), the ionized state of the carboxyl (COOH) in the R group of aspartic acid is: Question options: COO- COOH+ COOH CO-O-

COO-

What do Joules and calories measure? At what temperature do covalent bonds break? Does cooking food break covalent bonds? What is cohesion? What effects does cohesion have on the behavior of water? What is adhesion in the context of water, and what impact does it have on its behavior? How do hydrogen bonds arise? What is a partial charge?!!!listen to lecture 29:56 Are partial charges present in nonpolar covalent bonds? When hydrogen bonding occurs with a phosphate ion, what atom does the H in water interacts with: O or P?

Calories (cal) and Joules (J) are interchangeable units of energy 3000ºC no arises because of the attraction between H2O molecules for themselves. This explains: -The surface tension of water -Hydrophobic exclusion -The high heat of vaporization Adhesion - arises through attraction with other molecules -Ability for water to dissolve substances and to make things wet. -Capillary action For H-bonding to happen, the H must have a partial positive charge, and it must be able to interact with something with either a partial negative charge or a free pair of electrons. A partial charge is due to the difference in EN. When one atom wants electrons more than the other. No O

What element makes up most of the dry mass of a cell? How does carbon's electron configuration explain its ability to form large, complex, diverse organic molecules? In this course, we will be working with seven key functional groups: hydroxyl, carbonyl, carboxyl, amino, sulfhydryl, phosphate, and methyl. For each of these groups, you need to do the following: • Draw the molecular structure of each functional group. • Classify each functional group as nonpolar, polar uncharged, or charged.

Carbon With four valence electrons, carbon can form four covalent bonds with a variety of atoms. This ability makes large, complex molecules possible. XXX

What are all living organisms composed of? How big are cells? How do new cell arise? What is the genetic material of cells? What is a nucleoid, what is the nucleus? What does the plasma membrane do? What defines a prokaryote? What defines a eukaryote? How are prokaryotic and eukaryotic cells similar and different?

Cells The smallest prokaryotic cell currently known has a diameter of only 400 nm. Eukaryotic cells normally range between 1- 100µm in diameter. cell division Dna and Rna Nucleoid: singular circular molecule of dna in prokaryotic cells Nucleus: DNA is stored, packaged into chromosomes Encloses and protects cell, transports nutrients into the cell and also to transport toxic substances out of the cell. lacks nucleus no membrane bound organelles cells contain a nucleus and other membrane-bound organelles DNA exists that relates to genes. The cell wall is present in both

Which are the strongest bonds in an aqueous environment (surrounded by water) as found in biological systems? Ionic bonds Covalent bonds Hydrogen bonds London Dispersion Forces.

Covalent bonds

How do di-sulfhydryl bonds stabilize protein structure? Where are phosphate groups found? What is the charge on phosphate at pH 7? Are methyl groups found in hydrophilic or hydrophobic molecules? Which functional groups form hydrogen bonds? What are the four major classes of macromolecules? Which macromolecules are polymers? What is the definition of a polymer?

Covalently cross linking different parts of the protein together Nucleic acids Negative Hydrophobic Hydroxyl, Carbonyl, phosphate, aminos lipids, proteins, aa's, carbs carbs aa's and proteins long molecule consisting of many similar monomers covalently bonded

In eukaryotes, newly synthesized proteins encoded by genes are found in the _____, while DNA is found the _____. Nucleus; Cytoplasm Cytoplasm; Cytoplasm also Nucleus; Nucleus also Cytoplasm; Nucleus Nucleus; Nucleus also or the cytoplasm

Cytoplasm; Nucleus

Which one of the following represents a Watson-Crick base pair with the LARGEST number of hydrogen bonds? Question options: Thymine and Guanine Adenine and Cytosine Cytosine and Guanine Adenine and Thymine Cytosine and Thymine

Cytosine and Guanine

What happens during transcription? What happens during translation? Is DNA physically converted to RNA during transcription? Where do transcription and translation occur in prokaryotes?

DNA is transcripted into rna, DNA is used to make RNA RNA is translated using ribosomes into Protein no A DNA template is used to make RNA. Ribosomes read off information in RNA to make proteins cytoplasm

A promoter region is a specific: Question options: DNA sequence where RNA polymerase can bind to initiate transcription. DNA sequence where RNA polymerase binds to initiate translation. RNA sequence that binds to DNA to initiate transcription. protein sequence that is used to initiate transcription.

DNA sequence where RNA polymerase can bind to initiate transcription.

A mutation in _____ results in a change in _____ that sometimes produces a(n) _____ with altered structure and function. Hint: See textbook for more detail about genetic variation and mutations. DNA; RNA; protein protein; RNA; DNA RNA; protein; DNA RNA; DNA; protein protein; DNA; RNA

DNA; RNA; protein

Which of the following would affect the secondary structure of a protein? (Hint: Each of these affects a different level of protein structure. Can you identify the level of structure that would be disrupted for each answer?) Question options: Disruption of the interactions between two separate polypeptide chains. Changing the sequence of the amino acids. Disruption of the hydrogen bonds that hold different regions of the poly-peptide backbone together. Disruption of ionic bonds that hold the R-groups of amino acids together.

Disruption of the hydrogen bonds that hold different regions of the poly-peptide backbone together.

Why is ethanol soluble in water? How does DNA differ from RNA? In which macromolecule are carboxyl groups found? What do carboxyl groups do in proteins? What is the name of the bond that holds amino acids together?Which functional groups are found at the beginning and end of a protein? What is the charge on amino and carboxyl groups at pH 2, 6, and 11?

Ethanol has a polar -OH (hydroxyl group) group, which hydrogen bonds to water; which makes ethanol soluble. DNA has a Oh and rna just has H Amino Acids Protein synthesis. Every amino acid has both a carboxyl group and an amino group. The bond formed between these groups allows amino acids to be chained together in long sequences, and is known as a peptide bond. peptide bonds n terminus (amino) c terminus (carboxyl) carboxyl: 0, 0, -1 amino: 0, 0, 1+

In which of the domains do the cells store their genetic information in a nucleus? Eukarya Bacteria and Eukarya Eukarya and Archaea Archaea and Bacteria Archaea

Eukarya

3' - TCGGTCATCTGTGTGACCATGTC - 5' is a RNA sequence. Question options:TrueFalse

False

During transcription of a given protein-coding gene, both strands are used as template. Question options:TrueFalse

False

Lipids are polymers. True/False

False

Who was instrumental in the discovery of DNA double helix structure? Question options: Watson and Crick Chargaff Franklin and Wilkins Franklin, Wilkins, Watson, and Crick

Franklin, Wilkins, Watson, and Crick

In aqueous solutions, which type of bond or force has similar bond strength as ionic bond interactions? Nonpolar covalent bond Hydrogen bonds Polar covalent bond

Hydrogen bonds

Water molecules have high cohesion. This is because between water molecules there are Ionic bonds Hydrogen bonds Covalent bonds Hydrophilic compounds holding water together.

Hydrogen bonds

Which functional group differentiates RNA and DNA? (Hint: The answer is directly linked to how RNA and DNA are named.) Question options: Hydroxyl Amino Carboxyl None of the above

Hydroxyl

In Pasteur's experiment showing that living organisms arise from other living organisms, which one of the following statements MOST accurately describes Pasteur's hypothesis? (See text book.) Straight-neck flasks allow for more contamination than swan-neck flasks. Sterilization of broth kills microbes. If microbes arise from nonliving matter, they should appear spontaneously in sterile broth. The first cells must have come from chemical reactions occurring in early Earth. Microbes should be capable of growing equally well in sterile broth contained in both straight-neck and swan-neck flasks.

If microbes arise from nonliving matter, they should appear spontaneously in sterile broth.

Which one of the following represents the flow of information as described by the central dogma of molecular biology? Hint: See textbook for more detail about the central dogma. Information in protein is translated into RNA and then stored as DNA. Information in DNA is directly translated into protein. Information in DNA is transcribed into RNA and then translated into protein. Information in RNA is transcribed into DNA and then translated into protein. Information in DNA is translated into RNA and then transcribed into protein.

Information in DNA is transcribed into RNA and then translated into protein.

How do ions form? Why are ionic bonds weaker than polar covalent bonds? Understand pH. What is the charge on amines at pH 7 and 12? What is the charge on carboxyl groups at pH 0 and 7? Why do low and high pHs disrupt the structure of organic molecules like proteins? Are hydrophobic molecules attracted to each other?

Ions form when electrons are fully transferred to another atom. An example is the transfer of an electron from sodium to chlorine. Before transfer, the net charge for each atom is zero. Afterwards, each atom gains a charge. This is because the covalent interaction is lost. Thus, only the opposite charges generate a force of attraction. Ph slides 46-68 7=1+ 12=0 0 Changing the pH disrupts the hydrogen bonds, and this changes the shape of the protein No they are not, the attraction of water to water forces the hydrophobic molecules together Appreciate that London dispersion forces are a type of van der Waal interaction.

What does the term complementary mean in the context of DNA? If the nucleotides in a single strand of DNA are held together with phosphodiester bonds, what type of bond holds two different strands of DNA together? How many hydrogen bonds hold A and T together? How many hydrogen bonds hold G and C together? Is the interaction between A T or G C stronger? Why? If you boil a solution of DNA, which types of bonds break? Based on your knowledge of DNA structure, why is the concentration of purines equal to the concentration of pyrimidines in DNA?

Know that A binds to T and G binds to C in DNA. double stranded structure chemically matches the sequence on the other strand. H bonds 2 3 GC because they have more bonds H bonds Chargaff's rules

What are the primary roles of mRNA, tRNA, tRNA synthetase, and ribosomes in translation? What are the three sites in a ribosome. How are they ordered going left to right. What happens at the E site? What happens at the A site? What is a codon? What is a reading frame? What determines the correct reading frame? How many amino acids are found in human cells?

Messenger RNA (mRNA) -provides instructions. tRNA synthetases - attach amino acids to tRNAs. Transfer RNA (tRNA) - binds to mRNA to assemble the amino acids in the correct order. The ribosome - is the enzyme that covalently links amino acids together Exit site, Aminoacyl site, Peptidyl site. tRNA enters at A and exits at E. EPA tRNA exits at E binding site for charged t-RNA molecules Codons are groups of 3 nucleotides The reading frame is the grouping of three codons Ribosomes scan mRNA using tRNAMET to find AUG. This sets the reading frame 20 AA's

Given the mRNA sequence 5' - UAUGACAUAAUCU - 3', use the codon table to determine the peptide a ribosome would translate. Question options: Met - Thr Met - Tyr - Asp - Ile - IIe Tyr - Asp - Ile - IIe Met - Thr - Ser

Met - Thr

What amino acid sequence will be produced from this mRNA sequence: 5' - AUG UUU CCU - 3'? Question options: 5' - Met - Phe - Pro - 3' C-terminus - Met - Phe - Pro - N-terminus 3' - Met - Phe - Pro - 5' N-terminus - Met - Phe - Pro - C-terminus

N-terminus - Met - Phe - Pro - C-terminus

At physiological pH, the ionized state of the amino (NH2) group in the R group of lysine is: (Hint: Lysine is an amino acid. You can view its structure in the table of amino acids found in the book on pp. 73, Fig. 4.2, or in the table of amino acids in the lecture notes.) Question options: NH4+2 NH2 NH- NH3+

NH3+

What groups make up a DNA nucleotide? Question options: Nitrogenous Bases, Ribose Sugar and a Phosphate Group Nucleoside, Phosphate, and Pentose Sugar Nitrogenous Base, Phosphate, and Deoxyribose Sugar Dinucleotide, Oxygen, Deoxyribose Sugar

Nitrogenous Base, Phosphate, and Deoxyribose Sugar

A boy observes a robin outside of his window. He notices the robin repeatedly cocks its head to one side before pecking the ground. The boy suspects that when the robin cocks its head it is actually listening for worms or insects underground. If the boy notes that a single robin routinely catches a worm after cocking its head, would this observation prove his hypothesis to be correct? Yes, but further experiments are needed. Yes, and no further experiments are needed. No, as this would prove the boy's hypothesis is incorrect. No, this observation would only support the boy's hypothesis, but not prove it.

No, this observation would only support the boy's hypothesis, but not prove it.

The function of a protein is dependent upon the shape into which the chain of amino acids folds. Many noncovalent interactions are responsible for maintaining the protein's shape. Assume you have isolated a protein from an organism in its proper shape, and you have treated it with an enzyme that selectively targets and breaks only the peptide bonds in the proteins. Would the protein retain its shape under these conditions? Question options: No; while the noncovalent bonds determine the shape of a protein, the peptide bonds are required to hold the amino acids together. Yes; once noncovalent bonding determines the shape of a protein, the peptide bonds are no longer necessary. Yes; because the noncovalent interactions that determine the shape of a protein are stronger than the peptide bonds. Yes; but the shape would be affected to a greater extent by changes in temperature.

No; while the noncovalent bonds determine the shape of a protein, the peptide bonds are required to hold the amino acids together.

Pyrimidine and purine bases are found in which macromolecules? Question options: Fatty acids Nucleic acids Carbohydrates Proteins

Nucleic Acids

What macromolecule passes genetic information from parents to children in eukaryotes and prokaryotes? Which macromolecule forms chromosomes? What does the central dogma state? What does dogma mean? Can RNA ever be used to make DNA? What happens during replication?

Nucleic acids (DNA) DNA Dna to Rna to Protein Dogma: a principle or set of principles laid down by an authority as incontrovertibly true. Yes when you have HIV and AIDS DNA to DNA

_____ are the subunits of nucleic acids, and _____ are the subunits of proteins. Question options: Nucleoli; Amino acids Bases; polypeptides Amino acids; Nucleic bases Polypeptides; Sugars Nucleotides; Amino acids

Nucleotides; Amino acids

Recalling that a carbon atom possesses four valence electrons, what is the most likely structural formula for carbon dioxide (CO2)? Hint: Recall the number of covalent bonds an atom forms is typically equal to the number of empty valence slots. Question options: O=C-O O-C-O O-C=O O=C=O

O=C=O

What is a fact? What is a law? What is theory? What is a hypothesis? What is an atom?

Observation explains behavior of system but NOT why explains HOW something happens a question that can have a yes or no answer, can be experimented but never PROVEN consist of protons, neutrons, electrons/smallest unit of matter

In a double-stranded DNA molecule, the strands are said to be antiparallel because: Question options: One strand runs 5' to 3' and the other 3' to 5'. They form an uneven pair of grooves on the outside of molecule. They wind around one another. Each purine of one strand pairs with a pyrimidine of another.

One strand runs 5' to 3' and the other 3' to 5'.

What is required for ionic bond interactions to form? Unevenly shared electrons Opposite partial charges Opposite full charges Evenly shared electrons

Opposite full charges

Peptide bonds are characteristic of which macromolecules? Question options: Nucleic acids Lipids Fatty acids Proteins Carbohydrates

Protiens

Which most likely came first, DNA or RNA? Why do people think this? Why do most cells store information in DNA instead of RNA? What are the four bases found in DNA? What are the four bases found in RNA? Which is typically longer, DNA or RNA?

RNA Because it has multiple functions because dna is more stable GUAC guanine adenine thymine cytosine guanine adenine uracil cytosine dna

What is the name of the enzyme complex that forms at the start of transcription? Question options: DNA polymerase RNA helicase DNA gyrase RNA polymerase

RNA Polymerase

What does RNA polymerase do? What do enhancers do? What is the purpose of RNA processing? What steps occur in eukaryotic cells after RNA synthesis? Do transcription and translation happen simultaneously in prokaryotes? Do transcription and translation happen simultaneously in eukaryotes? If no, why not?

RNA Polymerase is the enzyme responsible for transcription Know that initiation, elongation, and termination are the three steps in transcription. Enhancers control initiation in eukaryotes prevent RNA degradation After synthesis, RNA processing removes unneeded sections, by a process called alternative splicing. •Additionally, to prevent RNA degradation, a 5' cap and poly (A) tail are added.•After processing, the RNA is transported from the nucleus to the cytoplasm through the nuclear pore. yes no

Which one of the following statements about RNA is INCORRECT? Question options: RNA is usually found in double-stranded form, just like DNA. RNA is less stable than DNA. RNA molecules can form base pairs within a single strand. RNA molecules are typically shorter than DNA molecules.

RNA is usually found in double-stranded form, just like DNA.

Which one of the following statements about RNA is CORRECT? (Hint: You will need to think carefully about which nucleotides are pyrimidines, which are purines, and the specific nucleotides found in DNA and RNA.) Question options: RNA uses the same purine bases as DNA. RNA has the same 5-carbon sugars as DNA. All of these choices are correct. RNA is a more stable molecule than DNA. RNA uses the same pyrimidine bases as DNA.

RNA uses the same purine bases as DNA.

Based on these statements pick the most correct answer. Statement 1 - All polypeptides a have tertiary structure.Statement 2 - All proteins have a quaternary structure. Question options: Statements 1 and 2 are both true Statements 1 and 2 are both false Statement 1 is false, but statement 2 is true Statement 1 is true, but statement 2 is false

Statement 1 is true, but statement 2 is false

In the spiral staircase analogy of DNA structure, each railing represents a _____ and each step represents a _____. (Hint: The book uses this analogy.) Question options: Sugar-phosphate backbone; Pair of bases Base; The sugar-phosphate backbone of the DNA molecule Sugar-phosphate backbone; Base

Sugar-phosphate backbone; Pair of bases

Which group helps in stabilization of protein structure by forming covalent cross-links? (Hint: Recall the fried eggs example from the lecture notes) Sulfhydryl Hydroxyl Carboxyl Amino

Sulfhydryl

Which of the following is not one of the five 'official' parts of an amino acid? Question options: The R group The amino group The carboxyl group The carbonyl group

The carbonyl group

What is true about the concentrations of purines and pyrimidines in DNA structure? (Hint: Think about the rules of base pairing.) Question options: DNA always has more purines than pyrimidines because purines have 2 rings, and subsequently can form more hydrogen bonds. The concentration of purines and pyrimidines depends on the width of the DNA double helix at a given point. The concentration of purines is the same as the concentrations of pyrimidines.

The concentration of purines is the same as the concentrations of pyrimidines.

Which of the following is true about the structure of a double-stranded DNA molecule? Question options: The nitrogenous bases in one strand are held to the nitrogenous bases of the other strand by phosphodiester bonds. The diameter of a DNA molecule is the same along its entire length due to the specific complementary base pairing of the DNA nucleotide The nucleotides in a single strand of DNA are held together by hydrogen bonds Purine nucleotides (A & G) always form base pairs with other purines, and pyrimidine nucleotides (C & T) always form base pairs with other pyrimidines.

The diameter of a DNA molecule is the same along its entire length due to the specific complementary base pairing of the DNA nucleotide

A burn caused by boiling water causes proteins inside your cells to lose their functions. Explain why the high temperature causes this to happen. Question options: The increased temperature disrupts covalent bonds such as peptide bonds, which causes the proteins to lose their primary structures and abilities to catalyze reactions. The increased temperature disrupts covalent bonds such as peptide bonds, which causes the proteins to lose their tertiary structures and abilities to bind specific molecules. The increased temperature disrupts weak interactions such as hydrogen bonding, which causes the proteins to lose their primary structures and abilities to catalyze reactions. The increased temperature disrupts weak interactions such as hydrogen bonding, which causes the proteins to lose their tertiary structures and abilities to bind specific molecules.

The increased temperature disrupts weak interactions such as hydrogen bonding, which causes the proteins to lose their tertiary structures and abilities to bind specific molecules.

A woman's doctor tells her to gargle with salt water. She stirs a tablespoon of salt into a cup of warm water and watches the salt dissolve. Why does the salt dissolve in water? The partial positive charges on hydrogen atoms in water molecules are attracted to sodium ions, and the partial negative charges on oxygen atoms in water molecules are attracted to chlorine ions. The partial positive charges on hydrogen atoms in water molecules are attracted to sodium ions. The partial negative charges on oxygen atoms in water molecules are attracted to chlorine ions. The partial positive charges on hydrogen atoms in water molecules are attracted to chlorine ions, and the partial negative charges on oxygen atoms in water molecules are attracted to sodium ions. The partial negative charges on chlorine atoms are attracted to positive charges on hydrogen atoms in water molecules.

The partial positive charges on hydrogen atoms in water molecules are attracted to chlorine ions, and the partial negative charges on oxygen atoms in water molecules are attracted to sodium ions.

Why are prime symbols used in the numbering of carbons in the sugars of nucleotides? Question options: None of the other answers are correct. To differentiate between each carbon To differentiate between the atoms of sugars and nitrogenous bases To differentiate between DNA and RNA carbon atoms

To differentiate between the atoms of sugars and nitrogenous bases

Which statement about transcription and translation in eukaryotes is correct? Question options: Transcription occurs in the nucleus and translation happens in the cytosol. Both transcription and translation occur in nucleus. Both transcription and translation occur in cytosol. RNA processing occurs in cytosol.

Transcription occurs in the nucleus and translation happens in the cytosol.

Which of the following occur(s) in the cytoplasm of eukaryotic cells? (Select all of the correct answers.) Question options: Translation Protein synthesis Transcription RNA processing

Translation Protein synthesis

Which one of the following is NOT a component of an amino acid? Question options: Carboxyl group Triphosphate group R group Amino group Central carbon

Triphosphate group

Amino acids with hydrophobic R groups are most often found buried in the interior of folded proteins. Question options:TrueFalse

True

During a dehydration reaction, the molecules undergoing the reaction lose a water molecule and cells gain a water molecule. Question options:TrueFalse

True

The individual polypeptide chains in a multi-subunit protein each have their own primary, secondary, and tertiary structure. Question options:TrueFalse

True

The sequence of amino acids in a protein is referred to as its primary structure. Question options:TrueFalse

True

One of your friends is arguing that viruses are "alive." What information would you provide to convince him that viruses are not considered alive, according to most biologists? Viruses need other types of cells to carry out metabolic reactions. Viruses are much more closely related to archaeons compared to bacteria. Viruses always contain either RNA or DNA. Viruses typically have protein coats, which are distinct from plasma membrane.

Viruses need other types of cells to carry out metabolic reactions.

Given the location of a promoter and terminator, be able to determine which strand of DNA is the template and which is the sense strand. Given the location of a promoter and terminator in a double-stranded DNA sequence, be able to write the sequence that will be transcribed.

XX

if given a picture of a nucleotide, be able to label the three main parts. Be able to tell the difference between a purine and pyrimidine at a glance. Be able to tell the difference between a base and a sugar at a glance.

XXX

An atom of iron has 26 protons, 30 neutrons and 28 electrons. What is its charge? a. -2 b. 2 c. -28 d. 54

a

Transcription refers to the process in cells where information from: Question options: an RNA strand is used to synthesize a protein. a protein is used to synthesize RNA. a DNA strand is used to synthesize RNA. an RNA strand is used to synthesize DNA.

a DNA strand is used to synthesize RNA.

Which choice is an example of a hydrogen bond? The bond that forms between: a hydrogen and oxygen atom within the same water molecule. two oxygen atoms within different water molecules. a hydrogen atom in one water molecule and an oxygen atom in another water molecule. two hydrogen atoms within the same water molecule. two hydrogen atoms within different water molecules.

a hydrogen atom in one water molecule and an oxygen atom in another water molecule.

Imagine that a scientist is able to isolate a single, intact nerve cell from a human cadaver. How large could this cell be? a hundred microns a meter a thousand microns ten microns a single micron

a meter

Which one of the following does NOT possess the ability to synthesize its own proteins? a human cell a virus a bacterial cell

a virus

What does lipid mean? Are lipids polymers? What is the difference between a sugar and a carbohydrate? What are the monomers called in nucleic acids? What are the monomers called in proteins? What are the five parts of an amino acid? Which parts of an amino acid are the same in all, which part is different? What happens during a dehydration reaction?

does not dissolve in water, soluble in non polar solvents no bc they dont have repeating structure sugar is monomer carbs are polymers nucleotide central carbon, carboxyl, r group, amino group, a hydrogen r groups are the only thing that change water is lost from h and oh

What is a proton? What is a neutron? What is an electron? How do you calculate atomic mass? How do you calculate the charge of an atom? What is an isotope? Where are protons, neutrons and electrons each found?

large mass and plus charge that defines element (atomic #) large mass with no charge, determines isotope of element small mass and minus charge (p-e=charge) n+p= atomic mass the variants of elements that have the same # of protons and electrons, but a different number of neutrons. ex: carbon-14, carbon-13, and carbon-12 are all isotopes of carbon. Protons and neutrons are in the center of the atom, making up the nucleus. Electrons surround the nucleus in orbitals and shells.

The unique properties of water are due to the _____ of water molecules and the ability of water to form _____ with other water molecules and with other polar molecules. polarity; polar covalent bonds electronegativity; polar covalent bonds polarity; hydrogen bonds hydrophobicity; hydrogen bonds

polarity; hydrogen bonds

The first cells were: prokaryotes. multicellular forms. None of the other answer options is correct. eukaryotes. viruses.

prokaryotes.

Transcription starts at the ________ and ends at the _________ Question options: 5' cap; terminator. promoter; terminator. 3' end; 5' end. promoter; 5' end.

promoter; terminator.

Which of the following CORRECTLY pairs the particles of an atom with their physical properties? proton-negatively charged; neutron-uncharged; electron-positively charged proton-positively charged; neutron-uncharged; electron-negatively charged proton-uncharged; neutron-negatively charged; electron-positively charged proton-positively charged; neutron-negatively charged; electron-uncharged

proton-positively charged; neutron-uncharged; electron-negatively charged

What is an isotope? What are orbitals? What are shells? How many electrons go in each of the first three shells? What are valence electrons? How are covalent bonds formed? What do Lewis Structures show? What are the strongest and weakest bond types? How does electronegativity relate to polar covalent, non-polar covalent and ionic bonds? How does electronegativity relate to hydrogen bonds and hydrophobic interactions?!!!!!!

same atomic number and position in the periodic table but with different atomic masses and physical properties. indicate where electrons have a high probability of being localized Electrons reside in shells with different energy levels: K, L, M The first 3 shells are filled by 2, 8, and 8 electrons. The outermost shell consists of the valence electrons. outside electrons that interact with other electrons Covalent bonds occur when atoms share valence electrons, when the difference between the electronegativities of two atoms is too small solid lines/covalent bonds and valence electrons Covalent Hydrogen Hydrophobic van der Waals A large ^EN leads to ionic bonds Very small ^EN: nonpolar covalent bonds Medium ^EN : polar covalent bonds.

In prokaryotes, do transcription and translation occur at the same time or sequentially? What do the letters M, D, and T stand for in nucleotides? What is the difference between ATP and ADP? What type of bond links nucleotides in a single strand of RNA or DNA? What is a single strand of DNA? Are phosphodiester bonds very stable? Do DNA strands have a polarity? Is a phosphate or hydroxyl group found at the 5' end of DNA? What is located at the 3' end?

same time 1,2,3 Triphosphate vs Diphosphate Phosphodiester Bond base, sugar, nucleotide monomers very stable yes phosphate hydroxyl

When a peptide bond is created between two amino acids: Question options: the amino group of the first amino acid is joined to the amino group of the second. the carboxyl group of the first amino acid is joined to the amino group of the second. the amino group of the first amino acid is joined to the carboxyl group of the second. the carboxyl group of the first amino acid is joined to the carboxyl group of the second

the carboxyl group of the first amino acid is joined to the amino group of the second.

Which of the following is NOT a key feature of individual cells: the ability to store and transit information using nucleic acids. the presence of a plasma membrane. the ability to harvest and transform energy from the environment. the presence of a nucleus.

the presence of a nucleus.

In prokaryotes, the messenger RNA consists of the: Question options: primary RNA transcript with a cap added and introns removed. primary RNA transcript plus a 5' cap. unprocessed primary RNA transcript. primary RNA transcript with a cap added, introns removed, and a poly (A) sequence at the end.

unprocessed primary RNA transcript.

is water made or broken down in a dehydration reaction? What happens during hydrolysis? What type of bond is made in a dehydration reaction involving amino acids? What are the partial charges on C, O, N, and H in a peptide bond?What are the primary functions of DNA and RNA? What are the three parts of a nucleotide? What is the defining difference between DNA and RNA? Why is ribose more reactive than deoxyribose?

water is made water is put in then broken water is lost when peptide bonds are made X dna stores info rna carries info nitrogenous base, phosphate group, 5 carbon sugar deoxyribose vs ribose (different sugar) the hydroxl group makes it more reactive

•Are the atoms in peptide bonds or R-groups involved in the formation of tertiary structure? •If a single poly-peptide forms a functional protein, does the protein have a quaternary structure? •What is the minimum number of polypeptides needed to form a quaternary structure? •In sum, what are the types of interactions that underlie each level of protein structure? •What is denaturation? •What can cause denaturation? •What happens to protein function when it is denatured?

yes no tertiary two or more polypeptides hydrophobic interactions, ionic bonding, hydrogen bonding and disulfide unfolding of protein temp rising, nonpolar solvents, high or low ph does not function

Does the 5' to 3' sequence of an RNA transcript match the 5' to 3' sequence of the sense strand? Where is transcription initiated? Do promoters provide information to RNA polymerase in terms of which direction to go? Where does transcription stop? Can both strands of DNA be transcribed? Do different cells transcribe different genes?

yes! promoter The promoter 'tells' RNA polymerase where to start and which direction to go. yes terminator yes Most genes are transcribed only in certain times, conditions, or cell types.