Final exam 2

अब Quizwiz के साथ अपने होमवर्क और परीक्षाओं को एस करें!

(a) In the deformed mice, somatic cells were mutated.

A pregnant mouse is exposed to high levels of a chemical. Many of the mice in her litter are deformed, but when they are interbred with each other, all their offspring are normal. Which of the following statements could explain these results? (a) In the deformed mice, somatic cells were mutated. (b) The maternal mouse's somatic cells were mutated. In the deformed mice, germ cells were mutated. The maternal mouse's germ cells were mutated.

polymerase

Catalyzes the synthesis of DNA polymerase nuclease kinase phosphatase ligase

Gene A and gene B can be transcribed at different rates, producing different amounts of RNA within same cell

Consider two genes, gene A and gene B (picture)

the DNA mismatch repair system

Copying errors that slip by the replication machinery can be corrected by: DNA ligase. DNA maintenance methyltransferase. DNA telomerase. RNA polymerase. the DNA mismatch repair system

DNA mitosis histones nucleosomes less

Each chromosome is a single ___ compacted during ____. This is accomplished by DNA binding to ______ that package DNA. ________ basic unit structure of eukaroyotic chromatin genes transcribed are packaged in a ____ condensed form of chromatin

B.False

Feedback inhibition is defined as a mechanism of inhibiting an enzyme late in a metabolic pathway by the accumulation of the pathway's product. A.True B.False

transcription and translantion

Gene expression replication transcription transcription and translantion translation

It binds to a second site, causing a conformational change in the enzyme that makes the active site less accommodating to the substrate.

How does an allosteric inhibitor work? It binds to a second site, causing a conformational change in the enzyme that forces the product to leave the active site. It binds to a second site, causing a conformational change in the enzyme that makes the active site less accommodating to the substrate. It binds to the active site, preventing substrate molecules from binding there. It interacts with the substrate, preventing it from fitting into the enzyme's active site. It outcompetes the substrate molecule.

B. The addition of a phosphate group can induce major conformational changes in a protein.

How does phosphorylation control protein activity? A. The addition of a phosphate group adds energy to a protein. B. The addition of a phosphate group can induce major conformational changes in a protein. C. The phosphate group promotes the binding of negatively charged ionic molecules.

3

How many nucleotides are for a single amino acid? 4 2 1 3

nuclease

Hydrolyzes bonds between nucleotides nuclease kinase phosphatase ligase polymerase

C. Methionine

In eukaryotes, the initiator tRNA always carries which amino acid? A. Glycine B. Alanine C. Methionine D. Lysine

D. DNA was found to contain only four chemical building blocks.

In the 1940s, proteins were thought to be the most likely candidate for genetic material. What is the primary reason that DNA wasn't the prime candidate? A. DNA has a high density of negative charges. B. Nucleotides were known to be a source of chemical energy for the cell. C. Both proteins and DNA were found to be components of chromosomes. D. DNA was found to contain only four chemical building blocks.

RNA splicing in the nucleus.

Introns are removed by: intronase. RNA polymerase III. RNA splicing in the cytosol. RNA splicing in the nucleus. RNAse.

Separates proteins based on pH at which the protein has no charge

Isoelectric focusing Separates preteins based on their molecular weight Separates proteins based on pH at which the protein has no charge reveals a protein's 3D structure

ligase

Joins two ends of DNA together kinase phosphatase nuclease ligase polymerase

C. Ubiquitin

Proteasomes act primarily on proteins that have been marked for destruction by the covalent attachment of which small protein? A. Protease B. Histone C. Ubiquitin D. Termination factor

primase

Puts a short strip of RNA to initiate transcription primase primer RNA polymerase

post-translation modification

RNA processing does NOT include: polyadenylation splicing post-translation modification G-capping G-capping

phosphatase

Removes phosphate nuclease kinase phosphatase ligase polymerase

Replication origins are rich in A and T nucleotides.

Replication origins typically consist of a small stretch of duplex DNA that is relatively easy to pry apart. Which statement is true? Replication origins are rich in A and T nucleotides. Replication origins are rich in G and C nucleotides. Replication origins are rich in G and T nucleotides. Replication origins contain multiple repeats of the nucleotide sequence TTAGGG. Replication origins have equal numbers of A, C, G, and T nucleotides.

Separates preteins based on their molecular weight

SDS-polyacrylamide gel electrophoresis (PAGE) Separates preteins based on their molecular weight Separates proteins based on pH at which the protein has no charge reveals a protein's 3D structure

True

Some antibodies disrupt bacterial, but not eukaryotic protein synthesis True False

True

Some genes do not encode proteins, but instead encode functional RNA. False True

d.The leading strand doubles back on itself to form a primer for the lagging strand.

Telomeres serve as caps at the ends of linear chromosomes. Which of the following is not true regarding the replication of telomeric sequences? a. The lagging-strand telomeres are not completely replicated by DNA polymerase b. Telomeres are made of repeating sequences c. Additional repeated sequences are added to the template strand d.The leading strand doubles back on itself to form a primer for the lagging strand.

(c) During their developmental history, fibroblasts have accumulated some transcriptional regulators in common with differentiating muscle cells.

The MyoD transcriptional regulator is normally found in differentiating muscle cells and participates in the transcription of genes that produce muscle-specific proteins, such as those needed in contractile tissue. Amazingly, expression of MyoD in fibroblasts causes these cells derived from skin connective tissue to produce proteins normally only seen in muscles. However, some other cell types do not transcribe muscle-specific genes when MyoD is expressed in them. Which of the following statements below is the best explanation of why MyoD can cause fibroblasts to express muscle-specific genes? (a) Unlike some other cell types, fibroblasts have not lost the muscle-specific genes from their genome. (b) The muscle-specific genes must be in heterochromatin in fibroblasts. (c) During their developmental history, fibroblasts have accumulated some transcriptional regulators in common with differentiating muscle cells. (d) The presence of MyoD is sufficient to activate the transcription of muscle-specific genes in all cell types.

The TATA box

The assembly of general transcription factors at a eukaryotic promoter typically begins at what site? The GAGA box The TATA box The TFIID sequence The sigma site The start codon

(a) linker histones

The classic "beads-on-a-string" structure is the most decondensed chromatin structure possible. Which chromatin components are not retained when this structure is generated? (a) linker histones (b) linker DNA (c) nucleosome core particles (d) core histones

(c) The catalytic site for peptide bond formation is formed primarily from an rRNA

The ribosome is important for catalyzing the formation of peptide bonds. Which of the following statements is true ? (a) Amino acyl tRNA synthetase enzymes are a component of the large ribosomal subunit. (b) The large ribosomal subunit is important for binding to the mRNA. (c) The catalytic site for peptide bond formation is formed primarily from an rRNA

telomeres.

The specialized repetitive DNA sequences at the ends of chromosomes are called: centromeres. centrosomes. histones. nucleosomes. telomeres.

siRNAs and miRNAs.

Two types of noncoding regulatory RNAs are: mRNAs and siRNAs. miRNAs and rRNAs. rRNAs and mrRNAs. siRNAs and miRNAs. sirRNAs and mrRNAs.

methionine, serine, alonine

What are the first three amino acids encoded by mRNA? methionine, therine, alonine methionine, alonine, cyctine methionine, serine, alonine

Some codons code for more than one amino acid.

What is FALSE about codons in mRNA? A. Codons in mRNAs bind to complementary anticodons in tRNAs. B. Some codons do not code for amino acids. C. Some codons code for more than one amino acid. D. In some cases, several different codons code for the same amino acid

C. uracil (U)

What is the complementary RNA strand for adenine (A)? A. cytosine (C) B. guanine (G) C. uracil (U) D. thymine (T)

The mRNA will be destroyed by nucleases.

What is the ultimate fate of an mRNA that is targeted by a microRNA (miRNA)? The mRNA will be destroyed by nucleases. The mRNA will be destroyed by the proteasome. The mRNA will be secreted from the cell. The mRNA will be translated more efficiently by ribosomes. The mRNA will be transported to the nucleus.

a. initiation of DNA synthesis

What part of the DNA replication process would be most directly affected if an organism had a mutation that meant it was lacking primase? a. initiation of DNA synthesis b. relief of torsional stress c. leading-strand elongation d. lagging-strand completion

Ligase

What type of enzyme seals the newly added (repaired) DNA to the rest of the DNA molecule? DNase Helicase Ligase Polymerase Sealicase

IEF, SDS-PAGE, mass spectrometry

Whats the correct order of techniques to use to identify from an unknown protein from an extract? IEF, mass spectrometry, SDS-PAGE IEF, SDS-PAGE, mass spectrometry

base pairs

When gene regulatory protein binds to DNA its most important connection is with? nucleotides phospholipids base pairs

c. lysine

Which amino acid would you expect a tRNA with the anticodon 5'-CUU-3' to carry? a. leucine b. phenylalanine c. lysine d. glutamic acid

The inheritance of a single-nucleotide mutation in a gene

Which is NOT an example of epigenetic inheritance? The inheritance of a regulatory protein that activates its own transcription The inheritance of a single-nucleotide mutation in a gene The inheritance of methylation patterns in DNA The inheritance of patterns of chromosome condensation

iPS cells created from mouse cells can differentiate into almost any human cell type

Which is false about iPS? Induced pluripotent embryonic stem cells Generated with different transcription factors by reprogramming of somatic cells iPS cells created from mouse cells can differentiate into almost any human cell type The cells are reprogrammed to behave like embryonic stem cells Have full pluripotency

the replication forks formed at any given origin move in opposite directions

Which of the following correctly explains what it means for DNA replication to be bidirectional. the replication fork can open or close, depending on conditions DNA replication machinery can move in either direction on the template strand replication fork movement can switch directions when it converges on another fork the replication forks formed at any given origin move in opposite directions

Eukaryotic gene activator proteins stimulate transcription initiation by recruiting a DNA polymerase to the promoter.

Which of the following is false? A. Eukaryotic gene activator proteins stimulate transcription initiation byrecruiting proteins that modify chromatin structure. B. Eukaryotic gene activator proteins stimulate transcription initiation by aiding in the assembly of general transcription factors and RNA polymerase at the promoter. C. Eukaryoticgene activator proteins stimulate transcription initiation by recruiting a DNA polymerase to the promoter.

(d) proper segregation of housekeeping proteins when cells divide

Which of the following is not a general mechanism that cells use to maintain stable patterns of gene expression as cells divide? (a) a positive feedback loop, mediated by a transcriptional regulator that activates transcription of its own gene in addition to other cell-type specific genes (b) faithful propagation of condensed chromatin structures as cells divide (c) inheritance of DNA methylation patterns when cells divide (d) proper segregation of housekeeping proteins when cells divide

C. Transcription of a eukaryotic gene can be influenced by proteins that bind to DNA sequences far from the promoter.

Which of the following is the main reason that a typical eukaryotic gene is able to respond to a far greater variety of regulatory signals than a typical prokaryotic gene or operon? A. Eukaryotes have three types of RNA polymerase. B. Eukaryotic RNA polymerases require general transcription factors. C. Transcription of a eukaryotic gene can be influenced by proteins that bind to DNA sequences far from the promoter. D. The protein-coding regions of eukaryotic genes are longer than those of prokaryotic genes. E. Eukaryotic genes are packaged into nucleosomes

C. CAC and CAU

Which of the following pairs of codons might you expect to be read by the same tRNA as a result of wobble? A. CUU and UUU B. GAU and GAA C. CAC and CAU D. AAU and AGU

d. Do any chromosomes contain point mutations?

Which of the following questions would not be answered by using karyotyping? a. Is the individual genetically female or male? b. Do any of the chromosomes contain pieces that belong to other chromosomes? c. Does the individual have an extra chromosome? d. Do any chromosomes contain point mutations?

They contain different genes

Which of the following statements is NOT true about the differences between liver cells and kidney cells in the same organism? They contain different genes. They contain different proteins. They contain the entire set of instructions needed to form the whole organism. They contain the same genes. They express different genes.

A. 5' CCCUAAAAAAAAAAAAAAUUUUUUUUUUUUUUAGGG 3'

Which of the molecules of RNA would be mostly likely to fold into a specific structure as a result of intermolecular base pairing? A. 5' CCCUAAAAAAAAAAAAAAUUUUUUUUUUUUUUAGGG 3' B. 5' UGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUGUG 3' C. 5' AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 3' D. 5' GGAAAAGGAGAUGGGCAGGAAUGAGAGUUGGAAGGG 3'

only one strand of a DNA helix per chromosome serves as template

Which of these is FALSE of transcription? DNA is always the template uses ribonucleotides as substrates RNA polymerase catalyzes transcription only one strand of a DNA helix per chromosome serves as template

E) there is only one DNA polymerase

Which of these statements is FALSE about replication? incoming dNTPs are a substrate for DNA polymerase parental strands are the template for replication C) incoming dNTPs are the energy source for replication D) replication occurs in the nucleus E) there is only one DNA polymerase

C. N-terminus

Which part of a protein is synthesized by a ribosome first? A. C-terminus B. Promoter C. N-terminus D. Start codon

Histone proteins have a high proportion of positively charged amino acids, which bind tightly to the negatively charged DNA backbone.

Which statement is true about the association of histone proteins and DNA? Each histone protein has a deep groove into which a DNA double helix tightly fits. Histone proteins form hydrogen bonds with the nucleotide bases of DNA. Histone proteins have a high proportion of negatively charged amino acids, which bind tightly to the positively charged DNA backbone. Histone proteins have a high proportion of positively charged amino acids, which bind tightly to the negatively charged DNA backbone. Histone proteins insert themselves into the major groove of DNA.

base pairing

Why two complementary strands of DNA hybridize? antiparallel base pairing

reveals a protein's 3D structure

X-ray crystallography Separates proteins based on pH at which the protein has no charge reveals a protein's 3D structure Separates preteins based on their molecular weight

stop codon are recognized by one tRNA

which is false? A. the genetic code contains three stop codons B. stop codon are recognized by one tRNA C. release factors bind to stop codons in the mRNA

C. cell division

which of the following is not a mechanism to maintain cell memory? A. Memory T cells B. B cells C. Cell division

(c) Double-stranded genomes have equal amounts of A and T

(c) Double-stranded genomes have equal amounts of A and T You are a virologist studying the evolution of viral genomes. You are studying a newly isolated viral strain and have sequenced its genome. You find that the genome contains 25% A, 45% G, 20% C, and 10% T. You report that you have isolated a virus with a single-stranded DNA genome. Based on what evidence can you make this conclusion? (a) single-stranded genomes always have a large percentage of purines (b) using the formula: G - A = C + T (c) Double-stranded genomes have equal amounts of A and T (d) Single-stranded genomes have a higher rate of mutation

kinase

Adds phosphate groups to molecules nuclease kinase ligase phosphatase polymerase

A. one gene to code for multiple proteins

Alternative splicing A. one gene to code for multiple proteins B. exon found in only certain types of spliced RNA C. can code for a protein D. a continuous stretch of codons that doesn't have a stop codon.

c) using the energy of ATP hydrolysis to move nucleosomes.

Although the chromatin structure of interphase and mitotic chromosomes is very compact, DNA-binding proteins and protein complexes must be able to gain access to the DNA molecule. Chromatin-remodeling complexes provide this access by __________________. a) recruiting other enzymes. b) modifying the N-terminal tails of core histones. c) using the energy of ATP hydrolysis to move nucleosomes. d) denaturing the DNA by interfering with hydrogen-bonding between base pairs

aminoacyl tRNA synthetase

Amino acids are attracted to their tRNA molecules by A. particular tRNA B. attached amino acid C. aminoacyl tRNA synthetase

5' to 3' direction

DNA synthesis proceeds in the 5' to 3' direction 3' to 5' direction

chromatin.

The complex of DNA and proteins that makes up a eukaryotic chromosome is: a centromere. a centrosome. chromatin. a histone. a nucleosome.

c) It binds to DNA in a sequence-specific manner.

The core histones are small, basic proteins that have a globular domain at the C- terminus and a long, extended conformation at the N-terminus. Which of the following is not true of the N-terminal "tail" of these histones? Select one: a) It is subject to covalent modifications. b) It extends out of the nucleosome core. c) It binds to DNA in a sequence-specific manner. d) It helps DNA pack tightly.

True

The effect of a single transcription regulator can still be decisive in switching any particular gene on or off. False True

d. 46

The human genome is divided into linear segments and packaged into structures called chromosomes. What is the total number of chromosomes found in each of the somatic cells in your body? a. 22 b. 23 c. 44 d. 46

promoter

The initiation site for transcription is: promoter start codon origin enhancer euchromatin

A. there are seven regulatory elements and each element is sufficient for driving expression in a single stripe.

The modular nature of the Eve gene's regulatory region means that ______. A. there are seven regulatory elements and each element is sufficient for driving expression in a single stripe. B. all the regulatory elements for each stripe use the same transcriptional activators. C. the E. coli LacZ gene is normally only expressed in a single stripe—unlike Eve, which is expressed in seven stripes. D. transcription activators only bind to the stripe 2 regulatory DNA segment in stripe 2.

(c) template

The process of DNA replication requires that each of the parental DNA strands be used as a ________ to produce a duplicate of the opposing strand. (a) catalyst (b) competitor (c) template (d) copy

D. Nucleotide polymerization occurs only in the 5' to 3' direction

Transcription is similar to DNA replication in that A. an RNA transcript is synthesized discontinuously and then pieces are then joined together B. it uses the exact enzyme as that to synthesize RNA primers during DNA replication C. the newly synthesized RNA remains paired to the template DNA D. Nucleotide polymerization occurs only in the 5' to 3' direction


संबंधित स्टडी सेट्स

Chapter 6: Internal Control and Risk Management

View Set

Saunders Leadership/ Management/ Delegating/ Prioritizing Questions

View Set

Customer Information, Risk and Suitability, Product Information

View Set

Course 5 Module 6. Investment Considerations for Retirement Plans

View Set

CHAPTER 10 ASSESSMENT - CONCEPTS

View Set

QUIZ 1: STOICHIOMETRY TO VALENCES

View Set

Ch 28 - Relationship of Principal & Agent - Week 5 (E2)

View Set

Chapter 31 - Lymphatic System (Elsevier Quiz Questions)

View Set

Chapter 11: Completing the Audit

View Set