Gen Bio chp 14 Biotechnology and Genomics

In what field of study would scientists predict a protein's three-dimensional shape and how DNA mutations would affect protein function?

bioinformatics proteomics genomics

When bone marrow stem cells are removed from the patient, infected with a virus that carries a normal gene, and returned to the patient, this is an example of

ex vivo gene therapy.

DNA _______ have microscopic amounts of DNA sequences on a glass slide, which allow visualization of which genes are turned on in specific cells.

microarrays

Which of the following is mismatched?

polymerase chain reaction—process that separates DNA fragments according to size

If a segment of non-coding DNA contained a sequence TTAGTTTAGTTTAGT, you would call this a(n) _________ repeat.

tandem

All of the following are true regarding transgenic animals EXCEPT

the process has been used to develop organisms that are partially animal and partially plant.

Which answer would be an example of unique noncoding DNA?

ATCGAAATTCGGGCTACCAAC

All of the following statements about genes and copy number variations are true EXCEPT

All of the answer choices are true (an individual's genome often contains multiple copies of a gene, individuals may differ as to the number of copies of a particular gene, and copy number variations have been associated with specific diseases).

A new form of genome editing called _______ is being researched to allow pigs to grow additional organs for human transplants.

CRISPR

Under which of the following circumstances would a DNA microarray be useful?

Researchers are trying to determine if an individual has inherited a genetic disease from their parents. It would enable doctors to determine which genes are responsible for producing diseased tissue in an individual. It would enable a researcher to determine the differences in gene expression between cell types.

Classify the following descriptions based on what type of therapy is described. In Vivo Gene Therapy: Ex Vivo Gene Therapy:

In Vivo Gene Therapy: *genes are inserted directly into body cells while they are still in the body *gene transfer by aerosol spray *gene transfer by injection Ex Vivo Gene Therapy: *gene transfer by modified organ implants *gene transfer by modified blood cells *bone marrow is harvested, treated, and returned *body cells are removed, genes inserted, and then body cells are returned to the body

________ interference is when small pieces of RNA are used to silence the expression of specific alleles.

RNA

Place the steps involved in creating genetically modified organisms (GMO) in sequential order based on the image provided.

1. A gene of interest is excised by restriction enzymes 2. A plasmid from bacteria is cut open with restriction 3. The gene is inserted into the plasmid where is is "glued" in place by DNA ligase enzyme to create recombinant DNA 4. Recombinant DNA is added back into the bacteria through chemical or electrical means 5. The bacteria reproduce and the gene of interest is cloned so that multiple copies are made 6. The gene product is harvested or extracted

Place the steps in ex vivo gene therapy for familial hypercholesterolemia in the correct order. Begin with the first step at the top.

1. A portion of the patient's liver is removed 2. Liver cells are infected with virus carrying normal gene 3. Removed liver portion is reconnected in the patient's body

Arrange the steps used to clone a mammal from beginning to end.

1. An egg is collected from a donor and enucleated 2. Inject nucleus of somatic cell from different donor into enucleated egg 3. The donor egg is induced to start dividing 4. The dividing egg is implanted into a surrogate 5. A clone (of the DNA donor) is born.

Match the parts of the eukaryotic DNA with its function. Exon: Intron: Intergenic sequences:

Exon: regions of a gene that will eventually become translated into proteins Intron: regions of a gene that will be excised after transcription Intergenic sequences: regions of the genome located between genes

How is RNA interference (RNAi) used as a form of gene therapy?

Small pieces of RNAi are used to silence the expression of specific alleles.

What is the function of naturally occurring restriction enzymes in bacterial cells?

They cut any viral DNA that enters the cell.

The proteome is ______.

all of a species' proteins

If you were looking for another polymerase like the Taq polymerase used in PCR, you might look in a bacterium living where?

hot vents

Cloning is the production of genetically _______ copies of DNA, cells or organisms by asexual means.

identical

To carry out a polymerase chain reaction (PCR), you must have DNA polymerase and

the nucleotides to synthesize new DNA strands.

Gene pharming is the use of

transgenic farm animals to produce pharmaceuticals.

Plants have been genetically engineered for all of the following reasons EXCEPT

(All of the choices are correct) to have a higher vitamin A content. to make the plant more resistant to pests. to produce human proteins. to reduce food spoilage.

What consequences could arise if the field of bioinformatics ceased to exist as a field of study?

*Many cures for genetic disorders would not be discovered. *Progress in determining the function of DNA sequences, making comparisons between our genome and other model organisms, and understanding how genes and proteins interact with cells would stop. *The creation of new transgenic plants, animals, and bacteria that benefit society would not occur.

Which of the following are applications of transgenic bacteria?

*clean up of oil spills *production of insulin *production of growth hormone

Choose the characteristics of the structure of eukaryotic chromosomes.

*genes are fragmented into exons and introns *genes are randomly distributed *more complex than prokaryotic chromosomes

Select the benefits of using genetically modified plants?

*herbicide resistant crops *increased crop yields *pest resistant crops *production of human proteins

What is the first step in producing a transgenic animal?

inject the desired gene(s) into a donor egg

The function of a vector in genetic engineering is to

introduce rDNA into a host cell.

DNA ______ is an enzyme that links DNA fragments together.

ligase

This method utilizes two other biotechnological procedures, __________ to create copies of DNA segments, and ____________ to separate and visualize the DNA segments.

polymerase chain reaction gel electrophoresis

The _____________ creates copies of small sections of DNA called ____________ .

polymerase chain reaction short tandem repeats (STRs)

The copied __________ are then loaded into a gel to _________ them by size.

short tandem repeats (STRs) separate

Transposons are ______.

specific regions of DNA that can move in and between chromosomes

Transgenic plant products include all of the following EXCEPT

suicide genes that cause the plants to self-destruct after their product has been produced.

DNA microarrays are used to study patterns of gene expression.

true

Which of the following explain why we need a broader definition of gene?

*genes can be split across several loci across the genome *the end product of some DNA is RNA (not protein) *some prokaryotes have RNA genes

Genomics seeks to determine ________.

*how many genes we have *the sequence of the bases in DNA

Human gene therapy

*includes the insertion of genetic material into human cells for the treatment of a genetic disease. *has been used for treatment of children who have severe combined immunodeficiency. *has been used in a trial to treat familial hypercholesterolemia.

Select the choices that may refer to a plasmid.

*prokaryotic DNA *vector

Click on all of the following applications that are possible through the science of genomics.

*sequence the human genome *determine the genes associated with cancer *determine the evolutionary lineage of humans and organisms *determine the number of genes in humans and other organisms *determine drug effectiveness based on genomic differences *apply bioinformatics to determine how an individual's genetic makeup affects their predisposition for disease *determine the function of noncoding regions of DNA *sequence the genomes of other organisms

List the sequential order of events in ex vivo gene therapy of the disease SCID.

1. Bone marrow is removed from the patient's body 2. Bone marrow cells are injected with a virus carrying a corrected gene 3. Bone marrow cells are injected into the patient 4. Normal bone marrow cells divide to produce normal blood cells

It is estimated that humans have approximately _____ base pairs in our genome.

3 billion

PCR is a technique used to create copies of a segment of _______ quickly in a test tube.

DNA

During the first step of a PCR reaction,

DNA is heated to break the hydrogen bonds that hold the two strands together.

Figuring out a person's genetic profile is greatly enhanced with the use of _______ technology.

DNA microarray

A DNA chip that contains rows of DNA sequences for mutations that indicate the presence of particular genetic disorders is representative of what type of biotechnology?

DNA microarrays

______ engineering is a modern field that allows scientists to change genomes, this can be to create biotechnology products or change the organism's characteristics.

Genetic

Biotechnology products produced by bacteria include all of the following EXCEPT

antibodies to deliver radioisotopes to tumor cells.

Ex-vivo gene therapy removes _______ from the body, genetically modifies them, and then reinserts them.

cells

Comparative genomics _________.

compares the human genome with the genome of other organisms

A transgenic organism

contains a foreign gene within its genome.

Gene therapy in humans has been used to treat

cystic fibrosis. cancer. inborn errors of metabolism.

During PCR, the hydrogen bonds of the double-stranded DNA molecules are broken by the enzyme helicase.

false

Restriction enzymes cut only at specific sites and therefore are not useful for genetic engineering.

false

True or false: Gene cloning refers to cloning of whole organisms.

false

A technology that can identify and distinguish among individuals based on variation of DNA is called DNA __________.

fingerprinting

One method of identifying an individual's DNA is by using DNA _______.

fingerprinting

The introduction of normal genes into an afflicted individual for therapeutic use is called

gene therapy

Functional genomics tries to understand the exact role of the _______ in cells or organisms.

genes

In vivo gene therapy delivers the ________ directly into the body or cells.

genes

Biotechnology products are produced by ________ modified organisms.

genetically

Leber congenital amaurosis (LCA) is a disorder characterized by early-onset retinal dystrophy which causes severe visual impairment beginning in infancy. The most common cause of the disorder is a mutated intron located in gene CEP290. Targeted deletion of the mutated intron shows promise as a treatment for LCA. The treatment of LCA is an example of the application of which of the following types of biotechnology?

genome editing

A scientist seeking to study the complete genetic makeup of an organism is studying in the field of _______.

genomics

The sizes of segments are compared with other samples for ___________.

identification

The function of the polymerase chain reaction in genetic engineering is to

make multiple copies of a specific segment of DNA.

Gene _________ describes the production of pharmaceuticals using transgenic animals.

pharming

Human DNA cut with some restriction enzyme A can be joined to

plasmid DNA cut with restriction enzyme A.

Which of the following molecules forms lengths of DNA with "sticky ends"?

restriction enzyme

The function of DNA ligase in recombinant technology is to

seal DNA into an opening created by restriction enzymes.

True or false: Modern science has been able to successfully clone a mammal.

true

List the sequential order of events that occur during the production of recombinant DNA (rDNA).

1. Identify an mRNA from a target gene 2. use reverse transcriptase to produce a complementary DNA 3. cleave the cDNA and vector DNA with the same restriction enzyme 4. introduce DNA ligase to connect sticky ends of DNA 5. allow vector to reproduce to clone the gene

Place the following steps for cloning DNA in the correct order: 1 - use vector to deliver new rDNA to bacterial or other cells 2 - use restriction enzymes to cut a plasmid and add the desired gene 3 - isolate and cut out a desired gene using restriction enzymes 4 - use DNA ligase to seal the new gene 5 - allow bacterial cells to replicate and produce desired product

3, 2, 4, 1, 5