Genetics exam 2
Describe the structure of RNA polymerase in bacteria. What is the core enzyme and what is the role of sigma factor?
Bacterial RNA polymerase is a complex, large molecule composed of a core enzyme with five subunits, two copies of alpha and single copies of beta & beta prime and sigma factor. There is another subunit called omega subunit; which helps in stabilizing the enzyme (not directly involved in transcription). Sigma factor controls the binding of RNA polymerase to the promoter region and initiation of synthesis. After few RNA nucleotides are added, sigma usually gets detached from the promoter.
State the differences between pro- and eukaryotic chromosomes.
Bacterial: ribosome size- 70s subunit- large (50s), small (30s) rRNA component (23s: 2904 nucleotides, 5s: 120 nt, 16s: 1541 nt) proteins: 31, 21 eurkaryotic: ribosome size - 80s subunit- large (60s), small (40s) rRNA component: 28s: 4718 nt; 5.8s: 160 nt; 5s: 120 nt; 18s: 1874 nt Proteins: 49, 33
Some restriction endonucleases produce 'sticky' ends. What makes an end sticky?
single-stranded complementary tails
How does super-coiling arise? What is the difference between positive and negative super coiling?
supercoiling arises from overwinding (positive supercoiling) or underwinding (negative supercoiling) the DNA double helix when the DNA molecule does not have free ends, as in circular ds DNA or when the ends of the linear DNA molecule are bound to proteins that prevent them from rotating around each other.
Reverse transcriptase is an enzyme found in association with retroviral activity. It has the property of
synthesis of DNA from an RNA template
Structures located at the ends of the eukaryotic chromosomes are called
telomeres
Draw and label a typical bacterial promoter. Include any common consensus sequences.
1) 3'-...Upstream element....TTGACA............TATAAT........................-5' (Transcription start site) (-40 to -60) (-35 region) (- 10 region)
A synthetic mRNA added to a cell-free protein synthesizing system produces a peptide with the following amino acid sequence; Met-Pro-Ile-Ser-Ala. What would be the effect on translation if the following components were omitted from the system? Explain your reasoning. A) IF 1, B) EF-Tu, C) ATP, D) IF 2, E) GTP
1) A) Lack of IF 1 would decrease the amount of protein synthesis. IF 1 stabilizes the 30S subunit of the ribosome during initiation. In the absence of it, translation would happen but less efficiently or at a slower rate. B) EF-Tu binds to GTP and the charged tRNA and is required for elongation. In its absence, the charged tRNA will not enter the A site, thus translation would stop. C) ATP is required for tRNAs to be charged with amino acids by aminoacyl-tRNA synthetase. Without ATP, there will be no amino acids available for protein synthesis D) IF-2 is required for initiation of translation.The lack of it would prevent the fmet-tRNA from being delivered to the small ribosomal subunit, thus blocking translation. E) GTP is required for initiation, elongation and termination. No GTP, no protein synthesis.
What are the different steps involved in the charging of tRNA?
1) Amino acid is converted to aminoacyladenylic acid after being activated by ATP. A covalent bond forms between the 5' phosphate group of ATP and the carboxyl end of the amino acid. This reaction is mediated by the synthetase enzyme. 2) Amino acid covalently binds to the 3' end of the tRNA. 3) The enzyme complex separates leaving the charged tRNA with the amino acid.
In a DNA structure, covalently arranged combination of a deoxyribose and a nitrogenous base would be called a
nucleoside
Lampbush chromosome histone linker DNA CEN region VNTR SINE chromosomal puff
oocytes and spermatocytes lysine and arginine H1 Histone Chromosome separation Minisatellites Alu sequence polytene chromosome
Semiconservative replication replicons DNA polymerase II Beta Subunit of DNA poly III Eukaryotic replication Polymerase switching Recombination
original DNA is half conserved units of replication DNA repair functions as a clamp prereplication complex pol delta replaces poly alpha reciprocal exchange between chromosomes
What are telomeres? What are their physiological functions? How the telomere gets replicated?
Telomeres are short tandem repeats of DNA sequence present on both tips of the linear chromosomes. They protect the DNA strands by preventing them from fusing together and getting damaged by endonucleases. Telomeres are replicated by an RNA-containing enzyme, telomerase.
What protein associated with a transcription factor is common to all eukaryotic promoters? What is its function in transcription?
The TATA binding protein (TBP) binds most eukaryotic promoters at the TATA box and positions the active site of RNA polymerase over the transcriptional start site.
Which of the following clusters of terms accurately describes DNA as it is generally viewed to exist in prokaryotes and eukaryotes?
double-stranded, antiparallel, (A + T)/ (G + C) = variable, (A + G)/ (C + T) = 1.0
Taq polymerase, a heat-stable DNA polymerase, is used in PCR, because
each PCR cycle includes a 'hot' (95 degree C) denaturation phase, that separates the hydrogen bonds which hold the strands of DNA together
Which cluster of terms accurately reflects the nature of DNA replication in prokaryotes
fixed point of initiation, bidirectional, semiconservative
List two especially useful characteristics of cloning vector
high copy number and antibiotic-resistance gene
In a southern-blot, one generally
hybridizes filter-bound DNA with a DNA probe
Considering the structure of double-stranded DNA, what kind of bonds hold one complementary strand to the other?
hydrogen
DNA polymerase I adds nucleotides
in place of the primer RNA after it is removed In a 5' to 3' direction
A diploid plant cell consists of 2*10 9 base pairs (bp). If this much of DNA is present as chromatin fibers, where each group of 200 bp of DNA is combined with histones into a nucleosome; a) how many nucleosomes are present in the cell, and b) what is the total number of histone molecules present?
2) A) 2*10^9 / 2* 10^2 = 10^7 nucleosomes B) Each nucleosome contains 9 histone molecules; total number of histones = 9*10^7
What would be the effect on DNA replication of mutations that destroyed each of the following activity in DNA polymerase I? A) 3' to 5' exonuclease activity B) 5' to 3' exonuclease activity C) 5' to 3' polymerase activity
2) A) More errors in replication, B) primers would not be removed; C) primers that have been removed would not be replaced by DNA strand.
The following diagram represents a transcription unit on a DNA molecule. ____________transcription start site__________ ___________________________________________ template strand A) Assume that this is a bacterial DNA. Draw the approximate location of the promoter and terminator for this transcription unit. B) Assume that this is a eukaryotic DNA. Draw the approximate location of the promoters of RNA polymerase II.
2) In eukaryotic DNA; -80 = CAAT box -35 = TATA box + 1 = Start site See homework 13 for image
The basic structure of a nucleotide includes the following components;
nitrogenous base, sugar and phosphate
Which of the following are among the major components of prokaryotic ribosomes?
16S rRNA, 5S rRNA, and 23srRNA
A bacterial protein is 300 amino acids long. Which of the following could be the number of nucleotides in the section of the DNA that codes for this protein? (Remember, DNA is double stranded)
1800
The following amino acid sequence is found in a tripeptide; Met-Trp-His. Give all possible nucleotide sequences on the mRNA, on the template strand, and on the non-template strand of the DNA that encodes this tripeptide.
2) There are two possible sequences; mRNA: 5'-AUGUGGCAU-3' DNA template: 3'- TACACCGTA-5' DNA nontemplate: 5'- ATGTGGCAT-3' mRNA: 5'- AUGUGGCAC- 3' DNA template: 3'- TACACCGTG-5' DNA non-template: 5'- ATGTGGCAC-3'
Assuming that each nucleotide is 0.34 nm long in the mRNA, how many triplet codes can occupy at one time the space in a ribosome that is 20 nm in diameter?
20/ 0.34 = apx. 59 (number of nucleotides) 59/ 3 = apx. 20 (number of triplet codes)
Describe the different types of DNA sequences that exist in eukaryotes
3 different types of DNA sequences exist in eukaryotes; a) Unique-sequence DNA: constitute most of the protein-coding sequences as well as a large number of sequences without any known function. One or a few copies are present per haploid genome. b) Moderately repetitive sequences: ranging from a few hundred to few thousand bp in length. Some consists of functional genes that code for rRNAs and tRNAs, but most is made up of transposable elements. Present in several thousand copies per haploid genome. c) Highly repetitive DNA: consists of clusters of tandem repeats of short sequences, often less than 10 bp in length, present in hundreds of thousands to millions of copies per haploid genome.
If 15% of the nitrogenous bases in a sample of DNA from a particular organism is thymine, what percentage should be cytosine?
35%
Select three post-transcriptional modifications often seen in the maturation of mRNA in eukaryotes.
5'-capping, 3'-poly A tail addition, splicing
What is a cosmid? What are the advantages of using cosmids as vectors?
A cosmid is a plasmid vector with an origin of replication, unique restriction sites and selectable marker genes. It can accommodate large DNA fragments, up to 50 kb in length. It also has the 'lamda cos' site so that the vector can be packaged into a lambda phage particle for efficient delivery into E.coli cells.
In the context of recombinant DNA technology, what is meant by the term 'vector'? What are the three most common ones? Give three characteristics of an ideal vector.
A vector is a vehicle to carry recombinant DNA molecules into the host cells where independent replication can occur. Three common vectors are; plasmid, Lambda phage and cosmid. An ideal vector should have; 1) The capability to replicate inside the host cell 2) Should contain several restriction enzyme sites 3) Should be able to carry a large piece of DNA 4) Should carry a marker gene to identify the cells that have taken up the vector, usually an antibiotic resistant gene is used as a marker.
In a diploid cell in which 2n = 14, how many telomeres are there in each of the following phases of the cell cycle; 1) G1, 2) G2, 3) mitotic prophase and 4) mitotic telophase?
A) 14 chromosomes and 28 telomeres B) After S, each chromosome consists of 2 chromatids and each chromatid has 2 telomeres; for a total of 4 telomeres per chromosome. Total: 56 telomeres C) 56 telomeres D) 28 telomeres
A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the rho subunit. At high temperature, rho is not functional. When these bacteria are raised at elevated temperatures, which of the following effects would you expect to see? a) Transcription does not take place b) All RNA molecules are shorter than normal c) All RNA molecules are longer than normal d) Some RNA molecules are longer than normal e) RNA is copied from both DNA strand Explain your reasoning for accepting or rejecting each of these five options.
A) Because the rho protein is only involved in transcription termination, it should not affect transcription initiation or elongation. B) Without the rho protein, transcription would continue longer, producing longer than normal RNA molecules. Therefore, you don't expect to see RNA molecules that are shorter than normal. C) Only RNA molecules produced from genes that use rho-dependent termination can be longer. Therefore, all RNA molecules will not be longer than normal. D) Correct. Some RNA molecules that have rho-dependent termination would be longer. E) No, because rho-protein has nothing to do with initiation of transcription. RNA would still be copied from a single strand.
What would be the most likely effect of a mutation at the following locations in an E.coli gene? A) - 9, B) - 35, C) - 20, D) Start site
A) Mutation at the -9 position would probably affect the -10 consensus sequence (TATA box), which is centered on the position -10. This sequence is necessary for the binding of RNA polymerase. A mutation there would most likely cause a decrease in transcription. B) A mutation in the -35 region could affect the binding of sigma factor to the promoter. Transcription would probably be reduced or inhibited. C) The -20 region is located between the consensus sequences of an E.coli promoter. A mutation here may not have any effect on transcription. D) A mutation in the start site would have little effect on transcription. The position of start site relative to the promoter is more important than the sequence at the start site.
Define the following terms: A) Secondary structure of protein, B) Polyribosomes, C) Shine-Dalgarno sequence, D) Functional domains (in proteins).
A) Secondary structure: through interaction between neighboring amino acids, the polypeptide chain folds and twists into a secondary structure. Two types of secondary structure; a) alpha helix and b) beta-pleated sheet Alpha helix is a right-handed helix being composed of spiral chain of amino acids stabilized by hydrogen bonds. Beta-pleated sheets have folded polypeptide chains running either in a parallel or anti-parallel fashion against each other. B)Polyribosome: In both pro- and eukaryotic cells, mRNA molecules are translated simultaneously by multiple ribosomes. The resulting structure, an mRNA with several ribosomes attached is called polyribosome. C) SD sequence: In bacteria, the mRNA transcript contains a sequence of about 6 ribonucleotides, all purines (A and G) upstream of the AUG start codon. This sequence is called Shine-Dalgarno sequence and it base-pairs with a sequence of bases found near the 3' end of the 16s rRNA. This base-pairing helps in attachment of mRNA and initiation of translation. D) Functional protein domains: In any protein molecule, specific amino acid sequences are associated with specific functions. These sequences are called the protein domains and are 50-300 aa long. Some proteins contain only one domain and others contain more than one. Usually, different domains confer different functional capabilities.
A) What advantage does pUC18 have in terms of recombinant DNA technology? B) How it is advantageous to have the polylinker region embedded in the lacZ component of these plasmids?
A) Small size, high copy number and polylinker in lacZ gene. B) An insert of DNA in the polylinker region inactivates the lacZ component. Normal lacZ would have given blue color colonies in the presence of X-gal in the medium; whereas inactivated lacZ gives rise to white color colonies. Thus, it helps in identification of the recombinant plasmids.
Consider the following segment of DNA which is to be replicated by DNA pol III and the replication starts from the right; 5'-ATTCGTACGATCGACTGACTGACAGTC-3' 3'-TAAGCATGCTAGCTGACTGACTGTCAG-5' A) Which will be the template for the leading strand? B) What will be the base sequences in the two daughter molecules?
A) Top strand B) 5'-ATTCGTACGATCGACTGACTGACAGTC-3' 3'-TAAGCATGCTAGCTGACTGACTGTCAG-5' 5'-ATTCGTACGATCGACTGACTGACAGTC-3' 3'-TAAGCATGCTAGCTGACTGACTGTCAG-5'
Which vectors, plasmids or cosmid or lambda phage, can be used to clone a continuous fragment of DNA with the following lengths? A) 4 kb B) 20 kb C) 35 kb
A) plasmid, b) lambda phage, c) cosmid
Which of the following is true regarding the nucleotide composition of DNA?
A+C=G+T
What is the initiator codon in both pro- and eukaryotes? Which amino acid is recruited by this triplet?
AUG, methionine
The secondary structure of a protein includes
Alpha helix and Beta-pleated sheet
In human chromosomes, satellite DNA sequences of about 170 base pairs in length are present in tandem arrays of up to 1 million base pairs. Found mainly in centromere regions, they are called
Alphoid families
Which are the common consensus sequences involved in initiation of transcription?
CAAT, TATA
In E.coli, the genetic material is composed of
Circular, double-stranded DNA
Viral chromosomes exist in a variety of structures and can be made up of the following
DNA or RNA
ddNTPs are used in which of the following biochemical reaction?
DNA sequencing
What are the five basic components required for an active replication fork?
Each active replication fork requires 5 basic components; a. Helicase to unwind the DNA b. SSBP to keep the strands open and separate c. Gyrase to remove coiling strain down stream d. Primase to synthesize RNA primer with a 3'-OH end e. DNA pol III to synthesize the leading and lagging strand
What is the difference between heterochromatin and euchromatin?
Euchromatin undergoes the normal process of condensation and decondensation in the cell cycle. It contains the majority of chromosomal material and most of the transcription takes place here. Heterochromatin remains in a highly condensed state throughout the cell cycle. It is found at the centromeres and telomeres of all chromosomes, along the entire length of the inactivated X chromosome in females and at other specific places. Most heterochromatin remains inactive during transcription.
Because of its rapid turnaround time, FISH is commonly used in hospitals and laboratories to screen aneuploidy in cells derived from amniocentesis and chorionic villus sampling. Chromosomes 13, 18, 21, X and Y are typically screened for aneuploidy in this way. Why these specific chromosomes are chosen for screening and how FISH is effective in showing the chromosomal anomaly.
FISH employs fluorescently labeled DNA that hybridizes to metaphase chromosomes and interphase nuclei. Because of the high likelihood of aneuploidy for chromosomes 13, 18, 21, X and Y, these are routine candidates for screening.
T/F: A nucleosome is a structure associated with the nuclear membrane and associated with cellular transport
False
T/F: Cytosine, thymine and uracils are purines
False
T/F: DNA gyrase is responsible for keeping the uncoiled strands apart
False
T/F: DNA replicates conservatively, which means that one of the two daughter double-helices is 'old' and the other one is 'new'
False
T/F: During replication, primase adds a short chain of DNA primer.
False
T/F: In DNA, strings of nucleotides are joined together by hydrogen bonds.
False
T/F: In RNA, uracil is present instead of guanine (in DNA).
False
T/F: In a typical PCR, primers are used to cleave specific regions of the DNA template
False
T/F: In contrast to euchromatin, heterochromatin contains more genes and is earlier replicating.
False
T/F: In restriction mapping, map units are expressed as m.u.
False
T/F: Presence of heterochromatin is characteristic of prokaryotic chromosome
False
T/F: Proteins are composed of strings of nucleotides connected together by phosphodiester bonds.
False
T/F: RNA processing occurs when amino acids are removed from nascent proteins.
False
T/F: Tertiary structure of protein is stabilized by peptide bonds between cysteine residues.
False
T/F: The secondary structure of a protein is dependent on polar interactions among the side chains of the amino acids.
False
T/F: Transcription factors function to help move ribosomes along the mRNA.
False
T/F: Viral genomes are always either double-stranded DNA or single-stranded RNA.
False
T/F: mRNA is usually polycistronic in eukaryotes.
False
T/F: Amino acids are divided into polar, nonpolar and neutral groups.
Flase
How does a genomic library differ from a cDNA library? How each is created?
Genomic library: created by inserting fragments of chromosomal DNA into a cloning vector. It consists of a set of bacterial or phage clones that contain the DNA fragments. cDNA library: made from mRNA sequences. Cellular mRNAs are isolated and then reverse transcriptase is used to copy the mRNA sequence to cDNA, which are inserted to plasmid or phage vectors. The vectors transfer the cDNA fragments to bacterial cells, creating a set of bacterial cells that contain all the DNA sequences.
Unwinding of DNA helix involves the following set of enzymes;
Helicase and SSBP
Eukaryotic chromosomes contain two general domains that relate to the degree of condensation. These two regions are
Heterochromatin and euchromatin
Chromatin of eukaryotes is organized into repeating interactions with protein octomers called nucleosomes. Nucleosomes are composed of which class of molecules?
Histones
A molecule of double-stranded DNA that is 5 million base pairs long has a base composition that is 62% G+C. How many times, on average, are the following restriction sites likely to be present in this DNA molecule? A) GGATCC B) AAGCTT C) CCGG
If G+C = 62%, then G = 31% and C = 31% If G+C = 62%, then A+T = 100 -62 = 38%; A or T= 19% To determine the probability of finding a particular a base sequence, we'll use multiplication rule. The probability of finding the sequence GGATCC = 0.31 X 0.31 X 0.19 X 0.19 X 0.31 X 0.31 = 0.0003333. To determine the average number of recognition sequences in a 5-million bp piece of DNA; 5,000,000 X 0.00033 = 1666.5 recognition sequences Do the other sequences similarly.
What is the significance of the fact that many synonymous codons differ only in the third nucleotide position?
In synonymous codons that differ at only the third nucleotide position, the 'wobble' and non-standard base-pairing with the anticodons will likely result in the correct amino acid being inserted in the protein.
Hyperchromic shift FISH Electrophoresis Purine Transfection Transforming Principles
Increased UV absorption DNA present in tissue agarose gel double-ring structure protoplast DNA
Shine-Dalgarno sequence is
Is a short sequence that precedes the AUG start codon and contains only purines
List, in order, the steps usually followed in producing recombinant DNA molecules in a plasmid vector.
Isolation of DNA, digestion of DNAs with an appropriate restriction endonuclease, ligation of fragments and transformation of host cells.
In addition to highly repetitive and unique DNA sequences, a third category of DNA sequences exist. What is it called and what types of elements are involved?
Moderately repetitive DNA, SINEs, LINEs and VNTR
Describe the structure and composition of nucleosome (core particle) and chromatosome.
Nucleosome core particle: contains two molecules each of histone H2A, H2B, H3 and H4, which form a protein core with around 147 bp of DNA wound around the core. Chromatosome: Nucleosome core + one molecule of histone H1.
ddNTP lacks ..............at the ........end.
OH group, 3'
Below is a list of terms. Give a brief description of each one. A) Okazaki fragment B) Lagging strand C) Bidirectional replication
Okazaki fragment: short, single-stranded stretches of DNA on the lagging strand. Lagging strand: the side of the replication fork where synthesis is discontinuous. Bidirectional: from the point of initiation, replication occurs in both directions along the DNA.
Suppose you are asked to clone the pig gene for the hormone prolactin, in a lab where you are a student researcher. Assume that the prolactin gene of the pig has not been isolated, sequenced or mapped yet. However, the mouse gene for prolactin has been cloned and the amino acid sequence is known. Briefly explain two strategies that you might use to find and clone the pig gene for prolactin.
One strategy would be to use the mouse gene for prolactin as a probe to find the homologous pig gene from a pig genomic or cDNA library. Another strategy would be to use the amino acid sequence of mouse prolactin to design hybridization probes to screen the pig DNA library.
Peptidyl transferase is associated with
Peptide bond formation during protein synthesis
Vectors such as pUC18 contain a large number of restriction enzyme sites clustered in one region. What is that site called?
Polylinker
Supercoiling relies on the enzyme
Topoisomerase
How are promoters and enhancers similar and how they are different?
Promoters are essential for the binding of general transcription factors. Enhancers stimulate or increase the rate of transcription. Promoters are typically adjacent to the transcriptional start site and are highly position dependent, whereas enhancers function at a distance from the gene and function independently of position and direction.
Normally DNA is replicated during the S phase of cell cycle and the process is highly regulated. Suppose, normal cells produce protein A, which increases in concentration in S phase. If the cells have a mutated copy of the gene for protein A, replication continues throughout the cell cycle, being no more limited to the S phase. Protein B is normally present in the beginning of S phase, but disappears gradually during the later part of S phase. When cells have a mutated copy of gene for protein A, protein B does not disappear and remains high throughout the cell cycle. When the gene for protein B is mutated; no replication happens. Propose a mechanism that would explain how protein A and B might normally regulate replication and how their mutation affects the process.
Protein B is probably necessary for the initiation of replication. It is present at the beginning of S phase, but disappears afterwards. Protein A is probably responsible for inactivating protein B. As level of A increases, level of B decreases. When protein A is mutated, protein B is no longer inactivated; thus replication continues. When protein B is mutated, initiation does not happen and replication stops.
How does a purine differ from a pyrimidine? What purines and pyrimidines are found in DNA and RNA?
Purines have a double-ring structure, whereas pyrimidines have a single ring. DNA: Purines are A and G; pyrimidines are T and C RNA: Purines, A and G; pyrimidines U and C
An intron is a section of
RNA that is removed during processing of RNA
One form of post-translational modification of a protein includes
Removal or modification of terminal amino acid
What role do restriction enzymes play in bacteria? How do bacteria protect their own DNA from the action of these enzymes?
Restriction enzymes are produced by the bacteria and used against viruses. They recognize particular sequences in the viral DNA and cut it. Bacteria protect their own DNA from these enzymes by modifying the recognition sequence, usually by adding methyl groups to the nucleotides in the DNA.
In Messelson and Stahl experiment, what patterns of bands were observed in; A) conservative replication B) semiconservative replication C) dispersive replication
See diagram or write out later
In what ways is eukaryotic replication similar to bacterial replication, and in what ways is it different?
Similarities: a) replication is semiconservative b) origin of replication serves as the starting point c) RNA primer provides the 3'-OH group for DNA polymerases to begin synthesis of a new strand d) synthesis is in the 5' to 3' direction e) template strand is read in the 3' to 5' direction f) dNTPs are the substrates g) replication is continuous in the leading strand and discontinuous in the lagging strand Dissimilartities: a) multiple origin of replication in eukaryotes b) several different DNA polymerases in eukaryotes, who have different functions c) Nucleosomes are assembled immediately after replication in eukaryotes
Southern blots and northern blots involve gel electrophoresis and a filter, which holds the nucleic acid. Briefly describe the procedure 'blotting' in this context and differentiate between Southern and northern blots.
Southern blot: DNA to be probed is cut with restriction enzyme and then the fragments are separated by gel electrophoresis. Alkali treatment of the gel denatures the DNA, which is then blotted onto the nylon or nitrocellulose membrane. A labeled probe (RNA or DNA) is then hybridized to complementary fragments on the filter. Northern blot: RNA is separated in the gel and probed with the labeled DNA
How RNA is structurally different from DNA?
Structural difference between DNA and RNA: a) DNA is double stranded, whereas RNA is single-stranded b) DNA contains deoxyribose sugar; the sugar in RNA is ribose c) DNA has A, T, G and C as bases, RNA has A, U, G and C
What are the different types of post-translational modifications of proteins?
The different types of modifications that occur to proteins are; 1) The N-terminus amino acid is removed or modified. 2) Individual amino acids are sometimes modified by being phosphorylated, methylated or acetylated. 3) CHO side chains are added to produce glycoproteins 4) Polypepetide chains are trimmed 5) Signal sequences are removed. Signal sequence is a short chain of about 30 amino acids present at the N-terminal end of some proteins (usually the ones that are meant to be secreted); it functions to direct the protein to its final destination in the cell. 6) Polypeptide chains get complexed with metals.
What are the three different packaging steps involved to package a fully extended DNA to a highly condensed mitotic chromosomes?
The first level of packing happens when DNA strands wrap tightly around the histone octomer (11 nm diameter fiber) Numerous nucleosomes coil closely together (six-fold increase in compactness), creating the second level of packing (30 nm diameter fiber) The third level of packing occurs just before mitosis. The 30-nm fiber further condenses into 300-nm chromatin fiber. Next, the 300-nm fiber condenses into 700-nm chromatids of metaphase (value varies among organisms).
What three general characteristics must the genetic material posses?
The genetic material must; a) contain complex information, b) replicate, and c) encode the phenotype.
What is the basis for determining base composition using density-gradient centrifugation?
The percentage of G-C pairs in DNA is proportional to the buoyant density of the molecule, because with 3 hydrogen bonds between them they are more compact and dense than the A-T pairs.
Suppose a new double-stranded DNA is discovered, which when exposed to DNA polymerases from E.coli; replicates continuously on both strands. What conclusions can you make about the structure of this novel DNA?
The strands of this new DNA must be parallel to each other, instead of being antiparallel (which is usual); as the replication is continuously happening on both strands. Replication by DNA polymerase can proceed only in the 5' to 3' direction, which requires the template to be read in the 3' to 5' direction. As replication is continuous, the two strands must be the same direction.
Which of the following two molecules of DNA has the lower melting temperature? Why? AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG AGGCGGGTAGGCACCCGTA TCCGCCCATCCGTGGGCAT
The upper molecule, with a higher percentage of A-T base pairs, will have a lower melting temperature than that of the lower molecule which has mostly G-C pairs. The A-T base pairs have less stability than G-C bp as they have only 2 hydrogen bonds between them.
Why it is not possible to predict the base sequence of a gene from the amino acid sequence of a protein it expresses?
There are 20 amino acids and 64 codons or triplets. Therefore, each amino acid is represented by multiple codons and because of this 'redundancy'; it is not possible to predict the sequence of DNA from the amino acid sequence.
When examining the genetic code, it is apparent that
There can be more than one codon for a particular amino acid
What is Tm? Why it is related to base composition?
Tm is the temperature required to denature 50% of the DNA. Because G-C base pairs are formed with three hydrogen bonds, it takes more heat to separate them than the A-T pairs.
Compare and contrast replication and transcription. How they are similar and how are they different?
Transcription and replication are similar in that both use a DNA template, synthesize molecules in the 5' to 3' direction, synthesize strands that are antiparallel and complementary to the template, use NTPs as substrates and use enzymes and other protein complexes for the process. Transcription differs from replication in its unidirectional synthesis of only a single strand of nucleic acid; its initiation does not require a primer; it is subject to many regulatory mechanisms; and each gene is transcribed separately. Replication differs from transcription in its bidirectional synthesis of two strands of nucleic acids and its use of replication origins.
What is transformation? How did Avery and his colleagues demonstrate that DNA is the genetic material?
Transformation is the genetic alteration of bacteria. James-Avery experiment demonstrated that; a) the transforming principle has a chemical composition closely matching with DNA, not with protein, b) Enzymes such as trypsin and chymotrypsin which break down proteins have no effect on the transforming principle, c) RNAse has no effect on it, d) DNAse destroy the biological activity of transforming principle, e) it absorbs UV light at the same wavelength as DNA. These evidences proved that DNA is the transforming principle.
T/F: A characteristic of the aging cells is that their telomeres become very short.
True
T/F: A common term for a plasmid or other DNA element that serves as a cloning vehicle is vector.
True
T/F: An intron is a section of an RNA that gets spliced out.
True
T/F: B-DNA is the most prevalent and stable DNA structure.
True
T/F: Chargaff's rule states that A = T and G = C.
True
T/F: Fetal hemoglobin contains two alpha and two gamma chains.
True
T/F: Heat or alkali can be used to denature DNA.
True
T/F: If the Kozak sequence is missing, initiator tRNA does not select that AUG codon to start initiation.
True
T/F: Polytene chromosomes are unique because they are composed of a large number of identical DNA strands.
True
T/F: Replication of DNA occurs in the 5' to 3' direction; that is, new nucleoside triphosphates are added to the 3' end.
True
T/F: Some restriction endonucleases produce sticky ends, while others produce blunt ends.
True
T/F: Telomerase is an RNA containing enzyme that adds telomeric DNA sequences onto the ends of linear chromosomes.
True
T/F: To isolate a bacterium with a plasmid that carries a desired DNA fragment along with an ampicillin-resistance gene; we should grow the bacteria in a medium that contains ampicillin
True
T/F: hnRNA is a primary transcript in eukaryotes that is processed prior to involvement in translation.
True
T/F: rDNA is the portion of the genome that is involved in the production of ribosomal RNA.
True
T/f: Telomerase is an enzyme involved in the replication of the ends of eukaryotic chromosomes
True
In sickle cell anemia, what alteration in the beta globin chain of hemoglobin molecule is found?
Valine instead of glutamic acid in the sixth position
What are the three main characteristics of the Watson - Crick double-helix model for DNA?
Watson-Crick model: a) A right-handed double helix is formed by the coiling of two long polypeptide chains around a central axis. b) The two strands are antiparallel- they run in opposite directions c) Nitrogenous bases of opposite strands are paired; A to T and G to C.
If telomerase activity is mutated in a cell, what would be the outcome?
Without functional telomerase, the telomeres would shorten at each replication cycle leading to eventual loss of telomere. Decline or loss of telomerase activity has been observed to play a role in the mechanism of aging in humans.
Can an extract from dead bacterial cells genetically transform living cells? Which experiment proved it and how?
Yes. Griffith in his experiment showed that a substance in the heat killed virulent bacteria (IIIS) genetically transformed the avirulent type IIR bacteria into live, virulent type IIIS. When he injected a mixture of heat killed IIIS and live IIR bacteria into mice, the mice developed pneumonia after 5 days of inoculation and blood from their hearts showed abundance of type IIIS bacteria. Therefore, it was proved that the IIR bacteria got transformed to virulent IIIS after acquiring a permanent genetic change.
PCR Palindromes Northern blot Probes Sanger's Method Plaque hybridization Transfection
automated thermocyclers recognition sequence probing of RNA fragment screening odf DNA library DNA sequencing screening of phage library viral vector
A protein has the following amino acid sequence; Met-Leu-Arg-Ser-Arg-Met-Tyr-Trp-Asp-His-Glu-Thr You wish to make a set of probes to screen a cDNA library for the sequence that encodes this protein. Your probe should be at least 18 base pairs long. A) Which amino acids should be used so that the smallest number of probes is required? (For the genetic code, use the figure in your text book) B) How many different sequences must be synthesized to be certain that you will find correct cDNA sequence that specifies the protein?
Your probe should be at least 18 bp long. When you look at the genetic code table, you would notice that out of all the amino acids that are present in the given protein; Met, Tyr, Trp, Asp, His and Glu have smallest number of possible codons. There is one codon for Met, one codon for Trp, and two each for the rest. Therefore, 1 X 2 X 1 X 2 X 2X 2 = 16 possible sequences must be synthesized to locate the gene.
The relationship between a gene and a messenger RNA is that
mRNAs are made from genes
Polynucleotide phosphorylase is the key enzyme used for
the manufacture of synthetic RNA for cell-free system
DNA polymerase III adds nucleotides
to the 3' end of the RNA primer
