Genetics Final

GWAS

- GWAS hits and SNPs associated strongly with a trait and are most likely in LD with the causal mutation - GWAS results can be used to predict phenotype - GWAS has been a commercial success because of inexpensive SNP-chips - GWAS are hypothesis-free approaches that survey the entire genome to identify genetic variants that may be associated with a particular disease or trait.

Transposable elements

- Transposable elements can restore gene function - Transposable elements can generate new gene functions - Resistance to active transposable elements is inherited via the cytoplasm - Transposable elements are similar to viruses in DNA sequence composition

it is estimated that ~10% of inborn genetic diseases are due to defects in splicing. What type of mutations could cause splicing defects?

- a change in the nucleotide sequence at the 5' end of an intron in the DNA - a mutations in a gene coding for one of the snRNPs that functions in the splicosome - a mutation in a gene coding for an RNA-binding protein that binds to the primary transcript at a cis-site important for splicing - a change in the nucleotide sequence at the 5' end of an intron in the primary transcript

The principal modification to the Cas9 enzyme for it to be useful in genetic engineering in plants and animals is:

- a nuclear-localization signal

what does the eukaryotic pre-inititation complex do?

- interact with core promoter sequence motifs - contains many proteins including RNA polymerase

we now know that Beadle and Tatum's "one gene, one enzyme hypothesis" is an oversimplification because

- not all proteins are enzymes - some genes code for more than one protein - not all genes code for a protein

Mechanisms known to regulate the function of transcription factors

- post-translational modifications like phosphorylation - transcription to control levels of TF expression -binding to steroid hormones like testosterone or estrogen -binding to co-factors that promote or inhibit DNA binding

Polyadenylation of mRNA is important for:

- preventing attack of RNAse - translation initiation

leading strand DNA replication involves

- the addition of nucleotides in a 5' to 3' direction

In the Yanofsky experiment, how could separate mutations in the DNA sequence result in a different amino acid change at the exact same location within the protein?

- the two mutations were at the same nucleotide position - the two mutations were at different nucleotide positions but within the same codon triplet

universally beneficial mutations are rare in natural populations because

- universally beneficial mutations are too complex to arise randomly - they go to fixation rapidly so observing them as polymorphic sites might be hard - new mutations are generally deleterious and get removed from populations quickly

benefits of GWAS studies

-As sequencing genomes becomes cheaper, GWAS are more and more affordable -SNP-chips can be used to sequence specific SNPs for a GWAS analysis GWAS allows for the surveying the genome without a prior hypothesis that might introduce bias - GWAS can identify regions of the genome associated with a trait or phenotype

Do you need to know genotype frequencies to calculate Fst?

-No, you need to know the allele frequencies (no haplotypes bc only looking at one SNP) - genotype frequency might be required to calculate allele frequencies - can calculate Fst with just allele frequency

What are the two special ingredients that turn CRISPR/Cas9 into a gene-drive system?

-The construct must contain the Cas9 enzyme and the appropriate sgRNA sequence - Heterozygous individuals become homozygous

What is the relationship between the maximum allele frequency difference and Fst (e.g., EPAS1 example)?

-When there's a large difference in allele frequency, there is a larger Fst. -Positive correlation - high Fst value corresponds to a large genetic differentiation between the populations

what types of mutations could potentially restore an open reading frame following a single nucleotide deletion?

-a single nucleotide insertion - a two nucleotide deletion

The Retinoblastoma protein (Rb) is sometimes referred to as a "tumor suppressor" because:

. Rb inactivation leads to unrestrained E2F activity and cell cycle progression

Microarray chips (SNP chips) are a useful way to...

... determine patterns of migration between populations.

For two genes on non-homologous chromosomes, the expected frequency of crossing over between these two genes is:

0

A team studies heritability in seed yield in a sunflower population across years. In 2021, there are unusual weather patterns, and they record a VG of 0.1 and a broad sense heritability of 0.25. In 2022 there is more consistent weather, and they record a new h^2 of 0.5. Assuming the VG has not changed between years, what is the new VE in 2022?

0.1

A team studies heritability in seed yield in a sunflower population across years. In 2021, they record a Va of 0.1 and a narrow sense heritability of 0.25. In 2022 there is intense regional flooding, and they record a new h^2 of 0.2. Assuming the Va has not changed, what is the new VE in 2022?

0.4

Two populations of cardinals live on either end of river, and a scientists is seeking to understand the FST between these groups at a genotype with alleles big A and little a. The expected genotypes for the species are AA: 25%, Aa: 50%, and aa: 25%. The observed genotypes are AA: 40%, Aa: 20%, and aa: 40%. What is the FST of the cardinal populations at this genetic locus?

0.6

Starting with the parental cross DD × dd, what proportion of the F2 offspring is expected to be heterozygous?

1/2

In Mendel's pea plants, large seeds (L) is dominant to small seeds (l), and orange flowers (O) is dominant to white flowers (o). An F1 plant from a mating between homozygous plants that were large/orange and small/white was crossed to the small/white parent. What proportion of the progeny are expected (according to the Mendel's law of independent assortment) to be homozygous for small and white alleles?

1/4

Consider the following DNA sequence: 5' GGAGCTACGCAGCGATCATCG 3' If the first AUG is used in translation, how many unique tRNAs would be needed to make the peptide encoded by this sequence?

3

For DNA forensics, how many SNPs at allele frequency of 7% would be required to achieve about the same false positive rate as two microsats each with 5 equally abundant alleles? Assume that the sample in question is heterozygous for all SNPs and all microsats. Round up, not down.

3

Following Chargaff's rule, if 15% of the bases in a region of the Drosophila genome are adenine, what percentage are cytosine?

35%

The nucleotide sequence of the template strand of DNA is: 5' - TAC CGG AAT AGC ACT -3' What is the corresponding mRNA sequence of the template DNA?

5' AGU GCU AUU CCG GUA 3'

What would an expansion and a contraction have in common when experienced within a population?

A change in the allele frequencies within the population

de novo mutation

A new mutation that was not inherited from either parent

Which of these is not a true statement regarding synteny? A. Synteny can explain how one gene impacts multiple independent phenotypes. B. Synteny can be broken up by structural rearrangements. C. Differences in the synteny of different species can be used to create phylogenetic trees. D. Synteny is a result of shared evolutionary origin between two species. E. The Hox genes involved in development exemplify synteny across animals.

A. Synteny can explain how one gene impacts multiple independent phenotypes

which is contained in a gene body? A. Transcription factors B. Poly-A Tail C. TATA Boc D. 5' untranslated region E. All cis regulatory sequences

All cis regulatory sequences

All of the following statements regarding PCR are true except for: A. PCR is a technique that paved the way for molecular biology and cloning. B. PCR is overrated and no one really uses this technique any more. C. There are three main steps in conventional PCR, where the goal is to amplify (make more copies) of a particular DNA sequence. First is denaturation, where the double DNA strands are melted apart. Next is an annealing step where oligonucleotide primers find their DNA template. Next is the extension step, where DNA polymerase adds nucleotides to the single strand DNA template, forming a new complementary DNA strand. D. PCR makes use of a DNA polymerase isolated from a eubacterial microorganism found living in hot springs. E. PCR allows for a section of DNA to be copied hundreds of thousands of times

B. PCR is overrated and no one really uses this technique any more.

The stop codon of a typical eukaryotic protein-coding gene marks... A. the place where transcription starts B. the final codon before an untranslated region C. the place where transcription ends D. the end of the gene E. the final frameshift in the coding sequence

B. The final codon before an untranslated region

Which of the following is true about Cyclins and Cdks? A. Cyclin/Cdk complexes ubiquitinate their substrates leading to inactivation of gene expression B. cyclins remain at constant abundance across the cell cycle and complexes formed between cyclins and variably abundant CDKs permit phosphorylation of target proteins C. cyclins change abundance across the cell cycle and complexes formed between cyclins and CDKs permit phosphorylation of target proteins D. cyclins remain at constant abundance across the cell cycle and complexes formed between cyclins and variably abundant CDKs permit phosphorylation of target genes E. cyclins change abundance across the cell cycle and complexes formed between cyclins and CDKs permit phosphorylation of target genes

C. cyclins change abundance across the cell cycle and complexes formed between cyclins and CDKs permit phosphorylation of target proteins

how is the Cre-lox system used in a tissue-specific manner?

Cre recombinase is expressed in specific tissues to induce site-specific recombination at lox sites

A. miRNAs regulate mRNA abundance B. miRNAs are transcribed initially as longer transcripts C. miRNAs often target transcripts of more than one gene D. miRNAs code for several different proteins E. miRNAs can block ribosome translation

D. miRNAs code for several different proteins

pre-mRNA is post-transcriptionally processed to mature mRNA. All are important post-transcriptional modifications of pre-mRNA except: A. addition of a 3' poly-A tail B. addition of a 5' methylated guanine cap C. rejoining of exons after intron splicing D. removal of the 5'UTR so that the first codon is AUG E. removal of introns through splicing

D. D. removal of the 5'UTR so that the first codon is AUG

Molecular biology central dogma

DNA (transcription) RNA (translation) Proteins

differences between RNA and DNA include

DNA is transcribed, while some RNAs are translated

Why is Mueller's ratchet and the accumulation of mutations a phenomenon present in mitochondrial DNA, but not most animal genomic DNA?

Diploid genomic DNA avoid's Mueller's ratchet with recombination

When compared to an additive genetic relationship, what impact does dominant/recessive genetic relationship have on the effectiveness of natural selection?

Dominance can reduce effective natural selection via the masking of beneficial recessive alleles.

A researcher is preparing to cut-up a human genome for Sanger Sequencing, but they forget to note the name of the restriction enzyme they use. After digesting a 1000 base pair section of DNA, they end up with 4 restriction fragments. Which of these is the most likely restriction enzyme used? A. BaeI (10 bases long) B. NOtI (8 bases long) C. None of the above D. Rsal (4 bases long) E. HindIII (6 bases long)

E. HindIII (6 bases long)

These are all improvements of Illumina Next-gen sequencing over Sanger Sequencing except:\ A. All of the above represent improvements. B. Sanger requires using microbial cloning with bacteria, wheres Illumina can use flow-cell amplification. C. Illumina works significantly faster, and with less computational power. D. Next-Gen sequencing is far cheaper per nucleotide then Sanger sequencing. E. Illumina does not require the use of fluorescence to identify bases (A/G/T/C).

E. Illumina does not require the use of fluorescence to identify bases (A/G/T/C).

Which one of the following is incorrect regarding the two strands in the DNA double helix? A. DNA is negatively charged because of phosphates in the backbone. B. The two strands are held together by hydrogen bonding between the nitrogenous bases. C. Double stranded DNA forms a helix, and the backbone of the helix is composed of alternating phosphate, sugar, phosphate, sugar, phosphate sugar, etc. D. The two strands are antiparallel. One runs in the 5' to 3' direction and the other strand is the reverse complement and runs in the 3' to 5' direction. E. Ribose is the sugar (aka the five carbon ring) found in DNA, which is the same for RNA.

E. Ribose is the sugar (aka the five carbon ring) found in DNA, which is the same for RNA.

Which of the following statements about telomeres is accurate? A. their length typically decreases within families during each passing generation B. they become shorted because repeated sequences cannot be replicated accurately C. their repeating Leu-Gly codons (TTA-GGG) are binding sites for charged tRNAs D. they are a major site of transcription initiated by basal transcription factors at core promoters E. they are rejuvenated by synthesis of DNA from an RNA template

E. they are rejuvenated by synthesis of DNA from an RNA template

Counted among Mendel's several contributions is: A. a rigorous demonstration of blending inheritance B. an explanation for additive effects of alleles C. identification of the heritable material D. an explanation for sexual selection E. development of the world's first genetic model organism

E. development of the world's first genetic model organism

why are mitochondrial genomes so small

Eventually, the least mutated class of chromosomes of a non-recombining chromosome will be lost from the population and that creates a selection pressure to move genes from the mtDNA to the nuclear DNA.

Does a F2 intercross have higher or lower LD (linkage disequilibrium) than a F5 intercross?

F2 has a higher LD than F5. The more generations of recombination that happen, the lower the linkage disequilibrium. LD decays faster as a function of physical distance the more generations you have. The further apart 2 SNPs are, the lower LD

How does heritability change if the allele frequency of the causal SNPs change?

Function of underlying allele frequency of the loci. If an allele is at 50% frequency, you are going to generate the most amount of genetic variation in the offspring because you're going to have the greatest spread between the 3 phenotypic classes. If a causal allele, underlying variation of that trait with a low frequency like 5% doesn't contribute much to the population level heritability. Heritability changes as the allele frequency changes

Are new, recessive deleterious mutations more or less likely to persist in populations if the population is expanding?

If it's expanding (doing well) , a new mutation that is deleterious won't have that much of an effect For a recessive trait to be seen, it has to be homozygous so if the population is expanding rapidly it will be hard for it to exist as homozygous. Many lineages so there is not much time to be homozygous for the traits.

Positive selection causes a beneficial allele to rise in frequency very quickly. Why does positive selection generate linkage-disequilibrium?

If selection causes an allele to rise into the frequency quickly, as it arises in frequency, it brings everything it was also linked to and are not necessarily beneficial (selective sweep). Creates a pattern of correlation among neighboring SNPs- creates linkage in the population

why is it that an additive genetic effect allows for more effective response to natural or artificial selection than

In additive systems each allele affects the trait dependently, so each can be acted upon by selection.

A population is experiencing sudden expansion. How old would you expect the MRCA be compared to a population experiencing contraction? What about the FST?

Lower, higher Mrca is younger compared to population experiencing contraction

Would P-element transformation work in a P-background or an M-background or both?

M-background- it would get shut down in p-background.

What is the corresponding amino acid sequence encoded by this DNA template strand? 5' - TAC CGG AAT AGC ACT -3' Assume the 1st position of the mRNA sequence is the first nucleotide of a codon in the protein.

N- Ser Ala Ile Pro Val- C

Why is natural & artificial selection better able to act on additives compared to dominance variance?

Natural and artificial selection are better to act on additive variance because they are directly related to the average effect of an allele on the phenotype of an individual, while dominance variance is related to the interaction between different alleles. Selective pressures can act on individual alleles.

Does methylation always shut down (reduce) expression of a protein coding gene?

No, Methylation at tCpG sites can shut down the expression of a non-coding RNA and subsequently leads to increased expression of a protein coding gene. (slide 20, lecture 36) CpG shuts down an inhibitor which in turn allows for expression

Is heritability a fixed property of a species?

No, changes based on environment and what population you are looking at. It is a measure of the proportion of the phenotypic variation that can be attributed to genetic variation within a specific population in a specific environment

Can Fst tell you whether individuals within a population are engaging in obligate assortative mating?

No- Fst is the measure of differences between 2 populations. You can calculate with Fst within a population if there's an excess of heterozygotes or a deficit of heterozygotes. can't necessarily tell you what is going on with in a populations

Are P-elements used in genetic engineering autonomous or nonautonomous?

Non-autonomous- they only work if a helper plasmid is also inserted. Inject the p-element and transposon into the fly until it inserts and then the TE hops around by expressing transposon somewhere else in the genome

If parents resemble their offspring does that mean that variation in the trait is determined by genetic factors?

Not necessarily, could be due to similar environmental factors that offspring and parents likely share

What other regions of the genome or chromosome is muller's ratchet expected to affect?

Only affects the Y chromosomes and areas of low recombination (gene poor) natural selection cant remove the deleterious sections very easily

Which of the following is NOT likely to be required for chromosome segregation during mitosis? A. spindle microtubules B. centrosomes C. kinetochore D. CENP-A E. origin recognition complex

Origin recognition complex

PCNA (proliferating nuclear antigen) is a target gene of E2F. What is the function of PCNA?

PCNA functions as a clamp to keep the newly synthesized DNA strand together with the DNA template

Are rare alleles or common alleles more likely to be lost during a bottleneck?

Rare- they lose the number of mutations and polymorphic sites. Less likely that someone with the rare allele is a part of the remaining population. Serial bottlenecks decrease diversity because allele frequencies will change more dramatically which causes some alleles to get lost and diverge more between subpopulations

Why do large sections of nucleotide repeats create problems for accurate genome assembly?

Repeat sections can cause DNA strands to slip during DNA synthesis, lowering accuracy of the subsequent sequencing.

In fred Griffith's classic study or S and R form streptococcus pneumoniae, he found that:

S form could arise from R form if material was provided from killed S form

Which factors can make allele fixation due to genetic drift more likely?

Small population size, the allele's high starting frequency

Which of the following statements are correct: A. All genes that are highly expressed (meaning highly transcribed) result in the production of an abundance of protein B. there is a strict 1 to 1 ratio in the amount of mRNA to protein C. Low abundance proteins are made only from genes that make little mRNA D. Most mRNAs are very stable and last for days to weeks allowing for the continued production of protein from the same mRNA E. Some genes that are highly expressed (meaning highly transcribed) produce very little protein relative to the amount of mRNA

Some genes that are highly expressed (meaning highly transcribed) produce very little protein relative to the amount of mRNA

How does the TMRCA relate to population size?

TMRCA is tied to population size- larger population, larger (older) TMRCA. More branches in genealogy, more time to mrca

A scientist studying two species of clams, and trying to estimate their evolutionary history. What piece of genetic information could help her estimate when was the most recent common ancestor of the clam species?

The extent of different mutations between the two species

What is the female P-type fly doing to the egg to protect the offspring from TE attack?

The female P-type fly contains the necessary pi-RNA and Piwi proteins to prime the developing oocyte for defense against P-elements. During development, there components can either be given by the mother, or if they were inherited in an active state, immediately defend the oocyte against TEs by targeting the TE sequence and destroying its transcript

Why would you expect a bottleneck to increase the mean FST between populations?

The increase in the effects of genetic drift cause changes in allele frequencies after a bottleneck.

In a mutant screen, why do you need to wait until the 2nd or 3rd generation after mutagenesis to screen for mutants?

The mutations may be recessive The first generation after mutagenesis will carry a mixture of mutated and unmutated alleles In subsequent generations, the mutated alleles will be passed down to a larger number of offspring, increasing their likelihood of being expressed The recessive mutations may become homozygous in some offspring by 2nd or 3rd generation Need to wait for mutation to be incorporated into the germline, even if it is dominant

A scientist is hoping to use P-element transformation to insert a transgene. However, the Drosophila she is using in the lab are P-type flies. What issue can occur with using P-element transformation in a P-type line?

The piRNA's present in P-types will cause the degradation of new P-elements, halting transformation.

A scientist has exposed some flies to EMS and after a few generations of crosses has generated three independent stocks (stock A, B, and C) that are pure breeding (homozygous) for white eyes. However, the scientist does not know whether these EMS mutations affect the same gene or not. The scientist makes three crosses and observes the following eye colors: AxB = red AxC = white BxC = red

Two

A researcher wants to understand if a gene of interest (geneX) is more highly expressed in the heart or the liver. Which approach would most help address their question?

Use samples from both tissues to first create cDNA of geneX, then compare the number of cDNA clones found from each tissue.

For an mRNA transcribed from a single-exon gene, a premature stop codon would mostly result in:

a shorter protein

How do histone acetyly transferase enzymes promote gene expression?

by adding acetyl groups to specific amino acids in histone tails, reducing the affinity of nucleosomes for nearby DNA

Eukaryotic genes have cis-regulatory regions sometimes referred to as enhancers. Why are enhancers important in gene regulation?

enhancers allow for gene expression to be controlled spatially and temporally

epigenetics defintion

heritable modifications to gene expression not coded for in the DNA

How can you have better resolution in a QTL study? Increasing which two components will increase the ability of a QTL study to find loci at high resolution?

large population size used in crosses, more generational crosses Increase resolution= known with more precision and accuracy where the loci that affecting the trait is. More crosses= more meiosis= more recombination to break up the haplotypes

An important function of the centromere is to:

link chromatids to spindle microtubules via the kinetochore

If two independently derived EMS eye color mutations are caused by the same nucleotide change, what phenotype do you expect in their F1s?

mutant phenotype

What phenotype do expect if they are caused by the different mutations in the same gene?

mutant phenotype

what is involved in altering chromatin state between open and closed configurations

post-translational modification of histone tails

what does the wobble position allow for

promiscuous base-pairing and fewer tRNAs than codons

linkage disequilibrium

refers to the statistical association between two or more genetic variants in a population.

replication in eukaryotic cells involves

selection of multiple origins from sites licensed by the pre-replication complex

which factors can make allele extinction due to genetic drift more likely

small population size, the allele's small starting frequency

A Drosophila male from a true-breeding stock with scabrous eyes (se) is mated with a female from a true-breeding stock with javelin bristles (jb). Both scabrous eyes and javelin bristles are autosomal recessive mutant traits. The F1 progeny from these parents all had normal eyes and bristles. F1 females were then mated with males that had both scabrous eyes and javelin bristles. The numbers and phenotypes of the F2 progeny are: 148 wild type (normal eyes and bristles) 7 scabrous eyes and normal bristles 4 normal eyes and javelin bristles 141 scabrous eyes and javelin bristles Based on these results, you conclude that:

the gene encoding for scabrous eye (se) and javelin bristles (jb) are located on the same chromosome

A Drosophila male from a true-breeding stock with scabrous eyes (se) is mated with a female from a true-breeding stock with javelin bristles (jb). Both scabrous eyes and javelin bristles are autosomal recessive mutant traits. The F1 progeny from these parents all had normal eyes and bristles. F1 females were then mated with males that had both scabrous eyes and javelin bristles. The numbers and phenotypes of the F2 progeny are: 77 wild type (normal eyes and bristles) 76 scabrous eyes and normal bristles 74 normal eyes and javelin bristles 83 scabrous eyes and javelin bristles Based on these results, you conclude that:

the gene encoding scabrous eye (se) and the gene encoding javelin bristles (jb) are located on different chromosomes and are not physically linked

what promotes efficient translation of mRNAs

the presence of PABP (poly-a binding protein) and translational initiation factors (eIFs) at the 5' methyl cap

Mendel's Law of Independent Assortment is usually accurate describing

the segregation of alleles at genes not linked physically to one another

how does meiosis increase genetic diversity

through crossing over events between non-sister chromatids on homologous chromosomes followed by independent assortment of chromosomes

Meselson and Stahl grew E.coli in two different media conditions. One of the media conditions contained N-15 and the other contained N-14. What was the purpose of growing E.coli under these two different conditions?

to label all the bases in DNA with either N-15 or N-14

After RNA pol II "escapes" from the Preinitiation Complex it:

transcribes RNA along the gene body adding new ribonucleotides to the 3' end of the growing RNA

point mutations like SNPs can be categorized as

transitions and transversions

What phenotype do you expect in the F1s if the aberrant eye color are caused by different mutations?

wildtype phenotype