Genetics Module 2 Exam
Arrange the following double stranding DNA molecules in order from most to least stable. Assume all the molecules are the same length.
- 20% T - 33% G - 26% C - 37% A [Chargaff's rule states that the amount of A in DAN equals the amount of T and the amount of G equals that of C. Three hydrogen bonds occur between G and C but only two between A and T]
Taking into account your knowledge of wobble rules, select all anticodons that can pair with the codon 5'UAC3'
- 5'IUA3' - 5'AUA3' - 5'GUA3' [according to the wobble rules, the first two positions pair strictly according to the AU/GC rule; however, the third position can tolerate certain types of mismatches; eg. if the third base of the mRNA codon is C, the complementarity base in the anticodon can be G, A, or I.]
De novo synthesis refers to the process by which nitrogenous bases harboring the same number of ring structures are synthesized during the series of enzyme-catalyzed reactions within a single metabolic pathway. Leflunomide, a drug used to treat moderate-to-severe rheumatoid arthritis, is an inhibitor of dihydroorotate dehydrogenase, the enzyme that catalyzes the fourth of six steps the de novo synthesis pathway by which single-ring containing bases are synthesized. Based on its mechanism of action, treatment with leflunomide would result in decreased cellular production of which nucleotides?
- Cytosine - Thymine - Uracil [The pyrimidine bases, T, C, and U contain single ring structures]
In the process of RNA editing adenine or cytosine may be deaminated and the result is _____.
- Cytosine is changed to Uracil - Adenine is changed to hypoxanthine - the new bases effectively result in new codons
Consider the following DNA sequence, which codes for the first portion of a long protein beginning at the ATG(AUG in mRNA) start codon 5' ATG CCC CGC ATG AGG GGG TGG AGA3' 5' ATG CCC CGC AGT AGG GAG TGG AGA3' What type of mutation is this?
- point mutation - transition - missense mutation
Consider the following DNA sequence, which codes for the first portion of a long protein beginning at the ATG (AUG in mRNA) start codons 5' ATG CCC CGC AGT AGG GGG TGG AGA3' 5' ATG CCC CGC AGT AGG GGG TGA AGA3' What type of mutation is this?
- point mutation - transition - nonsense mutation
This pre-mRNA contains 8 exons and 7 introns. The splice sites surrounding exon 4 are not readily recognized by the splice-some. In addition, a splicing repressor prevents the recognition of the 3' splice site in exon 7. What exon will be present in the mature mRNA?
1, 2, 3, 5, 6, 8 [if all exons were included, the mature mRNA would contain exons 1-8; however, because the splice sites surrounding exon 4 are not well recognized by the splice-somes, it is not included. Similarly, a repressor binding to the 3' splice site of exon 7 will block its inclusion' therefore the final mature mRNA will contain exons stated above]
The following RNA sequence can fold back up on itself to form double stranded regions, resulting in the formation of one bulge loop and one stem loop. Once folded, how many CG base pairs would be found in this RNA secondary structure? 5' GCGACCGAGCCAGCCAGAGGUGCACACGGCUGGCGUCGC3'
11 ["fold in half" and count]
The following sequence forms a stem loop in the poliovirus RNA that is bound to PCBP, an RNA binding protein that functions in both the translation and replication of the PV genomic RNA: 5'UGGGGUUGUACCCACCCCA3'. Once formed, how many hydrogens stabilize the stem in this structure?
16 [the stem in this structure is formed between nucleotides 1-6 (UGGGGU) and 14-19 (ACCCCA). Three hydrogen bonds occur between G and C but only two between A and U]
What is the minimum number of tRNA that can be used to recognize all of the codons for threonine?
2 [there are four codons for threonine ACU, ACC, ACA, ACG, which differ solely in the third position; any charged tRNA carrying Thr must have an anticodon with the sequence 3'UG5'. Based on the wobble rules, the last base in the anticodon could be either U or I, and all four codons for Thr would be covered]
Consider the following mRNA from a eukaryotic species. Which AUG codon is translation most likely to begin from? 5'CCUAUGAGCCACCAUGGAUGCCAAAUGCA3'
2nd [the consensus sequence for optimal start codon recognition in complex eukaryotes is: GCC(A/G)CCAUGG, positioned from -6 to +4. Aside from the AUG codon itself, a guanine at the +4 position and a purine, preferably an adenine, at the -3 position are the most important sites for the start codon selection.]
One strand of DNA is 5'AGGCCTTA3'. What is the sequence of the opposite stand?
3'TCCGGAAT5'
After screening a colony of bacteria for mutations in a given gene, you discover 100 mutant colonies out of 3 million total colonies. What is the mutation frequency for this gene in the population?
3.3 x 10^-5
How many bases are necessary to complete three complete twists (1080 degrees) of a DNA helix?
30 twists [there are ~10 nucleotides in each strand per complete 360 degree turn of the helix]
According to Chargaff's rule, if the DNA of a species contains 20% adenine, what percent of guanine will it contain
30% [A in DNA equals the same amount of T and the amount of G equals that of C; thus if 20% of the DNA is A, then 20% must be T, the remaining 60% is split between G and C)
You perform a cell free translation experiment like Nirenberg and Matthaei. You start with 60% C and 40% A. What relative amount of radiolabeled proline do you expect in the translated polypeptides?
36% [with only C and A available, there are two possible codons for proline: CCC and CCA CCC: 0.6 x0.6 x0.6 = 21.6%; CCA: 0.6x 0.6 x 0.4 = 14.4%; 14.4 + 21.6 = 36%]
Consider the following DNA sequence, which codes for the first portion of a long protein beginning at the ATG (AUG in mRNA) start codon. 5' ATG CCC CGC AGT AGG GGG TGG AGA3' 5' ATG CCG CGC AGT AGG GGG TGG AGA3' What type of mutation is this?
5' ATG CCC CGC AGT AGG GGG TGA AGA3'
The consensus sequence at a bacterial promoter are 5' TTGACA3' and 5'TATAAT3' at -35 and -10 respectively. Which of the following sequences would be most easily recognized by sigma factor?
5' TTGAAA3' [sigma factor recognizes both the -35 and -10 sequence; among the sequence listed, 5'TTGAAA3' has the fewest deviations from either of the consensus sequences, and would be most easily recognized by sigma factor]
Which DNA sequence would also work in place of the following bi-directional enhancer? 5'GTTC3' '3CAAG5'
5'GAAC3' 3'CTTG5' [a property of enhancers is that they can work in either direction]
You perform a cell free translation experiment like Nirenberg and Matthaei, but you forgot to write down what nucleotides you added to make the mRNA. You precipitate the translated polypeptides and measure the relative amount of radiolabeled amino acids incorporated into them. You get 25% proline, 25% threonine, 12.5% glutamine, 12.5% lysine, 12.5% asparagine, and 12.5% histidine. What nucleotides and in what % did you add to make the mRNA?
50% C and 50%A [if the amount of the NDPs in the phosphorylase reaction are controlled, the relative amount of the possible codons can be predicted, eg. if 50% C and 50%A are mixed together with polynucleotide phosphorylase, the predicted amounts of the codons within the random polymers would include 12.5% CCC and 12.5%CCA, both of which encode Pro, for an expected value of 25% proline.]
What percentage of human pre-mRNA is alternatively spliced?
70%
How many amino acids would be included in the polypeptide encoded by the following mRNA: 5' GCCACCAUGGGCCAAUUACGAAGGUUUUGCUGACCAGGUCAA3'
8 [Once the start codon (AUG) is identified, then the adjacent codons can be determined and translated using the genetic code until an in-frame stop codon (UGA in this particular mRNA) is reached]
With 248,956,422 pb, chromosome 1 is the longest chromosome in the human genome. How long is chromosome 1?
85mm [distance between two consecutive bases is 0.34 nm]
Select the codon that is not synonymous with CUU.
AUU [synonymous codons specify the insertion of the same amino acid, but different in their three base-composition.]
Cells are treated with a drug that blocks purine synthesis. Which bases would not be made in those treated cells?
Adenine and Guanine [double ring purine bases are A and G; where the single ring pyrimidine bases are T, C, and U]
A nucleoside analog is a synthetic compound that is structurally similar to a naturally occurring nucleoside. Such compounds typically interfere with DNA or RNA synthesis, and are accordingly used as antiviral and anticancer drug.
Adenosine [the structure attached to C1 most closely resembles the purine base adenine. When ribose is attached to adenine, the resulting nucleoside is called adenosine]
A tRNA's anticodon is 5'GGC3'. What amino acid is attached to it?
Alanine [during mRNA-tRNA recognition, the anticodon in a tRNA molecule binds to a codon in mRNA in an antiparallel manner and according to the AU/GC rule; eg. if the anticodon in the tRNA is 5'GGC3' it will bind to 5'GCC3' codon]
Which of the following might complicate the interpretation of ChIP-Seq data?
Because histones can be moved around or ejected from the chromatin, DNA that is only sometimes wrapped around a histone might not be sequenced
Researchers frequently wish to produce proteins in cells in a regulated fashion so that they effects of the protein can be studied under conditions when and when it is not present. Which of the strategies outlined below would be best suited for theses types of studies?
Creating a piece of DNA where the gene for the protein of interest is under control of a glucocorticoid response element [since the only option listed that can be regulated by a known substance is the glucocorticoid response element that is the best choice]
DNA intercalators are molecules capable of fitting between nucleic acid base pairing. A DNA molecule must unwind in order to create a space between consecutive base pairing to allow a given intercalator to insert itself. The intercalator doxorubicin is used in the treatment of Hodgkin's lymphoma. Treatment of lymphocytes with doxorubicin would disrupt which level of DNA complexity?
DNA double helix formation [unwinding to allow for insertion of an intercalator causes the neighboring base pairs to separate, resulting in an opening of about 0.34 nm. This type of change occurs at the level of two strands of DNA interacting with each other through complementary base pairing to form a double helix]
In apoptosis, a process of programmed cell death, the cell undergoes controlled degradation of cellular components including nuclear DNA. Researchers have notified that if the DNA is isolated from an apoptotic cell, it appears as distinct bands of multiples of approximately 145 bases in length. Why does this occur?
DNA that is wrapped around the histones is not being degraded. [DNA that is wrapped around histones is resistant to degradation; each histone is wrapped with a section of DNA approximately 145 nucleotides in length]
In the digestive system of animals, proteins called amylases and proteases break down large molecules (for example, starches or proteins) into smaller ones so that they can be absorbed by the intestine. What category of protein function do these proteins fall into?
Enzyme [cell shape and organization proteins provide physical stability; transport proteins regulate the passage of substances across a biological membrane, or bind and carry substances within the organism; movement proteins cause movement of structures in the cell, or locomotion of the cell itself; cell signaling proteins control physiological response; enzymes catylize biochemical reactions.]
What would be the result of a mutation in Hsp90 that prevented its binding to the glucocorticoid receptor?
Expression of the regulated genes would become constitutive
You are a doctor tasked with diagnosing a patient that comes to you with mental impairment. Upon performing genetic tests, you find he has approximately 300 repeats of GCC in one of his genes. His father and grandfather had similar mental impairment but were never diagnosed with a condition prior to their death. His grandmother, mother, and sister are unaffected. What disease do you predict that this patient has?
FRAXE
T or F: Prior to hormone binding, receptors for steroid hormones are usually found in the nucleus of the cell
False
T or F: The formation of an opening complex occurs at GC rich regions of DNA due to the decreased number of hydrogen bonds
False
T or F: insulators exert their effects on gene expression through histone acetylatransferase, histone deacetylase, and RAN polymerase.
False
What sequences are not considered to be regulatory elements?
General transcription factors
A mutation in which of the following would result in little to no effect on the expression of a gene regulated by a CRE?
Glucocorticoid receptor
What is the difference between the allosteric and torpedo models of eukaryotic transcriptional termination?
In the allosteric model, RNA pol II becomes destabilized after transcription of the poly A signal sequence, while in the torpedo model the polymerase is physically removed from the DNA
In numerous studies that investigate gene expression, the mRNA levels of proteins are examined. If one is interested in the amount of protein being produced, is this the best approach to use?
No, directly determining the amount of protein produced would be best because many steps are involved in regulating protein levels [because protein production relies on many different steps, the actual protein levels should be measured]
Suppose you performed a triplet binding assay with the triplet 5'UAA3'. What radiolabeled amino acids do you expect to find bound to the filter?
None [recall that three of the 64 codons function as stop codons, which are not recognized by the tRNA harboring a complementary sequence]
You have an RNA molecule that contain introns. You wish to carry out an in vitro splicing reaction with this RNA and cellular extracts. You want to determine if splicing is occurring via self splicing or through the splicesome. What enzyme could you add to the reaction to make this determination?
Protease [because splicing via the splicesome requires proteins, and self-splicing does not, if you added a protease, which degrades proteins, to the reaction you would be able to tell if your RNA was being spliced via self splicing or via the splicesome]
If the nucleotide in a eukaryotic mRNA coding sequence does not appear in the genomic DNA sequence, the most likely modification to have occurred is _________.
RNA editing
In E. coli, a mutation in the genes encoding which of the following proteins would disable the ability of the cell to recognize double-stranded breaks and conduct recombination during meiosis?
RecBCD
The base composition of an RNA virus was analyzed and found to be 17% A, 33%U, 19%G and 31%C. Do you think the viral genetic material is single-stranded RNA or double stranded RNA?
Single stranded [if the RNA were double stranded, there would be equal amounts A and U and C and G]
What molecules are not part of the closed complex?
Single-stranded DNA
An enormous variety of genomic structures can be seen among viruses, with a given virus having either a DNA or an RNA genome. The principal genomic componenet isolated from equine influenza virus is 22% C, 23%A, 22% G and 33%U. Based on this information equine influenza is a ________ virus.
Single-stranded RNA [DNA bases are A, C, G, and T, where RNA bases are A, C, G, and U; two separate RNA molecules to form double-stranded RNA because the %A does not equal %U the virus must be single stranded]
A single strand of RNA with sequence 5' UGAAUUGCAUCGGCAAUUGG3' has the potential to form what structure?
Stem loop [in this sequence the 5'AAUUGC3' will pair with the 5'GCAAUU3' forming a stem loop structure]
What typically terminates the process of translation?
Stop Codons
A mutation occurs in one of the general transcription factors necessary for eukaryotic transcription. A pre-initiation complex forms, but the open complex does not form. Further, TFIIB, TFIIE, and TFIIH are not released from the DNA. the mutation is most likely in which general transcription factor?
TFIIH [the general transcription factor that acts as a helicase to form an open complex. TFIIH also phosphorylate the CTD of RNA Pol II, leading to the release of TFIIB, TFIIE, TFEEH; if things are not occurring, it is mostly likely because of a mutation in the TFIIH]
In ChIP-Seq, the DNA fragments to be sequenced are around 150 bp in length. What does this size of DNA represent?
The amount of DNA wrapped around the nucleosome
A particular cell contains all of the standard histones but lacks several histone variants. Which of the following may be true of this cell?
The cell will express different sets of genes than other cells in the same organism.
Beechdrops is a parasitic plant that cannot perform photosynthesis but relies on its host the Beech tree. However, Beechdrops still retains many if not all of the genes for photosynthesis. Snapdragons and gladiolas are common garden flowers that rely on their ability to perform photosynthesis. If you were to compare the gene sequences for these three plants for ribulose-1,5-bisphosphate carboxylase/oxygenase (RuBisCO) a protein necessary for photosynthesis what would you predict?
The differences betwen gladiolas and snapdragons would most likely be silent mutations wile those in beechdrops may be silent or missense
A particular gene has a mutation in its NFR that causes it to bind abnormally tightly to histones. What effect would you expect this mutation has on the expression of this gene?
The expression of the gene would be abnormally low or absent
You are studying the DNA of a person who you know has two defective copies of the gene that encodes phenylalnine hydroxylase. You are surprised to find that this person also carries two defective copies of the gene for homogentisic acid oxidase. What disease symptoms will this person exhibit?
This person will exhibit symptoms of phenylketonuria [an individual carrying mutations in two different genes involved in the same pathway accumulates compounds like one carrying a single mutation in the gene coding for the enzyme that comes earlier in the pathway; in the phenylalanine breakdown pathway, phenylalanine hydroxlase acts homogentisic acid oxidase]
What would be a set of anticipated results from a "Lederberg" experiment?
Total number of colonies on a plate: 1500 total number of resistant colonies on replica plate with T1:15
What might happen if the insulator between two genes are missing?
Transcription factors influencing one gene's expression may abnormally influence a neighboring gene's expression
If a DNA template is being transcribed in vitro what would be the effect on RNA production if an inhibitor of TFIID was added?
Transcripts being produced would continue but there would be no new initiation [TFIID is only involved in initiation so current transcripts would finish at their current rate, but there would be no new initiation of transcription]
Longer CG repeat sequences favor the conversion of B-DNa to Z-DNA, where high ionic strength is required for the BZ transition of unmodified poly oligomers. The addition of any of the G8 adducts reduce the ionic strength necessary for the Bz transition, supporting that they are promoters of Z-DNA formation.
True
T or F: Because the alternative splicing, a pre-mRNA could generate a dozen different mRNAs.
True
T or F: The process of RNA editing can alter the base sequence of the mRNA following transcription
True
T or F: steroid hormones are an example of an effector which regulates regulatory transcription factor activity.
True
T or F: the genetic code is nearly universal in nuclear DNA from bacterial to mammals.
True
T or F: transcription and translation may occur simultaneously in prokaryotic cells.
True
A mutation in the iron response protein (IRP) that made it incapable of binding iron would result in ______.
constitutive transferrin receptor and no ability to stimulate ferritin expression [this mutation is expected to behave as if there is no iron on the cell so, therefore, there should be constitutive expression of transferrin receptor and no expression of ferritin even on the presence of iron]
Internal loops
internal loops occur when double stranded RNA separate due to no Watson-Crick base pairing between the nucleotides
The wild-type eye color of Drosophila is red. A single-base mutation can occur that produces a white eye color. What statement is correct regarding this mutation?
it is an example of a mutation that likely alters protein function
Which RNA encodes the sequence of amino acids for a functional protein?
mRNA
You are working in a lab studying mRNAs from many different species. You need to distinguish between mRNA in a mixed sample. You begin by having all the mRNAs sequenced, including the mitochondrial mRNAs. You notice the higher number of C to U conversions in the mitochondrial mRNAs form a certain portion of the sample. You conclude that this portion of the sample is from ____.
plants [C to U conversion in mitochondrial mRNAs is common type of RNA editing in plants]
Which types of mutations are least likely to be subjected to natural selection?
silent
You have cloned a gene for a mammalian mitochondrial protein that is rich in tryptophan. If you translate this protein in the cytoplasm rather than the mitochondria, what result do you expect?
the protein will be shorter than its mitochondrial counterpart [the mitochondrial genetic code differs from the nuclear genetic code in certain ways, eg. in vertebrate mitochondria, UGA codes for tryptophan, where its universal meaning is as a stop codon]
In the following sequence of DNA, the italicized base has been mutated. What type of mutation is this. 5'GATCTCCgAATT3' 5'GATCTCCcAATT3'
transversion
