Module 3

Name and describe three different kinds of bacterial cloning vectors.

(1) plasmid: contain a multi-cloning site, origin of replication, and a selectable marker; can carry ~20-25Kb of foreign DNA (2) phage: a virus containing the DNA of interest infects bacteria; is more efficient than plasmid transformation and can carry ~25Kb of foreign DNA (3) cosmid: type of hybrid plasmid that contains plasmid sequences plus the COS sequences from phage for capsid packaging for phage transduction; cosmids form colonies, not plaques; can carry up to ~45Kb of foreign DNA (4) bacterial artificial chromosome or BA: a vector based on the bacterial F-plasmid (fertility plasmid), making its introduction in bacteria more stable than plasmids; typical foreign DNA insert size is in the hundreds of Kb

PCR is necessary for efficient replication of cell's DNA in interphase a technique for amplifying DNA sequences in vitro one of the control elements of the cell cycle None of the above

A technique for amplifying DNA sequences in vitro

Of the DNA sequences below, which would probably be the harder to determine? CGATATATATATATATACGAT GGCATCACGAGCTGCATTCGCA

CGATATATATATATATACGAT

If a restriction enzyme cuts a circular DNA into three fragments, how many restriction sites are there in the DNA? two three four six five

Three

What is a concise definition of proteomics? the process of defining the complete set of proteins encoded by a genome the harvesting of proteins from a cell to determine their economic value the manipulation of amino acid sequences in proteins to alter their function changing the terminal sequences of proteins to alter their function the rational design of drugs based on protein structure

the process of defining the complete set of proteins encoded by a genome

A linear DNA fragment is cut with a restriction enzyme to yield two fragments. There is/are __ site(s) for this enzyme in this fragment.

1

A typical prokaryotic genome has 1 million base pairs of DNA, containing 1000 genes. 1 million base pairs of DNA, containing a few hundred genes. 1000 base pairs of DNA, containing a few hundred genes. 1000 base pairs of DNA, containing a few thousand genes.

1 million base pairs of DNA, containing 1000 genes.

Most of the bacterial genomes described in the text have fewer than 10,000 genes 5,000 base pairs 500 genes 10,000 base pairs 50 genes

10,000 genes

Assume that a plasmid (circular) is 3200 base pairs in length and has restriction sites at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion. 400, 800, 1000 (2 of these) 400, 1200, 1600 300, 700, 2200 700, 400, 1400, 2600 300, 700, 1000, 1200

300, 700, 1000, 1200

The haploid human genome contains about 3 × 109 nucleotides. On average, how many DNA fragments would be produced if this DNA was digested with restriction enzyme PstI (a 6-base cutter)? RsaI (a 4-base cutter)? How often would an 8-base cutter cleave?

4 base cutter = (1/4)^4 = 1/256bp gets cut (3x10^9)/256 = 11,718,750 cuts 6 base cutter = (1/4)^6 = 2.44e-4 ~ 1/5000bp gets cut (3e9/5000) = 600,000 cuts 8 base cutter = (1/4)^8 = 1e-5 ~1/100,000 gets cut (3e9/100000) = 30,000 cuts

The full-length (i.e., containing the entire protein-coding region) cDNA for a specific eukaryotic gene in humans is 1500 nucleotides long. You screen a pig genomic library with this cDNA and isolate two genomic clones of different lengths. Both clones are sequenced and found to be 1900 and 2100 nucleotides long from start codon to stop codon. Screening of genomic libraries of several other organisms reveals that all of them contain only one genomic clone -- pigs seem to be the exception to the rule here. What evolutionary events might have led to the presence of two genomic clones in pigs, and the discrepancies in their length compared to the cDNA probe? How is this representative of a general type of occurrence in molecular genetic evolution?

50% credit: There was likely a duplication of this gene in pigs. 25% credit: After duplication, the gene has diverged. 25% credit: Evolutionary divergence tends to follow gene duplications, as mutations in one gene are no longer selected against as strongly (the presence of a "back up" copy of the gene means the individual will generally have at least one functional copy of the gene product). 25% credit: Alternatively, humans may have lost one copy of this gene. However, this possibility should be ruled out by the fact that pigs seem to be unique in possessing two genomic copies.

Assume that a given plasmid vector to be used in a cloning experiment contains 4000 base pairs of DNA. Assume also that the restriction endonuclease Cuj cuts this plasmid at the following sites (starting from an arbitrary zero point): 1000, 1500, and 3000. Given complete digestion of the plasmid with the endonuclease so that only linear fragments are produced, what sizes of DNA are expected?

500, 1500, 2000

In the genetic map of the human genome, one map unit is approximately 850,000 bp. For the genome of the eukaryotic yeast Saccharomyces cerevisiae, one map unit is approximately 3000 bp. What is a map unit, and why is it so different in these two different types of organisms?

A map unit is the amount of measured recombination between two linked points in a genome. Because one map unit in humans is many more base pairs than in yeast, the amount of homologous recombination per DNA length must be lower in humans than in Saccharomyces cerevisiae.

What is bioinformatics? a technique using 3D images of genes in order to predict how and when they will be expressed a method that uses very large national and international databases to access and work with sequence information a software program available from NIH to design genes a series of search programs that allow a student to identify who in the world is trying to sequence a given species

A method that uses very large national and international databases to access and work with sequence information

Describe the three basic components of a typical plasmid cloning vector and the reason/use for those plasmid vector components.

A typical plasmid vector will have the following components: -Polylinker: First, there will be a multiple cloning site OR polylinker that is "cut" with specific restriction enzymes. The same restriction enzyme can then be used to "cut" templated DNA. When the cut vector and template are mixed together the complementary single stranded regions will anneal to one another and this complementarity is covalently linked using DNA ligase. Once in the vector, the vector is transferred into a bacterial host, where is multiplied. -Antibiotic resistance marker: The vector also contains antibiotic resistance genes so that when growing in the presence of antibiotic, only those bacteria with the vector will be able to grow. -Selectable marker: Lastly, the vector will contain a selectable marker, eg. the lacZ gene. The polylinker is located within this gene, when a template is ligated within the lacZ gene it is made nonfunctional. In the presence of a colorimetric indicator, such as X-gal, which is broken down into a blue byproduct by lacZ, the presence of a template fragment in the plasmid vector is visualized by white bacterial colonies. These colonies can then be chosen for further analysis.

Plasmids are important in biotechnology because they are a vehicle for the insertion of foreign genes into bacteria recognition sites on recombinant DNA strands surfaces for protein synthesis in eukaryotic recombinants surfaces for respiratory processes in bacteria

A vehicle for the insertion of foreign genes into bacteria

What do PCR, reverse transcription, and dideoxy DNA sequencing all have in common? All produce RNA as a product. All produce RNA as a product. All produce lipid as a product. All produce DNA chains as a product.

All produce DNA chains as a product.

In the context of molecular genetics, reverse translation refers to assembling a DNA sequence from an amino acid sequence. assembling an RNA sequence from a DNA sequence. translating in the 3' to 5' direction. transcribing first, then translating. making an amino acid sequence from a DNA sequence.

Assembling a DNA sequence from an amino acid sequence.

Under ideal conditions, how many copies of all the sequences of the host genome should be represented in a genomic library? Why?

At least one should be represented. Typically, library construction includes a several-fold greater number of clones than necessary for one representative of each fragment in order to increase the likelihood of cloning difficult fragments and stochastic loss.

A principal problem with inserting an unmodified mammalian gene into a bacterial plasmid, and then getting that gene expressed in bacteria, is that prokaryotes use a different genetic code from that of eukaryotes bacteria cannot remove eukaryotic introns. bacterial RNA polymerase cannot make RNA complementary to mammalian DNA bacterial DNA is not found in a membrane-bounded nucleus and is therefore incompatible with mammalian DNA

Bacteria cannot remove eukaryotic introns.

For a physical map of a chromosome, distances are measured in units of percent recombination. RFLPs. centiMorgans. base pairs. contigs.

Base Pairs

Mycoplasma are among the smallest and perhaps the simplest self-replicating prokaryotes known. M. genitalium contains a genome of 0.58 Mb. Approximately how many genes does this bacterium contain? about 3000 426,000 12 1200 between 400 and 550

Between 400 and 550

Which of the following are the important proteins needed for cloning a eukaryotic gene into a bacterial plasmid? DNA ligase DNA polymerase restriction enzymes specific for the target genes Both B and C

Both B and C

Match YAC with the best letter choice: a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. foreign DNA k. mRNA l. Agrobacterium tumefaciens

d

List four applications of PCR technology. Do not describe what PCR *does* (well, you can if you want, but you won't get points for it). Instead, list activities or fields in which PCR is useful.

Cell-free cloning Identification of restriction enzyme variants Screening for genetic disorders Diagnostic screening for infectious organisms Forensics Paleobiology

What is comparative genomics? How does its study contribute to our understanding of genetics?

Comparative genomics is a relatively new field involved in identifying similarities and differences in organization and gene content among the genomes of different organisms. Such studies are important for studying the genetic relatedness of species and for identifying gene families.

The Human Genome Project, which got under way in 1990, is an international effort to construct a physical map of the 3.3 billion base pairs in the human genome. collect samples of cells from all parts of the world in order to preserve human genetic diversity. collect plant seeds in order to reduce the impact of human activity on plant extinction. clone deleterious genes from humans and study their mode of action. clone beneficial genes from humans for eventual use in gene therapy.

Construct a physical map of the 3.3 billion base pairs in the human genome.

A bacterial polycistronic transcription unit is one that contains information for one protein product. contains information for more than one protein product. is capped at the 5'end and carries a poly-A tail at the 3'end. is void of start (AUG) and termination (UAA, UGA, UAG) triplets. none of these answers

Contains information for more than one protein product.

A set of overlapping DNA fragments that form a contiguous stretch of DNA is called a _________. chromosome sequence map contig clone

Contig

Restriction endonucleases... are used to randomly digest DNA molecules. are human enzymes. are all genetically engineered. cut DNA at specific sequences.

Cut DNA at specific sequences.

It is common to use ddNTPs (dideoxyribonucleoside triphosphates) in which of the following biochemical reactions? citric acid cycle DNA sequencing restriction digestion electron transport plasmolysis

DNA Sequencing

It is common to use ddNTPs (dideoxyribonucleoside triphosphates) in which of the following biochemical reactions? citric acid cycle DNA sequencing restriction digestion electron transport plasmolysis

DNA sequencing

Fluorescent Sanger dideoxy sequencing methods uses what method to discriminate between the 4 different nucleotides? Centrifugation sedimentation gradient. Fluorescently labeled dNTPs Fluoresently labeled dATP. Different fluorochromes attached to the four different ddNTPs.

Different fluorochromes attached to the four different ddNTPs.

Explain why the genetic map distance between two genes on the same chromosome may be inconsistent with the physical map distance. E.g., for three loci A, B, and C, on the same chromosome, explain why the genetic distance might be A-[20 centimorgans]-B-[20 cM]-C, while the physical distance might be A-[200 kilobases]-B-[100 kb]-C.

Different regions of the chromosome will be more prone to recombination than others.

The set of all proteins encoded by the genome is called the _______ . genome transcriptome metabolome proteome pharmacogenome glycome

Proteome

Restriction endonucleases are typically used to clone genes. What factors determine the sites at which these endonucleases will cleave DNA? What characteristics do these sites tend to have?

Each RE will cleave at a specific sequence. These sequences tend to be short (4-8 bp), and tend to be palindromic (e.g., GAATTC).

The PCR (polymerase chain reaction) protocol that is currently used in laboratories was facilitated by the discovery of a bacterium called Thermus aquaticus in a hot spring inside Yellowstone National Park, Wyoming. This organism contains a heat-stable form of DNA polymerase known as Taq polymerase, which continues to function even after it has been heated to 95 degrees C. Why would such a heat-stable polymerase be beneficial in PCR? Each cycle includes a "hot" saturation phase (95oC), which allows the primers to anneal to the target DNA. Each cycle includes a "hot" denaturation phase (95oC), which serves to sterilize the culture. Each cycle includes a "hot" denaturation phase (95oC), which activates the Taq polymerase. Each cycle includes a "hot" denaturation phase (95oC), which separates the hydrogen bonds that hold the strands of the template DNA together. More than one of these answers is correct.

Each cycle includes a "hot" denaturation phase (95oC), which separates the hydrogen bonds that hold the strands of the template DNA together.

Mario Capecchi, Sir Martin Evans, and Oliver Smithies recently won a Nobel Prize for gene targeting (gene knockouts) in mice. Describe the steps involved in creating a knockout mouse.

Embryonic stem (ES) cells heterozygous for a knockout mutation in a gene of interest (X) and homozygous for a marker gene (here, black coat color) are transplanted into the blastocoel cavity of 4.5-day embryos that are homozygous for an alternate marker (here, white coat color). The early embryos then are implanted into a pseudopregnant female. Some of the resulting progeny are chimeras, indicated by their black and white coats. Chimeric mice then are backcrossed to white mice; black progeny from this mating have ES-derived cells in their germ line. By isolating DNA from a small amount of tail tissue, it is possible to identify black mice heterozygous for the knockout allele. Intercrossing of these black mice produces individuals homozygous for the disrupted allele, that is, knockout mice

Briefly discuss general trends relating to DNA content and gene number in major groups of organisms. How do eukaryotes and prokaryotes differ in regard to gene number and organization? As a general rule, what can be said about the genomes of more complex eukaryotes vs. less complex eukaryotes? If two species are very closely related, what can be said about the relative sizes of their genomes?

Eukaryotes contain more DNA in their genomes than bacteria and exhibit a wide variation of DNA amount among different groups. Evolutionary expansion has been accompanied by increased amounts of DNA, with more "complex" forms containing more DNA than less complex forms. Such change in DNA content is not universally accompanied by increases in gene number. Some closely related species may vary more than tenfold in their DNA content.

Describe one major difference in the organization or content of prokaryotic and eukaryotic genomes.

Eukaryotic genomes contain repetitive DNA that is largely absent in prokaryotic genomes. -or- Genes are more densely spaced in prokaryotes versus eukaryotes -or- prokaryotic genomes typically encode fewer genes than eukaryotic genomes Other answers are acceptable, provided they are true and make sense.

There are different challenges that exist for sequencing prokaryotic and eukaryotic genomes. Which challenge is correctly paired with the type of genome to which it relates? Prokaryotic: presence of plasmids Prokaryotic: repetitive DNA Eukaryotic: repetitive DNA Eukaryotic: ESTs Eukaryotic: circular DNA

Eukaryotic: repetitive DNA

A BLAST search is done to find similar gene or protein sequences. find the chromosomal location of a sequence. predict the three-dimensional structure of a protein from its amino acid sequence. find restriction sites and SNPs in a sequence. determine the conditions under which a gene is expressed.

Find similar gene or protein sequences.

Crossing over is often reduced around centromeric regions of chromosomes. If you were trying to construct a genetic map of two linked marker loci in this region, what result might you obtain and why? How would the genetic map correspond to the physical map?

Genes mapped based on recombination will appear to be very close together in centromeric regions due to low rates of recombination. Distances between the same genes on the physical map may be much greater when compared to other regions of the chromosome.

This term refers to the work undertaken by large teams of researchers who, through a concerted effort, clone and sequence the DNA of a particular organism.

Genome Project

This is the study of "genes in their entirety."

Genomics

List two especially useful characteristics of cloning vectors. high copy number and antibiotic resistance gene(s) virulence and lysogenicity ability to integrate into the host chromosome and then cause a lytic cycle nonautonomous replication and transposition reverse transcriptase and ligase activities

High copy number and antibiotic resistance gene(s)

Explain why the greatest diversity of human SNPs is found among African people.

Humans are thought to have first evolved in Africa. This means that any distinct population of humans (however defined) arose from a subset of the African population that became geographically isolated. Thus, any SNPs in this population arose from precursors that were already present in the African population, and another branch of those ancestral SNPs' descendents is likely still extant in the African population. Basically, for any SNP "family" in a distinct human Population X, the African population probably has a SNP family very similar to that one, plus several others with no clear analogue in Population X.

Nucleic acid blotting is widely used in recombinant DNA technology. In a Southern blot one generally hybridizes filter-bound DNA with a DNA probe. hybridizes filter-bound RNA with a DNA probe. examines amino acid substitutions with radioactive probes. cleaves RNA with restriction endonucleases. ligates DNA with DNA ligase.

Hybridizes filter-bound DNA with a DNA probe.

Nucleic acid blotting is commonly used in molecular biology. Two types, Southern blots and northern blots, involve gel electrophoresis and a filter, which holds the nucleic acid. Briefly describe the procedure of "blotting" in this context and differentiate between Southern and northern blots.

In a Southern blot the DNA to be "probed" is cut with a restriction enzyme(s); then the fragments are separated by gel electrophoresis. Alkali treatment of the gel denatures the DNA, which is then "blotted" onto the filter (nylon or nitrocellulose). A labeled probe (RNA or DNA) is then hybridized to complementary fragments on the filter. In a northern blot, RNA is separated in the gel and "probed" with the labeled DNA.

All of the following are characteristics of the genomics revolution EXCEPT_____________ Large scale acquisition of DNA sequences Ability to conduct discovery-based research Enabled reverse genetics approach to genetics research Facilitated collaborative research networks Inability to understand single genes

Inability to understand single genes

The first commercial production of what human enzyme led to the explosion of the biotechnology industry? Polynucleotide Phosphorylase Inuslin Amylase Lactose Dehydrogenase

Insulin

Which of the below are not steps in the production of genome sequence maps: Read the sequence of individual piece of the genome. Isolate whole chromosomes. When sequences are obtained, assemble and organize the sequences in order. Identify molecular markers on specific chromosomes. All of these are steps you would use.

Isolate whole chromosomes.

What might be a reasonable function of restriction endonucleases in a bacterium, distinct from their use by molecular biologists?

Isolated from bacteria, restriction endonucleases restrict or prevent viral infection by degrading the invading nucleic acid of the virus.

The human genome contains approximately 20,000 protein-coding genes, yet has the capacity to produce several hundred thousand gene products. What can account for the vast difference in gene number and product number? It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing. There are more introns than exons. There are more exons than introns. Much of the DNA is in the form of trinucleotide repeats, thus allowing multiple start sites for different genes. Every gene can be read in both directions, and each gene can have inversions and translocations.

It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing.

Typically, bacterial DNA contains_____ (more or less?) repetitive DNA than eukaryotic DNA.

Less

When propagating a clone in the lambda phage, would you have more immediate success if the phage entered the lysogenic or the lytic cycle?

Lytic Cycle

A map of the order, overlap, and orientation of physically isolated pieces of the genome.

Physical Map

A _______________ family is a group of evolutionarily related genes that arose through repeated evolution of an ancestral gene.

Multigene

Some vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. What term is given to this advantageous arrangement of restriction sites? palindrome consensus sequence multiple cloning site β-galactosidase complementation

Multiple cloning site

A ddNTP, used often in DNA sequencing, lacks a(n) ________ at the ________ and ________ carbons. OH, 2', 3' methyl, 2', 3' carboxyl, 5', 3' OH, 2', 5' None of these are correct.

OH, 2', 3'

In general, the organization of genes in bacteria is different from that in eukaryotes. In E. coli, approximately 27 percent of all genes are organized into contiguous, functionally related units containing multiple genes under coordinate control that are transcribed as a single unit. Such contiguous gene families are called transcriptomes proteomes contigs operons pseudogenes

Operons

Two genes that evolved from the same common ancestral gene, but are now found as homologs in different organisms are called _______________ .

Orthologs

Words such as did, mom, and pop have something in common with the fundamental tool of recombinant DNA technology. In the context of recombinant DNA technology, which term would be used to describe such words? lysogenic prototrophic palindromic conjugation insertion

Palindromic

What is meant by the term pseudogene?

Pseudogenes are nonfunctional versions of genes that resemble other gene sequences but that contain significant nucleotide substitutions, deletions, and duplications that prevent their expression. Pseudogenes are designated by the prefix (psi).

What is recombinant DNA technology? What are the safety issues related to recombinant DNA technology?

Recombinant DNA technology refers to the creation of new combinations of DNA molecules that are not normally found in nature. Safety issues generally center around the creation and release (accidental or intentional) of genetically engineered organisms that are a threat to human health or animals and plants in the environment. Many organisms that are "genetically engineered" carry genes for antibiotic resistance.

Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the fragments contains the DNA piece of interest. This problem is solved by Knowing the isoelectric points of the piece in question. Measuring the sizes of the bands on the gel Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest Identifying the molecular weights of the fragments in question None of the above

Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest

What is the name of the process by which bacterial colonies (cells) are transferred from one agar plate to another, maintaining the same spatial pattern?

Replica Plating

Which of the following enzymes is used to make complementary DNA (cDNA) from RNA? DNAse gene cloning hydrogen sulfide reverse transcriptase isolation of stem cells from a lamb embryo and production of a zygotic equivalent

Reverse Transcriptase

Which technique would NOT be used to find a gene for a functional protein in a sequenced region of a genome? Scan the region for ORFs. See if an EST database contains sequences in the region. See if a SNP database contains sequences in the region. Scan the region for promoter sequences. Scan the region for intron splice sites.

See if a SNP database contains sequences in the region.

As a model system, what are three of the advantages of the mouse as a model system?

Short generation time • Produce abundant progeny • Readily mutagenized and crossed. Mice have similar body plans and stages of development as humans • Similar genome size and number of chromosomes to humans

Restriction endonucleases are especially useful if they generate "sticky" ends. What makes an end sticky? single-stranded complementary tails blunt ends poly-A sequences 5' cap interference

Single-stranded complementary tails

Compared with eukaryotic chromosomes, bacterial chromosomes are large, mainly organized in monocistronic transcription units without introns. small, mainly organized in monocistronic transcription units with introns. large, mainly organized in polycistronic transcription units without introns. small, with high gene density. large, triple-helix, Z-DNA, organized in monocistronic units with introns.

Small, with high gene density

Intron frequency varies considerably among eukaryotes. Provide a general comparison of intron frequencies in yeast and humans. What about intron size?

The entire yeast genome has only about 240 introns, whereas some single genes in humans contain over 100 introns. In general, smaller genomes have smaller intron size in addition to lower intron number.

What two factors contribute significantly to the wide ranges of genome size among eukaryotes?

The presence of introns and repetitive sequences is a major contributor, as are the differences in the number of genes.

When two proteins show a 50 to 70 percent match in amino acid sequence, it is likely that the two proteins have identical functions. the two proteins have no common origin. the two proteins share a common ancestry. the two proteins have identical tertiary structures. the primary structures may differ, but the secondary structures are identical.

The two proteins share a common ancestry.

Describe the organization of the α-globin gene cluster in humans. Roughly how large is this cluster? How many genes are present? Briefly describe these genes.

The α-group spans more than 30 kb and contains three genes: zeta and two copies of the alpha gene. In addition, two nonfunctional pseudogenes are in the group. Most of the DNA in this region consists of intergenic spacer DNA.

Why are telomeres and centromeres particularly difficult to sequence?

They consist of highly repetitive DNA, and so strand slippage issues can confuse the determination of a consensus sequence.

What is the enzymatic function of restriction enzymes? to add new nucleotides to the growing strand of DNA to repair breaks in sugar-phosphate backbones to cleave nucleic acids at specific sites to join nucleotides during transcription.

To cleave nucleic acids at specific sites

What is the purpose of a cDNA library? To produce a library of all genomic DNA of an organism. To produce a library of expressed genes. To replicate the genomic DNA. To produce a library of chloroplast genes.

To produce a library of expressed genes.

The difference between a genetic screening experiment and a selection experiment is that a screening experiment involves ________, whereas a selection experiment creates conditions that ________ irrelevant organisms. complementation analysis, enhance temperature extremes, enhance epistasis analysis, enhance visual examination, eliminate chemical removal, activate

Visual examination, eliminate

The lungfish Protopterus aethiopicus has a genome 38 times larger than that of humans. Most of the DNA in this species is noncoding repetitive DNA. How could you create a library of clones that would let you compare just the genes in the lungfish to the genes in humans?

You could generate cDNA libraries and compare the transcribed regions of the genome.

Match expression vector with the best letter choice: a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. foreign DNA k. mRNA l. Agrobacterium tumefaciens

b

Write the letter all of the following statements that are NOT true. a. Coding sequences for gene products can be isolated from cDNA libraries. b. Antibodies are used for Northern blot analysis. c. VNTRs are highly conserved in human populations. d. PCR amplification generates large numbers of linear DNA fragments. e. RNA molecules can be used as hybridization probes in Southern blot analysis.

b, c

What are three key differences between a genomic and a cDNA library?

cDNA lib. represents only transcribed regions of the genome; all genes equally represented in genomic library while cDNA library reflects the level of expression of a gene in a particular cell type or tissue ; cDNA library contained only sequences found in the mature mRNA - introns are removed

Restriction endonucleases... are used to randomly digest DNA molecules. are human enzymes. are all genetically engineered. cut DNA at specific sequences

cut DNA at specific sequences

Match shuttle vector with the best letter choice: a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. foreign DNA k. mRNA l. Agrobacterium tumefaciens

e

During gel electrophoresis, __ will migrate more rapidly than __. a. cloning vectors b. ethidium bromide c. large DNA fragments d. DNA size markers e. small DNA fragments

e, c

One of the primary reasons for generating a large number of clones in a eukaryotic genomic library is that each cosmid replicates nonautomously. lysogenic phages continue to integrate their DNA into the host chromosome, thus reducing the number of desired recombinant clones. each vector can take up only a relatively small fraction of the eukaryotic DNA. each ligation product is sequence specific. the host range of the vector is limited.

each vector can take up only a relatively small fraction of the eukaryotic DNA.

Match PCR with the best letter choice: a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. foreign DNA k. mRNA l. Agrobacterium tumefaciens

f

Match real-time PCR with the best letter choice: a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. foreign DNA k. mRNA l. Agrobacterium tumefaciens

g

Match ß-galactosidase with the best letter choice: a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. foreign DNA k. mRNA l. Agrobacterium tumefaciens

i

Match transgene with the best letter choice: a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. foreign DNA k. mRNA l. Agrobacterium tumefaciens

j

Compared with prokaryotic chromosomes, eukaryotic chromosomes are large, mainly organized in monocistronic transcription units without introns. small, mainly organized in monocistronic transcription units with introns. large, mainly organized in polycistronic transcription units without introns. small, mainly organized in polycistronic transcription units without introns. large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns.

large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns.

Assume that one conducted a typical cloning experiment using pUC18, transformed an appropriate host bacterial strain (one carrying the lacZ complementing region), and plated the bacteria on an appropriate X-gal medium. Blue and white colonies appeared. Which of the two types of colonies, blue or white, would most likely contain the recombinant pUC18? Explain your answer.

the white colonies because of insertional inactivation of the lacZ component