Molgen 4500 Final

अब Quizwiz के साथ अपने होमवर्क और परीक्षाओं को एस करें!

What are three ways in which gene regulation is accomplished by modifying the structure of chromatin?

(1) the modification of histone proteins (2) chromatin remodeling (3) DNA methylation.

Albinism, lack of pigmentation in humans, results from an autosomal recessive gene (a). Two parents with normal pigmentation have an albino child. What is the probability that their next three children will be albino?

(1/4) chance of albinism in each child, by three children =(1/8)^3= (1/64)

11. Albinism, lack of pigmentation in humans, results from an autosomal recessive gene (a). Two parents with normal pigmentation have an albino child. What is the probability that their next child will be an albino girl?

(1/4)x(1/2)= 1/8

Below is a list of terms, each term relating to the replication of chromosomes. Describe the role (relationship) of each in (to) chromosome replication. (a) Okazaki fragment (b) Lagging strand (c) Bidirectional

(a) Okazarki Fragment- Fragments of the lagging strand, which are transcribed in "sections" due to their 3' end facing away from the replication fork. (b) Lagging Strand- Transcribed at multiple locations due to it's 3' end facing away from the replication fork, replicationg away from it as well. (c) Bidirectional- Takes place in bacterial DNA, the ring structure unwinds and replicates in both directions.

Population genetics is concerned with: Question options: how genes produce proteins. how genes confer relative reproductive success on the individuals. whether allele frequencies are changing over time. how genes interact with one another. (b) and (c) above.

(b) and (c)

character traits

(different alleles) alternative forms of a gene that are usually recognized by phenotypes

contrasting trait

(different alleles) alternative forms of a gene that are usually recognized by phenotypes

A segment of DNA from Drosophila melanogaster has the sequence: 5' TCA AGC TTA AGA AGG CAT TTT 3' (i) Assuming that this is the template strand, what is the sequence of the encoded mRNA (make sure to denote 5' and 3' ends of the transcript)? (ii) If, contrary to section (i), the sequence shown above is the coding strand, what is the sequence of the encoded mRNA? Again, be sure to denote 5' and 3' ends of the transcript

(i) 3' AGU UCG AAU UCU UCC GUA AAA 5' (ii) 5' UCA AGC UUA AGA AGG CAU UUU 3'

(i) What is the name of the structure shown below? Be sure to name the structure, not the molecule itself. (ii) What is its function in transcription? (iii) What is the probable base composition of the region marked by the "A" arrow? (iv) What is the probable base composition of the region marked by the "B" arrow? (v) If the region marked with the "B" arrow was mutated to: GGCCGGTGC, what effect would this have and why? q8.2k

(i) Hairpin loop (ii) Terminates transcription in prokaryotes (iii) G/C rich (iv) String of U's (v) Transcription might not be terminated because there will be a bunch of triple bonds rather than double bonds. This will keep the RNA from dissociating from the template DNA and allow transcription to continue.

(i) Hairpin loop. (ii) Terminates transcription in prokaryotes. (iii) G/C rich (iv) String of U's (v) Transcription might not be terminated because there will be a bunch of triple bonds rather than double bonds. This will keep the RNA from dissociating from the template DNA and allow transcription to continue.

Mutations can be either recessive or dominant to the wild type. For each of the following examples, determine if the mutation would most likely be recessive or dominant. Explain your reasoning. (i) Mutation that disrupts the active site of an enzyme ii) Over expression of an enzyme

(i) Recessive. The wild type allele is functional, while the mutated allele does nothing. If brought together in a heterozygote, the functional allele would mask the nonfunctional allele. Thus, the mutation is recessive. (ii) Dominant. Whereas the wild type allele is expressed only at the appropriate level and time, the mutated allele is expressed at higher levels and/or at inappropriate times. Thus, the hyperactive mutated allele will mask the wild type allele in a heterozygote.

Other than genes, name three regions of a chromosome. What are their functions Which of them represents euchromatin? Heterchromatin?

-Centromere - the attachment point for spindle microtubules (heterochromatic) - Telomeres - natural ends, the tips of linear chromosomes that serve to stabilize the chromosome (Heterochromatic) - Origin of replication - where DNA synthesis begins (euchromatic)

List three different sex determination systems

-Chromosomal sex-determining- Genic sex-determining- Environmental sex-determining

Kornberg used the phage PhiX174 to demonstrate DNA pol I was able to produce biologically active DNA in vitro. Briefly describe the experimental methods that he used to draw the conclusions that DNA pol I could produce biologically active DNA.

-Initial (+) strand of PhiX174 was labeled with 3H, added to DNA pol 1, ligase, bromouracil and 32P labeled dNTP to produce (-) strand -dsRF was nicked, made single stranded, and new (-) strand was isolated following centrifugation. -(-) strand was used with DNA pol 1, ligase, unlabeled dNTPs to produce a new (+) strand in vitro. -new (+) strand was successfully used to infect E coli and produce new infectious PhiX174 phage particles -demonstrated that DNA pol 1 was capable of producing biologically active DNA in vitro

snRNA?

-Small nuclear RNA -Found in the nucleus -Uridine rich (given names U1, U2, etc.) -alternatively remove introns to create alternate mRNA (isoforms)

RNA differs from DNA in that it:

-has uracil rather than thymine -is usually single-stranded rather than double-stranded -has ribose sugars rather than deoxyribose sugars in its nucleotides.

If 64% of the people in a population are blue-eyed and the population is in Hardy-Weinberg equilibrium, what is the percentage of heterozygotes in the population? a. 32% b. 36% c. 16% d. 20% e. It cannot be determined from these data.

...32

What is the probability of obtaining 3 heads in four flips of a fair coin?

.25

In a human population, the genotype frequencies at one locus are 0.5 AA, 0.4 Aa, and 0.1 aa. The frequency of the A allele is: Question options: 0.20 0.32 0.50 0.70 0.90

0.70

Pleiotropy occurs when

1 gene influences multiple phenotypic traits

In a tropical human population in Hardy-Weinberg equilibrium for an autosomal locus determining presence/absence of pigment in the skin, the frequency of albinism (aa) is 1 in 10,000. The frequency of heterozygotes is approximately: Question options: 1 in 50 1 in 100 1 in 1000 1 in 75 1 in 25

1 in 50

Describe at least two reasons why testing for a genetic condition might be advantageous.

1) Allows people to make informed decisions about reproduction 2) Allows early intervention that may lessen or even prevent the development of conditions.

Fill in the blanks in the "level of transcription" column of this table with: + for high levels of transcription, and - for minimal levels of transcription of the lac operon. Consider regulation by both the lac repressor and CAP (catabolite activator protein). The strain is wild type, with no partial diploidy. 1. high glucose, no lactose 2. no glucose, high lactose 3. high glucose, high lactose 4. no glucose, no lactose

1. - 2. + 3. - 4. -

Fill in the blanks in the "level of transcription" column of this table with: + for high levels of transcription, and - for minimal levels of transcription of the lac operon. Consider regulation by both the lac repressor and CAP (catabolite activator protein). The strain is wild type, with no partial diploidy. Please label your answer with numbers 1-4 based on the chart below. Medium conditions Level of transcription 1high glucose, no lactose 2 no glucose, high lactose 3high glucose, high lactose 4no glucose, no lactose

1. - 2.+ 3.- 4.-

Name at least four structural predictions made by Watson/Crick's DNA model?

1. 2 polynucleotide chains coiled around a center axis forming a double helix 2. The two chains are anti-parallel, running 3-->5 in oppisite directions on each strand 3.Bases lay flat, perpindicular to the axis, stacked on one another 3.4 angstroms apart 4.Nitrogenous bases of oppisite strand are paired as a result of hydrodgen bonds. 5. In the chain there are major grooves alternating with minor grooves 6.Each double helix is 20 angstroms in diameter

Explain at least two reasons why the following definition of a gene is inadequate: "A gene consists of DNA sequences that are transcribed into a single RNA molecule that encodes a single polypeptide."

1. A single gene can encode for more than one protein through alternative splicing. Multiple RNA molecules can come from a single DNA sequence. Polycistronic RNA (in prokaryotes)- multiple proteins from single RNA transcript. 2. DNA can be transcribed multiple times into RNA molecules. (When the DNA sequences are transcribed into mRNA, that pre-mRNA molecule must undergo splicing, or the removal of introns, before leaving the nucleus and being translated. Alternative splicing causes differences in the final RNA molecule that will encode for the polypeptide, meaning that slightly different polypeptides will be made from the DNA sequence. Depending on where a start codon is located in a DNA sequence, initiation of transcription can start at different locations, creating different mRNA molecules).

Which of the following relations will be found in the percentages of bases of a double-stranded DNA molecule? 1. A+G=T+C 2. A+C=G+T 3. A+T/A+G = 1.0 4. A+G/C+T = 1.0 5. A/C = G/T 6. A/G = T/C 7. A/T = G/C 8. A+T=G+C

1. A+G=T+C - Yes 2. A+C=G+T - Yes 3. A+T/A+G = 1.0 - No 4. A+G/C+T = 1.0 - Yes 5. A/C = G/T - No 6. A/G = T/C - Yes 7. A/T = G/C - Yes 8. A+T=G+C - No

Describe, in order, the steps usually followed in producing recombinant DNA molecules in a plasmid vector.

1. Cut both DNA and plasmid with the same restriction enzymes 2. Introduce these in the presence of DNA ligase which will seal them to create recombinant DNA. 3. Introduce recombinant DNA to a host through transformation or electropartition. 4. Hosts that take up vectors can then be tracked using a selectable marker gene(typically an antibiotic resistance gene) 5. They can then be placed in a solution contaning X-Gal in which blue and white colonies will distingusih between these infected and not.

Avery, McLeod, and McCArthy continued

1. DNA was the transforming molecule 2. Use protease to determine that Protein is not causing the transformation 3. Treat with RNase and transformation still occurs 4. Treat with DNase no transformation

Watson-Crick

1. Develop model 2. Right handed double helix 3. Major and Minor grooves

Hershey-Chase Experiment

1. Labels were P32 and S35 2. Labeled phages 3. Only Phages labeled with P32 were present in Ecoli 4. S35 phage ghost

DNA association

1. Repetitive DNA associates fastest and first the Unique DNA 2. Longer the association time larger Gnome size 3. Reflect complexity

List 2 methods that we have discussed used to map human genes.

1. Somatic cell hybridization-uses mouse cell and human cell combines and loses all but a few of human chromosomes 2.FISH (Fluorescent in situ hybridization)- Use mRNA to generate DNA, Label ssDNA and where the florescent is the gene location 3.Lod Score Method (Logarithm of Odds) through pedigree

Answer the following questions about standard PCR: 1) What enzyme is required for PCR? State the specific name of the enzyme, not just the type of enzyme. 2) Apart from the enzyme, what 3 DNA molecules are required (give the technical names by which they are called)? What must be true about the sequences of these molecules? Note that dNTPs are individual nucleotides, not DNA molecules. 3) Name the three basic steps of PCR and describe the molecular processes that occur in each. How is each step induced? 4) How does this system work to amplify DNA?

1. Taq polymerase 2. deoxyribonucleoides, oligonucleotides, target DNA sequence 3. Denaturation: Temperature is raised to a high heat so that double stranded molecules become single stranded. Annealing/Hybridization: When temperature is lowered primer complementarily anneals to the denatured single strand. extension: primers extedn in the 5'-->3' direction as nucleotides are added and eventually ligase seals 4.The system works to amplify DNA, by the addition of enzymes to the targeted region which allow it to be flanked, then synthesized by the Taq polymerase. After each trial the taregt region is synthesized at an exponential rate.

What two factors contribute significantly to the wide ranges of genome size among eukaryotes?

1. The presence of introns and repetitive sequences 2. differences in the number of genes

Mendels Postulates

1. Unit factors(alleles) exist in pair 2. One unit factor is Dominant, the other recessive 3. Paired unit factors segregate randomly

Frederick Griffith

1. Use of mice and pneumonia 2. Transforming Principle experiment 3. Heat killed virulent IIIS (with capsule S shiny) and IIR (without capsule R) kill mouse

why is it important for cyclin proteins to vary in concentration throughout the cell cycle?

1. cyclins are proteins that kinases bind to in order to be activated (cdk or cyclin dependent kinases) 2. result in variable phosphorylation by kinases and different results/effects depending on point I cell cycle

Fill in the blanks in the "strain genotype" column of the following table. Write chromosomal genotypes with no partial diploidy. (+) means transcription of the lac operon. (-) means no transcription of the operon. The first line is filled in for reference. Please label your answers 1-3. Include the strain genotype for lacI, lacP, lacO, lacZ, and lacY Strain genotype Lactose absent Lactose present 1 - + 2 + + 3 - -

1. lacI+,lacP+, lacO+, lacZ+,lacY+ 2. lacI+, lacP+,lacOc, lacZ+, lacY+ 3. lacIs, lacP+, lacO+, lacZ+, lacY+

RNA virus

1. ssRNA-Retrovirus a. Reverse transcriptase b. RNA to DNA 2. Provirus a. Newly made DNA incorporated into genome 3. May cause cancer

What are the three classes of "functional" (non-mRNA) RNAs? Briefly describe the role of each class of functional RNA.

1. tRNA- Brings the correct Amino Acid to the mRNA during translation. 2. rRNA- Major component of ribosomes 3. snRNA- Helps process RNA transcripts

10. List four terms used to describe the normal morphologies, with respect to arm ratio, of eukaryotic chromosomes.

1. telocentric 2.acrocentric 3.metacentric 4.submetacentric

A geneticist is examining a culture of fruit flies and discovers a single female with strange spots on her legs. The new mutation is named melanotic. When a female melanotic fly is crossed with a normal male, the following progeny are produced: 123 normal females, 125 melanotic females, and 124 normal males. In subsequent crosses with normal males, melanotic females are frequently obtained, but never any melanotic males. Provide a possible explanation for the inheritance of the melanotic mutation. (Hint: The cross produces twice as many female progeny as male progeny.)

1. trait is sex-linked (sex-limited) because of the difference in numbers of a particular phenotype between sexes 2. lethal dominant X-linked allele in male conditions 3. large difference in the ratio between males and females in the F1 generation (2 females:1 male)

Kornberg used the phage PhiX14 to demonstrate DNA pol I was able to produce biologically active DNA in vitro. Describe in sufficient detail the experimental methods that he used to draw the conclusions that DNA pol I could produce biologically active DNA.

1.) tridium labeled the positive strand 2.)Create a (-) strand:bromouracil, 32P, POLI 3.) Centrifuge out (-) strand 4.) Create new, non-radioactive (+) strand:No bromouracil, no 32P 5.) Centrifuge out new positive strand and transfer 6.) Phages reproduce in new bacteria

Protein synthesis in Prokaryotes

1.Initiation: ssu (small subunit) rRNA binds to initiation factor, then to mRNA at Shine-Delgarno sequence, AUG calls for amino acid formylmethionine at the P site, sets reading frame, Large subunit binds, second binding site for charged tRNA 2. Elongation: P site tRNA shifts to E site and releases, grows by 1 amino acid at a time, continues until a stop codon is reached 3. Termination: Stop codon signals release

In the following tetrahybrid cross AaBbCcDd x AaBbCcDd what proportion of the F2 offspring would be expected to be genotypically AaBbCcDd?

1/16

For a particular plant, red flowers (A) are dominant over yellow flowers (a). An initial cross was made between a plant that was true-breeding for red flowers, and another plant true-breeding for yellow flowers. F1 progeny, all having red flowers, were allowed to form seeds, which were then planted to generate F2 progeny. Pollen from all the resulting F2plants was pooled and used to fertilize true-breeding yellow plants. What proportion of the progeny resulting from this cross would be expected to have yellow flowers?

1/2

In the following cross, what proportion of individuals will have the Bombay phenotype?AB Hh x Ab Hh

1/4

What are three of the characteristics of an autosomal recessive trait that are observed in a pedigree analysis?

1/4 chance kids will recieve the trait equal chance in males and females parents dont have to be infected to pass it on

10% recombination is equal to how many map units?

10 mu

If they live long enough what will the penetrance be of individuals carrying the Huntingtons Disease allele

100%

In snapdragons, heterozygotes for one of the genes have pink flowers, whereas homozygotes have red or white flowers. When plants with red flowers are crossed with plants with white flowers, what proportion of the offspring will have pink flowers?

100%

Under certain conditions, the rate of mutation of a particular gene may be determined in humans. What properties of the mutation would favor the most direct determination of mutation rate in humans? Select all that apply: recessive 100% penetrant X-chromosome fully expressed dominant

100% pentrant X-chromosome fully expressed dominant

Cytosine makes up 38% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be thymine? a) 12 b) 38 c) 31 d) 24

Narrow-sense heritability for IQ scores has been estimated as 0.4. If the mean IQ score in the population is 100, what is the predicted IQ for a child whose parents both had IQ scores of 150?

120

If a typical somatic cell has 32 chromosomes, how many chromosomes are expected in each gamete of that organism?

A diploid somatic cell from a rat has a total of 42 chromosomes (2n = 42). As in humans, sex chromosomes determine sex: XX in females and XY in males. Reference: Ref 2-1 What is the total number of telomeres in a rat cell in G2?

168

An organism has a T content of 31%. What is the percentage for C?

What types of phenotypic ratios are likely to occur in crosses when dealing with a single gene pair where all the genotypic combinations are of equal viability? 2:3, 1:2 1:2:1, 3:1 1:4:6:4:1, 1:1:1:1 9:3:3:1, 27:9:9:9:3:3:3:1 12:3:1, 9:7

1:2:1; 3:1

Mitosis ends with __, while meiosis ends with ___.

2 diploid cells; 4 haploid cells.

A diploid somatic cell from a rat has a total of 42 chromosomes (2n = 42). As in humans, sex chromosomes determine sex: XX in females and XY in males. What is the total number of chromosomes in a polar body cell from a rat?

If a typical somatic cell has 44 chromosomes, how many chromosomes are expected in each gamete of that organism? 18 22 72 88 44

An organism has a G content of 32%. What is the percentage for A?

If a crossover event happened in one half of all tetrads, how many recombinant gametes would be produced?

25%

A trihybrid cross is a cross between two individuals who are heterozygous for three genes. For example: AaBbCc x AaBbCc. Assuming these three genes are unlinked and assorting independently, what segregation ratio would be observed?

27:9:9:9:3:3:3:1

An organism has a haploid number of 6, how many possible assortments of chromosomes are possible based on the independent assortment of the chromosomes?

2^6 = 64

Flower diameter in sunflowers is a quantitative trait. A plant with 6-cm flowers, from a highly inbred strain, is crossed to a plant with 30-cm flowers, also from a highly inbred strain. The F1 have 18-cm flowers. F1 × F1 crosses yield F2 plants with flowers ranging from 6 to 30 cm in diameter, in approximately 4-cm intervals (6, 10, 14, 18, 22, 26, 30). Reference: Ref 24-1 The number of different genes influencing flower diameter in this plant is Question options: 3. 4. 5. 6. 7.

18. Round (R) seed shape is dominant to wrinkled (r) seed shape in pea plants. If an RR plant is crossed with an rr plant, what is the frequency of phenotypes in the F2 generation? a) ¼ RR, ½ Rr, ¼ rr b) All wrinkled seeds c) 3 round seeds, 1 wrinkled seed d) All round seeds

3 round seeds, 1 wrinkled seed

How many nucleotides would be expected for a gene coding for a protein with 300 amino acids? 300 100 600 1200 900

3 x 300 = 900

In transcription, nucleotides are always added to the _____end of the elongating strand.

Type the complementary strand to the following single-stranded DNA. (Be sure to read instructions on which way to write strand, 5' to 3' or 3' to 5') 5' - ATAGCATGGGCCATACGATTACTGA - 3'

3' TATCGTACCCGGTATGCTAATGACT 5'

When codons that code for the same amino acid differ in their ________, a single tRNA might bind both of them through wobble base pairing. 5' base middle base 3' base

3' base

Write the anticodon, with correct polarity, of all tRNAs that will bind to the mRNA codon 5' UCG 3', considering wobble-base pairing rules.

3'-AGC-5'

BamHI cuts the sequence 5′ G|GATCC 3′. Which of the following sequences would NOT be recognized by this enzyme? a) 5′ AGCGGATCC 3′ b) 3′ TCCTTAAG 5′ c) 3′ CCTAGGATC 5′ d) 5′ AGGATCCGTA 3′

3'TCCTTAAG5'

Drosophila passes through______larval stages and a ____before developing into an adult fly.

3, pupa

Flower diameter in sunflowers is a quantitative trait. A plant with 6-cm flowers, from a highly inbred strain, is crossed to a plant with 30-cm flowers, also from a highly inbred strain. The F1 have 18-cm flowers. F1 × F1 crosses yield F2 plants with flowers ranging from 6 to 30 cm in diameter, in approximately 4-cm intervals (6, 10, 14, 18, 22, 26, 30). Reference: Ref 24-1 An 18-cm F1 plant is crossed to a 6-cm plant. What is the probability of an offspring with one additive allele, if all genes that influence this trait are unlinked? Question options: 1/3 1/4 1/6 3/8 1/16

3/8

If a DNA molecule is 30% cytosine (C), what is the percentage of guanine (G)?

30%

Assume that a plasmid (circular) is 3200 base pairs in length and has restriction sites at the following locations: 400, 700, 1400, 2600. Give the expected sizes of the restriction fragments following complete digestion. 700, 400, 1400, 2600 400, 800, 1000 (2 of these) 300, 700, 2200 300, 700, 1000, 1200 400, 1200, 1600

300,700,1000,1200

23. If a typical somatic cell has 64 chromosomes, how many chromosomes are expected in each gamete of that organism? 32 64 16 8 128

An organism has a G content of 15%. What is the percentage for A?

35%

If a DNA molecule of 50 base pairs contains 15 cytosine bases (C), how many thymine bases will it have? 10 15 30 35 60

35. (50-15 = 35)

suppose you heard though various media of an animal alleged to be a hybrid of a rabbit and a cat. If the cat has a diploid chromosome number of 30 and the rabbit has a diploid chromosome number of 46, what would be the expected chromosome number in the somatic tissues of this alleged hybrid?

How many different F2 genotypes would you expect in a cross with four heterozygous gene pairs?

3^4 = 81

There are ______ Hox gene cluster in mammals Question options: 8 1 4 None of the above 6

Human gametogeneis from one oogonium and one spermatagonium results in how many mature gametes of each?

4 male spermatids, 1 ovum (and 2 polar bodies)

26. The ant, Myrmecia pilosula, is particularly interesting because it carries all its genetic information in a single pair of chromosomes. In other words, 2n = 2. (Males are haploid and have just one chromosome.) For the purposes of this question, assume that a G1 somatic cell nucleus in a female Myrmecia pilosula contains 2 picograms of DNA. How much DNA would be expected in a Metaphase I cell of a female? 8 picograms not enough information to answer this question 4 picograms 32 picograms 16 picograms

4 picograms

A diploid somatic cell from a rat has a total of 42 chromosomes (2n = 42). As in humans, sex chromosomes determine sex: XX in females and XY in males.What is the total number of chromosomes present in the cell during metaphase I of meiosis?

15. If a typical somatic cell has 44 chromosomes, how many chromosomes are expected in each gamete of that organism? 18 22 72 88 44

44/2= 22

in G1 of the cell cycle, the genus Oompa Lumpa has a DNA content (C) of 2.5 picograms. Following DNA synthesis (in G2 of the cell cycle) what will be the DNA content (in picograms) of the Oompa lumpa cell?

In G1 of the cell cycle, the genus Ooompa lumpa has a DNA content (C) of 2.5 picograms. Following DNA synthesis (in G2 of the cell cycle) what will be the DNA content (in picograms) of the Oompa lumpa cell?

5 picograms

What would be the sequence of a single-stranded DNA produced by using the DNA sequence shown as a template? 3' TACCGTGCGTGACATTAAGCC 5'

5' ATGGCACGCACTGTAATTCGG 3'

If the following DNA strand was used as a template, what would the sequence of an RNA be? 5' GTACCGTC 3' 5' GUACCGUC 3' 5' GACGGTAC 3' 5' CAUGGCAG 3' 5' GACGGUAC 3' 5' GUCGGUAC 3'

5'GACGGUAC3'

Name two mutagens that would be classified as base analogs.

5-bromouracil and 2-aminopurine

Name two mutagens that would be classified as base analogs. acridine orange and proflavin hydroxyurea and peroxidase ultraviolet light and cosmic radiation 5-bromouracil and 2-aminopurine ethylmethane sulfonate and ethylmethylketone peroxide

5-bromouracil and 2-aminopurine

Name two mutagens that would be classified as base analogs. Question options: ethylmethane sulfonate and ethylmethylketone peroxide hydroxyurea and peroxidase ultraviolet light and cosmic radiation 5-bromouracil and 2-aminopurine acridine orange and proflavin

5-bromouracil and 2-aminopurine

Name two mutagens which would be classified as base analogues.

5-bromouracil and 2-aminopurine

12. The DNA of a eukaryotic chromosome is: 1attached in the middle by a centromere. 2lots of double helices all jumbled together. 3two or three helices neatly arranged in the nucleus. 4a pile of fibers with lots of loose ends. 5one long double helix.

5. One long double helix

It is estimated that transposable elements compose approximately what percent of the human genome?

When crossing an organism that is homozygous recessive for a single trait with a heterozygote, what is the chance of producing an offspring with the homozygous recessive phenotype?

50%

Human albinism is an autosomal recessive trait. Suppose that you find a village in the Andes where 1/4 of the population is albino. If the population size is 1000 and the population is in Hardy-Weinberg equilibrium with respect to this trait, how many individuals are expected to be heterozygotes? Question options: 50 250 300 500 750

500

A recessive allele in tigers causes the white tiger. If two normally pigmented tigers are mated and produce a white offspring, what percentage of their remaining offspring would be expected to have normal pigmentation? 25% 50% about 66% 75% about 90%

75%

19. Assume that a dihybrid cross is made in which the genes' loci are autosomal, independently assorting, and incompletely dominant. How many different phenotypes are expected in the offspring? 9 4 7 6 3

The height of a type of bean plants is determined by five unlinked genes called A, B, C, D, and E. Each gene has two alleles: additive (uppercase letter) and nonadditive (lowercase letter). Reference: Ref 24-4 The shortest plants are 130 cm. The tallest plants are 220 cm. Estimate how many centimeters each allele contributes to the height difference of 90 cm.

90/5 alleles, but there are 2 allels so divide by 2 [(90/5)/2] = 9 cm per allele

The height of a type of bean plants is determined by five unlinked genes called A, B, C, D, and E. Each gene has two alleles: additive (uppercase letter) and nonadditive (lowercase letter). The shortest plants are 130 cm. The tallest plants are 220 cm. Estimate how many centimeters each allele contributes to the height difference of 90 cm.

90/5 then since 2 alleles need to /2= 9cm or 9cm. Since the uppercase alleles are additive, the tallest plants have the genotype AABBCCDDEE, and they are 90cm taller than the shortest plants, aabbccddee. That is, 10 "tall" alleles added 90cm; 90/10 = 9.

Assuming Mendel's Second Law is correct, what is the expected segregation ratio for traits in a dihybrid cross?

9:3:3:1

Before sequencing, the DNA fragment was cloned into a plasmid. On the strand that acted as the template in the sequencing reaction, what base of the cloned fragment was closest to the primer? C G A T

Which of the following two molecules of DNA has the lower melting temperature? Why?

A DNA molecule with a higher percentage of G-C pairs will therefore have a higher Tm than that of DNA with more A-T pairs.

The maternal-effect Bicoid gene codes for ________________ Question options: a DNA-binding transcription factor a kinase a cell-to-cell junction protein a signal protein a transmembrane protein a serine protease

A DNA-binding transcription factor

human blood types are an example of codominace because...

A and B alleles both express equally in individual with both alleles

Describe the difference between a focused promoter and a dispersed promoter.

A focused promoter specifies transcription initiation at a single specific nucleotide, whereas a dispersed promoter directs the initiation of transcription from a number of weak transcription start sites spread over a fairly wide region (50 to 100 nucleotides).

Define polymorphism.

A gene or a trait is said to be polymorphic if there is more than one form of that trait in a population.

What is meant by the term helix-turn-helix (HTH)?

A geometric conformation is formed by two adjacent α helices separated by a "turn" of several amino acids. Such motifs bind to the major grooves of DNA and interact with the DNA backbone.

Which of the following statements regarding Eukaryotic transcriptions is not true? a. Eukaryotic transcription involves a core promoter and a regulatory promoter. b. There is no one generic promoter. c. A group of genes is transcribed into a polycistronic RNA. d. Chromatin remodeling is necessary before certain genes are transcribed.

A group of genes is transcribed into a polycistronic RNA.

What are Hox Genes?

A group of related genes that control the body plan of the embryo along the anterior-posterior axis.

The primary structure of a protein is

A linear chain of amino acids

Which statement is true regarding heritability and continuous variation? Question options: Heritability measures the degree to which genes determine phenotype. As the number of gene loci that affect a trait increases, the proportion of extreme version of the trait also increases. The total variance used to calculate heritability measures all the variance in a population. A heritability value of 0.8% of the total variance is due to differences in the environment. A low heritability score means that genes are less influential than environment in determining phenotypic variation.

A low heitability score means the genes are less influential than environment in determining the phenotypic variation

What are morphogens and what do they do?

A molecule which uses concentration gradients to establish the positional information in developing parts of the embryo. Short Answer: It is a diffusible developmental regulatory gene

Nucleotide with a purine base:

A purine has nine rings. PGA, purines are G and A.

What is a gene? a) A sequence of DNA that encodes a protein b) A sequence of amino acids that catalyze a reaction c) A sequence of RNA that regulates expression d) A sequence of DNA that tells polymerase where to begin transcription

A sequence of DNA that encodes a protein

You are the proud owner of a calico cat kitten named Buffy. When you take Buffy to the vet for its first visit, you find out that the Buffy is a male! Is this unexpected, and if so why? What do you expect the chromosomal karyotype of your cat to look like with respect to X and Y chromosomes? Do you think you will be able to breed Buffy in the future?

A single X-linked locus determines the presence of orange color. There are two possible alleles at this locus: X+, which produces non-orange fur, and X0, which produces orange fur. Male are hemizygous and thus may be black (X+Y) or orange (X0Y) but not black and orange. However, rare calico males can arise from the presence of two X chromosomes, X+X0Y. Calico males are sterile, so breeding Buffy in the future isn't possible.

Explain why large recombination frequency values are less accurate measures of map distance than smaller ones.

A testcross for two genes that are relatively far apart on the same chromosome tends to underestimate the true physical distance, because the cross does not reveal double crossovers that might take place between the two genes. Because double crossovers between two genes go undetected, map distances will be underestimated.

25. The ant, Myrmecia pilosula, is found in Australia and is named bulldog because of its aggressive behavior. It is particularly interesting because it carries all its genetic information in a single pair of chromosomes. In other words, 2n = 2. (Males are haploid and have just one chromosome.) Which of the following figures would most likely represent a correct configuration of chromosomes in a Metaphase I cell of a female? A. B. C. D. E.

Meiosis I prophase b. Meiosis I anaphase c. Meiosis II prophase d. Meiosis II anaphase e. Mitosis prophase f. Mitosis anaphase Reference: Ref 2-2 Chromosomes are in unseparated, sister-chromatid form, at the end of which phase(s)?

A. Meiosis I prophase B. Meiosis I anaphase C.Meiosis II prophase E.Mitosis Prophase

Match numbers with the best letter choice: a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication DNA gyrase

A. supercoil remover

Shine-Delgarno sequence

AGGA

If the bottom strand of the DNA (sequence not shown) is the template, the RNA sequence, left to right 5' to 3', is: (Do not enter 5' and 3' characters) (5'AGGGTCCAC3)

AGGGUCCAC

If the bottom strand of the DNA (sequence not shown) is the template, the RNA sequence, left to right 5' to 3', is:

AGGUCCAC

The _________ can be used to quickly screen chemicals for their ability to be mutagenic (and hence potentially carcinogenic).

AMES

Which of these sequences could form a hairpin? CGCCAAAAAATCGCCCCCCAATTA ATTATTGGCGCTAACGCCAATTTT GCCGCCGCCGCCCCATTATTATTAT ATTATTTCGTACCCCCAATTTT TTCAATAATCGCTAATAACTGA

ATTATTGGCGCTAACGCCAATTTT (G/C content in the center)

3' TACCGTGCGTGACATTAAGCC 5' Reference: Ref 10-5 What would be the sequence of an RNA produced by using the DNA sequence shown as a template? Type your answer from 5' to 3', but DO NOT INCLUDE 5' and 3' characters.

AUGGCACGCACUGUAAUUCGG

Which of the following are examples of monohybrid crosses?

Aa x aa Aa x Ax

Name the three major modifications of mRNA of eukaryotes before it is transported to the cytoplasm. In addition, tell why each of the modifications is necessary

Add 5' cap (protect against degradation, acts as a binding site for the ribosome); add poly-A tail (possibly protect against degradation, possibly helps in the transfer of the mRNA to the cytoplasm); remove introns (forms a message that can be translated into a functional protein).

The cumulative contribution made by all the genes that contribute to a quantitative trait.

Additive effects

What are the four nucleotides that make up RNA? Give full names, not abbreviations.

Adenine (A), guanine (G), cytosine (C), and uracil (U

What does "proofreading" refer to with regard to DNA replication?

All DNA polymerases have this function, in the 3'-5' direction. Error correcting process. DNA pol I also has 5'-3' exonuclease activity. Also occurs in mRNA translation for protein synthesis. Important because it determines the mutation rate. Better proofreading abilities means less mutations.

Which of the following statements is true? Question options: a) None of the above b) All of above c) Many developmental genes exert their effects on only a single module. d) Embryos are made up of modules. e) Adults are made up of modules.

All of the Above(modules)

How do developmental genes constrain evolution? Question options: a) Modifying previously existing structures b) Maintaining highly conserved genes c) Creating novel structures d) Both a and b e) All of the above

All of the above

In the absence of glucose and in the presence of galactose, several genes are activated to enable yeast utilize galactose. The key regulator(s) of the yeast GAL system is/are the _______ protein(s).

All of the above

Which of the following human genotypes is associated with Klinefelter syndrome? XXY<XXXY, XXXXY

All of the above

Which of the following statements about the gene eyeless is true? Question options: a) None of the above b) Pax6 is the equivalent gene in mice. c) All of the above d) It is found in Drosophila. e) It encodes a transcription factor.

All of the above

Which of the following is not a developmental environmental signal? Question options: a) Light b) All of the above are developmental environmental signals. c) Temperature d) The presence of predators

All of the above are developmental environmental signals

The developmental pathway for sex determination in Drosophilia is best exemplified by which of the following statements: Question 4 options: One developmental state is the default, whereas its alternative requires the activation of a series of regulatory gene products. One developmental state is the default, whereas its alternative requires the activation of a series of regulatory gene products. Regulation occurs at more than one level from the gene to the active protein. An on-off decision for a master switch is made early on in development. All of the above are true.

All of the above are true

What do PCR, reverse transcription, and dideoxy DNA sequencing all have in common? a) All produce DNA chains as a product. b) All produce lipid as a product. c) All produce RNA as a product. d) All produce RNA as a product.

All produce DNA chains as a product

Genes come in different versions called

Alleles

What is the function of the TATA binding protein? Aids in the removal of introns from eukaryotic pre-mRNA Allows prokaryotic RNA polymerase to bind to the promoter of genes Allows eukaryotic RNA polymerase II to bind to the promoter of genes Helps termination factors bind and terminate transcription.

Allows eukaryotic RNA polymerase II to bind to the promoter of genes

Degeneracy of Code

Almost all amino acids are encoded by 2 or more codons

Protein secondary structures

Alpha helix, Beta sheets

List five levels at which gene control can take place in eukaryotes.

Alteration of structure, transcription, mRNA processing, RNA stability, translation, Post-translational modification

The next step in the translation of this mRNA will be the formation of a peptide bond between which two amino acids? See figure

Amino acid 2 and 3.

14. An allele is one of the bases in DNA. an alternate form of a gene. another term for epistasis. present only in males and is responsible for sex determination. found in mitochondria but not in nuclei.

An allele is: An alternate form of a gene

An allele is

An alternate form of a gene

One of the dominant features of the immune system is the capacity to generate new cells that contain different combination of antibodies. Because there are billions of combinations it is impossibe for each combination to be encoded by a single gene. Explain in sufficient detail how such diversity is accomplished in the case of the light chain of a typical antibody.

An antibody is a Y shaped molecule that has 4 chains, 2 heavy 2 light. There are 2 types of light chainsa nd 5 types of heavy. Different combinations of these chains results in different type of antibody classes. Each mature B-cells makes one type of light and one type of heavy chain, the light chain genes have meny different regions.

Of what advantage is it to have a polylinker region (multiple unique restriction sites) embedded in the lacZ component in the pUC series of plasmids?

An insert of DNA in the polylinker inactivates the lacZ component and allows identification of recombinant plasmids under proper genetic and environmental conditions

Chromosomes are randomly partitioned during ___, contributing to genetic diversity.

Anaphase 1

Human females with XY chromosomes and a mutation in their receptor gene have ___ syndrome.

Androgen Insensitivity

What must be true for a population to be in Hardy-Weinberg equilibrium?

Answer: 1. There must be random mating in the population; 2. there must be an infinite population size; 3. and there must be no evolution occurring (no natural selection, no genetic drift, no migration and no mutation).

In 1859 in On the Origin of Species, Charles Darwin wrote: "...I do not doubt that a breed of cattle, always yielding oxen with extraordinarily long horns, could be slowly formed by carefully watching which individual bulls and cows, when matched, produced oxen with the longest horns; and yet no one ox could ever have propagated its kind." What kind of selection is Darwin talking about? In plant or animal breeding, why is this type of selection commonly used?

Answer: Family selection. This allows you to cancel out uncontrolled environmental variation.

Define the term "fitness". What are three critical points to keep in mind when measuring fitness?

Answer: Fitness is the relative probability of survival and reproduction of a genotype or phenotype. Fitness is measured: a) by reproductive success; b) in a specific environment; c) relative to other genotypes/phenotypes in the population.

How does genetic drift alter the genetic variation in a population? Why is it a relatively insignificant agent of evolution in all but the very smallest populations?

Answer: Genetic drift, one of four agents of evolution, is characterized by a random change in allele frequencies. Because in altering allele frequencies it can produce fixation of one allele or another, genetic drift decreases the genetic variation in a population over time. The larger a population is, the more likely that any deviations in one direction from our expectations are offset by deviations in the other direction. When this happens, the net effect is that the allele frequencies do not change. For this reason, genetic drift generally plays a significant role only in very small populations.

What are the three classes of "functional" RNAs? Briefly describe the role of each class of functional RNA:

Answer: tRNA (brings the correct amino acid to the mRNA during translation); rRNA (major component of ribosomes); snRNA [helps process RNA transcripts (especially, helps remove introns)].

Scientists use the pink bread mold Neurospora to study meiosis. What are the features of this organism that lend itself for this line of study?

Asexual colonies are easily and inexpensively maintained in the lab. The haploid state of Neurospora makes it ideal for mutational analyses as mutant alleles are always expressed directly in the phenotype.

In the context of molecular genetics, reverse translation refers to translating in the 3' to 5' direction. assembling an RNA sequence from a DNA sequence. making an amino acid sequence from a DNA sequence. assembling a DNA sequence from an amino acid sequence. transcribing first, then translating.

Assembling a DNA sequence from an Amino Acid sequence

What is the primary function of the centromeric DNA region found on chromosomes?

Attachment point for spindle microtubules, which are the filaments responsible for moving chromosomes during cell division.

the characteristic affects males and females equally. two unaffected parents can have an affected child. in families in which the parents are unaffected but the children are affected, 1/4 of the children are affected.

Autosomal Recessive

Compare the inheritance of traits that are governed by genes on autosomal chromosomes with the inheritance of traits governed by mitochondrial genes.

Autosomal genes are inherited from the mother and father; mitochondrial genes are usually inherited solely from the mother

What is/are the possible inheritance pattern(s) for the characteristic in Pedigree 1?

Autosomal recessive only

A rare dominant trait, when exhibited in men, is transmitted to half their sons and to half their daughters. The gene for this trait is carried: A) on the x chromosome B) on an autosome C) on the y chromosome D) in the mitochondria E) none of the above

Embryonic stem cells are the subject of a great deal of research. What characteristic of embryonic stems cells accounts for this scientific interest? A) they are not controversial B) they are potentially totipotent C) they are potentially pluripotent D) they can be used to clone animals E) they do not undergo apoptosis

If a female Drosophila that is heterozygous for a recessive X-linked mutation is crossed to a wild-type male, what proportion of female progeny will have the mutant phenotype? A) 100 percent B) 0 percent C) 33 percent D) 25 percent

What phenomenon describes a genetic trait that is expressed more strongly or earlier in development with each generation? A) Penetrant B) Maternally determined progeny phen. C) Epistasis D) Anticipation E) Norm of reaction

the contribution Charles Darwin made to genetics was to A) demonstrate the connection between Mendel's principles of inheritance and evolution B) propose that evolution occurs by natural selection C) develop the theory of evolution, based on earlier theories of population genetics D) connect the fields of evolution and molecular genetics

Which of the following is NOT a feature of Darwin's theory of natural selection? Question options: A) A population adapts to its environment due to the variable reproductive success of individuals. B) There is no heritable variation among individuals. C) Individuals with poor fitness never produce offspring. D) A and B E) B and C

B and C

Which of the following is NOT a feature of Darwin's theory of natural selection? A) A population adapts to its environment due to the variable reproductive success of individuals. B) There is no heritable variation among individuals. C) Individuals with poor fitness never produce offspring. D) A and B E) B and C

B) There is no heritable variation among individuals. C) Individuals with poor fitness never produce offspring.

Human racial differences are produced by A) a single gene that affects skin color. B) cultural factors as well as multiple genes that affect several traits. C) multiple genes that affect skin color. D) multiple genes that affect several traits.

B) cultural factors as well as multiple genes that affect several traits.

A principal problem with inserting an unmodified mammalian gene into a bacterial plasmid, and then getting that gene expressed in bacteria, is that a) prokaryotes use a different genetic code from that of eukaryotes b) bacterial DNA is not found in a membrane-bounded nucleus and is therefore incompatible with mammalian DNA c) bacteria cannot remove eukaryotic introns. d) bacterial RNA polymerase cannot make RNA complementary to mammalian DNA

Bacteria cannot remove eukaryotic introns

Describe two ways in which bacterial DNA differs from eukaryotic DNA:

Bacterial DNA found in a large circular and not located with a nucleus. Eukaryotic DNA is organized into linear chromosomes within the nucleus. Eukaryotic DNA is also wrapped around histones. Bacterial gene contains no introns.

List at least two different types of DNA repair and briefly explain how each is carried out.

Base excision repair is a type of DNA repair where enzymes first remove the modified base, and then repair the rest of the nucleotide. Nucleotide excision repair is when large DNA lesions are repaired by removing and then repairing a multiple nucleotide section.

Why do insertions and deletions often have more drastic phenotypic effects than base substitutions do?

Base subs do not alter the reading frame. A single base change will only ater the amino acid that codon translates to. Insertion and deletions alter the frame causing the change of amino acids in every codon in every codon downstream causing drastic effects.

What is true of the secondary structure of DNA? a. Cytosine pairs with adenine. b. Thymine pairs with guanine. c. Bases on complementary strands are held together by hydrogen bonds. d. Sugar-phosphate groups are on the inside of the DNA molecule e. Nucleotide bases are on the outside of the DNA molecule

Bases on complementary strands are held together by hydrogen bonds.

A major difference between eukaryotes and prokaryotes is that eukaryotes have a nucleus, whereas prokaryotes do not. Discuss the impact of having a nucleus on the creation of mature mRNA.

Because prokaryotes do not have a nucleus, the translational machinery is able to attach to the mRNA as it is being synthesized, and so there is no time to process the mRNA before it is translated. In eukaryotes, the translational machinery is not present in the nucleus so there is time to process the mRNA in the nucleus before it is sent out to the cytoplasm. In eukaryotes, the transcribed mRNA present in the nucleus before post-transcriptional modifications are called heterogenous mRNA, consisting of both intron and exon regions. By the help of slicing mechanisms, mature mRNA are produced, which consists of only coding region. The mature mRNA is only a fraction of the heterogeneous mRNA molecules.

Huntington disease is caused by a single dominant gene and results in progressive mental and neurological damage. The disease is usually symptomatic when a person is between 30 and 50 years old and the patient usually dies within 15 years of diagnosis. Approximately 1 in 25,000 Caucasians have this disease. Huntington disease has not been associated with any other disease, now or in the past. Why might natural selection not have eliminated such a deleterious gene from the population?

Because the onset of the disease is late (between 30-50) which is old enough for and affected person to reproduce and pass on the gene.

Which chicken trait would respond best to selection? Explain your answer. (see quiz 1 q1)

Body weight, since selective parents who have better characteristics in this case body weight Because the h2 value of body weight is highest Will respond better to selection

Polygenic traits are ___

Both A and B (may be measured quantitatively and have continuous variation, are influenced by both genes and the environment)

Regulatory proteins that bind DNA have common motifs that interact with sequences of DNA. How do amino acids in DNA-binding proteins interact with DNA?

By forming hydrogen bonds with DNA bases

Mendel's law of independent assortment has its physical basis in the: A) separation of alleles into haploid cells B) spindle attachment in anaphase 1 C) random arrangement of chromosomes on the metaphase plate in meiosis 1 D) sister chromatids separating in meiosis 2 E) haploid cells forming

In wild-type flowering plants, carpel development is determined by what class of gene products? Question 1 options: A gene products A + B gene products B + C gene products C gene products A + C gene products

C gene products

Which of the following is NOT an explanation as to why dominant disease-causing genes exist in populations A) Despite the genes' effects, individuals stay healthy enough to reproduce. B) The genes may be the result of new mutations. C) The genes are masked and therefore are passed only through carriers. D) The genes exert their effects late in life, beyond reproductive age.

C) The genes are masked and therefore are passed only through carriers.

Which of the following is the fastest way for an enzyme to respond to changing conditions in the cell? A) covalently modifying the enzyme in the cell (by phosphorylation) B) changing the enzyme's compartmentalization or location in the cell C) altering the enzyme's activity by allostearic effectors (activators or inhibitors) D) controlling the synthesis or degradation of the enzyme in the cell

C) altering the enzyme's activity by allostearic effectors (activators or inhibitors)

Your teaching assistant....interchanges translation and transcription in the lecture..which one(s) of these statements the assistant has made is true? A) DNA is translated into RNA by RNA polymerase B) mRNA is translated to a nucleotide sequence to make a protein C) During translation, amino acids are brought to the ribosome by a tRNA molecule D) DNA is transcribed to RNA E) None of the above (comma in between)

C,D

9. Interactions among the human ABO blood group alleles involve _______ and ________. a. expressivity b. continuous variation c. complete dominance d. incomplete dominance e. co-dominance

C. Complete dominance E. Co-dominance

The _____ box sequence is specific to many (but not all) eukaryotic promoters and often facilitates transcription.

CAAT, CG

When considering the initiation of transcription, one often finds consensus sequences located in the region of the DNA where RNA polymerase(s) bind. Which are common consensus sequences? any trinucleotide repeat satellite DNAs CAAT, TATA GGTTC, TTAT

CAAT, TATA

Name three types of consensus sequences or modular DNA sequences that exist upstream from the coding regions of some eukaryotic genes.

CAAT, TATA, CG

Which of these sequences, if paired with its complementary strand, would be a palindrome (runs the same backward as forward)?

CCCGGG

We discussed cis regulatory elements (CRMs) in transcripitonal networks. What are CRMs and how the are involved in gene regulation?

CRMs are regulatory elements that function only on the strand that they are directly attached to. This is because they are not an enzymatic regulatory unit and therefore cannot extend to other DNA strands. CRMs are involved in gene regulation in ways suchs as inhibiting or enhancing transcription of a sequence and can therefore increase or decrease their production.

Genetic distances within a given linkage group

Cannot exceed 100 cM, are dependent upon crossover frequencies between paired, non-sister chromatids, are measured in cenitMorgans.A,B, and C

What is catabolite repression? How does it allow a bacterial cell to use glucose in preference to other sugars?

Catabolite repression is when the presence of the product of an enzyme, or "breakdown" substance", represses the transcription of the gene for that enzyme. Bacteria cells can use glucose because it is this "breakdown" substance of the lac operon. WHen glucose is present, adenyl cyclase is inhibited, preventing CAMP synthesis. Without CAMP, the activator protein CAP cannot bind to it's activation site, and RNA polymerase cannot bind to the promoter. Thus the lac operon is not transcribed.

The distance between two linked gene pairs can be expressed as a percentage. Name the unit based on percent recombination that was created in honor of the scientists who pioneered the use of fruit flies for genetic research.

CentiMorgans or Morgan

Cellular organelles with inheritance independent of the nucleus are ___ and ___

Chloroplasts, mitochondria

This process moves a nucleosome from the TATA box of a gene's promoter so that transcription can occur.

Chromatin Remodeling

Which circle shows a bond that would also be found in an RNA transcribed from one strand of this DNA?

Circle a, phosphodiester bond.

Enhancers are said to be cis-acting. What is meant by cis-acting, and what are enhancers?

Cis-acting means that the genes under control must be in the same chromosome as the cis-acting element. Enhancers are sections of DNA that regulate transcription of other sections of DNA.

Interactions among the human ABO blood group alleles involve ___ and ___

Co-dominance and complete dominance

Linked genes ___

Co-segregate

In order to determine if mutations from different organisms that exhibit the same phenotype are allelic, which test would you perform?

Complementation test

Which term refers to mating between closely related people?

Consanguinity

This form of DNA replication was eliminated during the Meselson-Stahl experiment because the original double-helix did not appear to be preserved during cell division.

Conservative

Most regulatory genes have evolved little over a period of millions of years; therefore, they are said to be _______.

Conserved

What three general characteristics must the genetic material possess?

Contain complex information, replicate faithfully, encode the phenotype.

Transcriptional repression by methylation of DNA is most common in sequences called____________ islands.

CpG

Name one characteristic of X-linkage that is often used to identify X-linked genes in pedigree analysis.

Criss-cross pattern of inheritance-where all sons exhibit mutant mother phenotype, the phenotype largely or exclusively affects males.

X-linkage in pedigrees is often identified by what characteristic of the pedigree?

Criss-cross pattern of inheritance.

Yellow leaves on a plant can be caused by genetic mutations, viruses, or unfavorable environmental conditions. Suppose you find a plant that has yellow leaves and want to determine if the cause of the phenotype is a genetic mutation or an environmental stress. Design an experiment to differentiate between the different possibilities.

Cross the yellow plant with a normal plant. Self the resulting F1 and look for a consistent, predictable segregation pattern. For example, the presence of a 3 green :1 yellow segregation ratio would suggest that the yellow phenotype was caused by a recessive mutation.

What events during sexual reproduction are significant in contributing to genetic diversity?

Crossing over and random distribution of maternal and paternal chromosomes

13. Crossing over occurs during interphase. prophase. metaphase. anaphase. telophase.

Crossing over occurs during: Prophase

7. __________________ refers to the splitting of the cytoplasm, separating one cell into two.

Cytokinesis

___ refers to the splitting of the cytoplasm, separating one cell into two.

Cytokinesis

Discuss the difference between "cytoplasmic inheritance" and "genetic maternal effect."

Cytoplasmic inheritance - some characteristics of a cell are encoded by genes located in the cytoplasm (chloroplast and mitochondria). Present in both males and females and are passed from mother to offspring. No mechanism ensures cytoplasmic genes are evenly distributed.Genetic maternal effect - the phenotype of the offspring is determined by the genotype of the mother. Genes are inherited from both parents, but offspring phenotype is determined by the genotype of its mother.

Which of the following traits exemplify plasmid DNA? A) It often carries genes beneficial to its bacterial host. B) It replicates independently of the genomic DNA. C)It is always larger than the genomic DNA. D)Both A and B, above E)Both B and C, above

the following are features and characteristics of the DNA molecule except: A) is composed of four nitrogenous bases B) is capable of being replicated C) can be mutated D) is used as genetic material by all organisms E) All of the above

The region of a protein that is capable of holding on to a particular nucleotide sequence in order to affect proper gene regulation

DNA binding domain

The region of a protein that is capable of holding on to a particular nucleotide sequence in order to affect proper gene regulation.

DNA binding domain

21. During interphase of the cell cycle: sister chromatids move to opposite poles. RNA replicates. DNA recombines. DNA content essentially doubles. the nuclear membrane disappears.

DNA content essentially doubles

This enzyme links two separate lengths of nucleic acid by creating a phosphodiester bond between them

DNA ligase

Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat (which breaks hydrogen bonds)? Indicate the reason for your choice. A: GCATTAGGGCATCCC CGTAATCCCGTAGGG B: TTAGCGTTATAGCAT AATCGCAATATCGTA Mark the correct boxes below: DNA molecule A DNA molecule B DNA molecule A has a higher A-T content DNA molecule B has a higher G-C content DNA molecule A has a higher G-C content. DNA molecule B has a higher A-T content

DNA molecule A DNA molecule A has a higher G-C content DNA molecule B has a higher A-T content

DNA molecule A. DNA molecule A has a higher G-C count (more hydrogen bonds). DNA molecule B has a higher A-T count (less H bonds)

Which of the following DNA double helices would be more difficult to separate into single-stranded molecules by treatment with heat (which breaks hydrogen bonds)? Indicate the reason (or reasons) for your choice. A: GTATTAGAACATCTC CATAATCTTGTAGAG B: TGAGCGTTCCAGCAG ACTCGCAAGGTCGTC Mark the correct boxes below: DNA molecule A DNA molecule B DNA molecule A has a lower A-T content DNA molecule B has a higher G-C content DNA molecule A has a higher G-C content. DNA molecule A has a higher A-T content

DNA molecule B DNA molecule B has a higher G-C content DNA molecule A has higher A-T content

Compare and contrast the in vivo role of DNA pol I and DNA pol III

DNA pol I - removes the RNA primer. 5' --> 3' exonuclease activity and also 3' --> 5' exonuclease activity. Can fill in primer regions with DNA. DNA pol III - Only has 3' --> 5' exonuclease activity. Proofreading capabilities.

Which enzyme catalyzes the elongation of a DNA strand in the 5' --> 3' direction? a) DNA polymerase III b) DNA ligase c) topoisomerase d) primase

DNA pol III.

Strand discrimination during the process of _____________ is based on DNA methylation in E. coli.

DNA repair

What are the basic regulatory elements in a strand of DNA that allow for genes to be regulated? Are these different in eukaryotes and prokaryotes? If so, why?

DNA sequence that affects the transcription of other DNA sequences to which it is physically linked. Bacteria and eukaryotes use both positive and negative control mechanisms to regulate their genes. However, negative control is more important in bacteria, whereas eukaryotes are more likely to use positive control mechanisms.

It is common to use ddNTPs (dideoxyribonucleoside triphosphates) in which of the following biochemical reactions? DNA sequencing citric acid cycle electron transport plasmolysis restriction digestion

DNA sequencing

It is common to use ddNTPs (dideoxyribonucleoside triphosphates) in which of the following biochemical reactions? plasmolysis electron transport restriction digestion DNA sequencing citric acid cycle

DNA sequencing

In biology, most information flows through which sequence?

DNA to RNA to protein

Given the figure above, is it DNA or RNA? ________ Is the arrow closest to the 5' or 3' end? ________ Spleen diesterase is an enzyme that breaks the covalent bond that connects the phosphate to the 5' carbon. Assume that the dinucleotide is digested with spleen diesterase. To which base and to which carbon on the sugar is the phosphate now attached, A or T? 3' or 5'? ________, ________ DNA, 5' end, A, 5' DNA, 3' end, T, 5' DNA, 3' end, A, 3' RNA, 3' end, A, 3' RNA, 3' end, T, 3'

DNA, 3' end, A,3'

When regions around genes become sensitive to the enzyme ______ this is an indication that those regions are becoming __________ active.

DNAse I, transcriptionally

When regions around genes become sensitive to the enzyme ______________ this is an indication that those regions are becoming ______________ active.

DNaseI, transcriptionally

Darwin is referring to family selection. In this case, although the offspring are sterile, the parents that produced the offspring with the desirable traits can be identified and chosen to produce more. In plant and animal breeding, this allows uncontrolled environmental variation to be canceled out.

Morphogens control cell fate at ____________________ concentrations.

Decreased

The contribution of Gilbert and Sanger to modern genetics was to

Develop a method for sequencing DNA

Which of the following statements is true? Question options: a) The transcription factors and the extracellular signals that govern pattern formation can be thought of as the molecular "black box." b) All of the above c) Developmental processes in both Drosophila and vertebrates are controlled by similar sets of genes. d) None of the above e) Many regulatory genes are required to bring about the diversity of organisms that we observe.

Developmental process in both drosophilia and vertebrates..

Which figure shows one of the amino acids that was key to distinguishing DNA from protein in the Hershey and Chase experiment? See figure, Quiz 8

Diagram b, cysteine or methionine

Which diagram shows a nucleotide that would be used to make RNA? diagram a diagram b none diagram d diagram e

Diagram d

siRNA

Dicer cleaves double stranded-RNA, small interfering RNA binds to RISC complex(RNA-Induced Silencing Complex) for unwinding, the now single stranded RNA target complimentary mRNA to mark for degradation or inhibit transcription, target genes from which they were transcribed

List at least three different types of DNA repair and briefly explain how each is carried out.

Direct repair - changes altered nucleotides back into their original (correct) structures. Base-excision repair - a modified base is first excised and then the entire nucleotide is replaced. Nucleotide-excision repair - removes bulky DNA lesions (like pyrimidine dimmers) that distort the double helix.

In the Meselson-Stahl experiment, what hypothetical form of DNA replication results in the same DNA density distribution as the semiconservative method after the first cell division, but was not supported upon the second cell division?

Dispersive

You learn that a Mars lander has retrieved a bacterial sample from the polar ice caps. You obtain a sample of this bacteria and perform the same kind of experiment that Meselson and Stahl did to determine how the Mars bacteria replicates its DNA. Based on the following equilibrium centrifugation results, what type of replication would you propose for this new bacteria?

Dispersive. All generations demonstrate DNA of an intermediate density.

Transcription factors are proteins with at least two functional _________

Domains

2. Describe the differences between dominance, co-dominance, and incomplete dominance.

Dominance is when a trait is completely dominant over the other and only that trait is expressed. Co-dominance is when neither trait has dominance and both are expressed(ABO). Incomplete dominance is when neither trait has dominance over the other and the traits blend.

In a germ-line cell from a human male that is dividing, when to the X and Y chromosomes segregate?

During meiosis I, anaphase.

One of the primary reasons for generating a large number of clones in a eukaryotic genomic library is that each cosmid replicates nonautomously. each ligation product is sequence specific. the host range of the vector is limited. each vector can take up only a relatively small fraction of the eukaryotic DNA. lysogenic phages continue to integrate their DNA into the host chromosome, thus reducing the number of desired recombinant clones.

Each vector can take up only a relatively small fraction of the eukaryotic DNA

Genetic information can be carried in which of the following biomolecules

Either DNA or RNA

16. Embryonic stem cells are the subject of a great deal of research. What characteristic of embryonic stems cells accounts for this scientific interest? they are not controversial they are potentially totipotent they are potentially pluripotent they can be used to clone animals

Embryonic stem cells are good for research because they: They are potentially totipotent

A condition in which one gene pair masks the expression of a nonallelic gene pair is called ________. dominance codominance recessiveness epistasis additive alleles

Epistasis

Mice homozygous for mutations in one gene exhibit polydactyly (i.e. extra toes) while in another gene (limb deformity), homozygous mutants lack all parts of the limb below the wrist. A mutant that is doubly homozygous for extra toes and limb deformity mutations willNOT exhibit polydactyly because it is missing the distal limbs, where the toes are located.This type of genetic relationship is called

Epistasis

How does epistasis differ from Mendel's principle of dominance?

Epistasis differs from Mendel's principle of dominance in that when the epistatic gene is expressed as ee, the third trait, which is usually recessive is displayed and covers the main dominant or recessive one at the first loci. Pretty much it becomes dominant over either expression that happens to be expressed when the epistatic gene is heterozygous (Ee) or homozygous dominant (EE).

Is a change in allele frequency of a population over time

Evolution

What is evolution? Describe four different mechanisms by which it can occur.

Evolution is a change in the allele frequencies in a population.It can occur via the following four mechanisms: a) Genetic drift.Conditions under which it occurs: Random change in allele frequencies due to small population size or a small founder population colonizing a new habitat. b) Migration/gene flow.Conditions under which it occurs: New individuals are added to a population. If their genetic makeup for any particular gene is different from that of the population they join, the overall allele frequency in the new population changes. c) Mutation.Conditions under which it occurs: A direct change in an allele as a result of some environmental insult and/or a problem in replication. d) Natural selection.Conditions under which it occurs: If there is variation for a trait, heritability for that trait, and differential reproductive success based on that trait, evolution by natural selection is occurring.

Briefly discuss the evidence for the semi-conservative replication of DNA.

Experiments by Meselson and Stahl allowed E. coli to be labeled with 15N and 14N and then followed the density of the daughter cells using cesium chloride gradient centrifugation. They predicted that parental DNA molecules of one density which were allowed to replicate in another medium of a different density will show daughter DNA molecules of intermediate density because half will be old DNA and the other half will be new DNA. Their results proved that indeed half was old and other half was new indicating DNA of intermediate density.

5. "The occurrence of partial expressivity and incomplete penetrance demonstrates that gene expression can be influenced by biological or environmental context." Explain this statement and give examples to support it.

Expressitivity describes the range of a particular phenotype. Penetrance is the % of people who express the mutant phenotype. Phenotypes can vary due to environmental factors such as, temperature and nutrition, or due to inheretence or gene interaction. (examples: rabbits coat color varies due to temperature, epistasis one gene modifies the expression of another- the Bombay phenotype.

Heritability indicates the degree to which a characteristic is genetically determined. True False

F- limitations to heritability...

Height in all organisms is always a continuous trait. True False

F- not always continuous

A QTL is a gene. True False

F- quantitative trait loci; chromosome region, not single gene (could be many genes)

A morphogen is a protein that can restore totipotency to cells from an adult animal. Question options: True False

False

Allelic frequencies within populations are affected by dominance and recessiveness. True False

False

An increase in homozygosity generally leads to increased overall vigor. True False

False

Genetic differences in large, randomly breeding populations remain constant if migration occurs. True False

False

Homeotic genes in mammals are dissimilar to those in Drosophila Question options: True False

False

Inbreeding results in an increase in the frequency of heterozygotes compared to the results of random mating. True False

False

Overdominance refers to the lack of expression of recessive phenotypes. True False

False

Plant cells can not be cloned from single isolated cells Question options: True False

False

QTL mapping often provides an overestimate of the number of genes contributing to a quantitative trait. true or false

False

Segmentation genes determine the identity of individual segments during development. Question options: True False

False

T or F, A QTL is a gene

False

T or F, Allelic frequencies within populations are affected by dominance and recessiveness.

False

T or F, Genetic differences in large, randomly breeding populations remain constant if migration occurs.

False

T or F, Heritability indicates the degree to which a characteristic is genetically determined.

False

T or F, Inbreeding results in an increase in the frequency of heterozygotes compared to the results of random mating.

False

T or F, Overdominance refers to the lack of expression of recessive phenotypes.

False

T or F, QTL mapping often provides an overestimate of the number of genes contributing to a quantitative trait

False

The function of the gene dorsal is required for determining the left/right axis during Drosophila development Question 6 options: True False

False

The human Hox genes are similar in sequence to the homeotic genes found in Drosophila, but are not lined up in the the same order. Question options: True False

False

The heritability of a trait is the proportion of genes affecting a trait. True False

False The heritability of a trait is the proportion of differences among individuals for a trait that is due to genetic variation. It is subject to change and is specific to a population and environment and cannot be extrapolated. And it usually has to be re-calculated every few years or generations due to changes in genetic or environmental composition of the population.

Define the term "fitness". What are some critical points to keep in mind when measuring fitness?

Fitness is the relative probability of survival and reproduction of a genotype or phenotype. Critical to assessing fitness is understanding that it is measured: a) relative to other genotypes/phenotypes in the population; b) in a specific environment; c) by reproductive success. Relative, environment, reproductive success

Alternative RNA splicing is a method that apparently evolved for the production of many different polypeptides from the same pre-mRNA. Provide an example of alternative splicing.

Fourteen exons occur in the alpha-tropomyosin gene, six of which make up three pairs that are alternatively spliced. Ten different forms of alpha-tropomyosin are expressed in a tissue-specific manner., The drosophila protein Dscam has many (~38000) sites that could be alternatively spliced. In theory this leads to more polypeptide products than there are genes in the Drosophila genome, Genetic mutations in the human SMN2 gene can lead to alternatively spliced protein products that can cause spinal muscle atrophy

Two "naked" (without histones or other proteins) double-stranded fragments of DNA are exactly the same length. At 89°C, fragment A has completely denatured, which means that the two strands have separated. At that temperature, fragment B is still double-stranded. How might these fragments differ, to result in different denaturation temperatures?

Fragment B has a higher percentage of G-C pairs and requires a higher melting temperature. G-C are held together by three hydrogen bonds.

What are the approximate positions of consensus sequences (modular elements) at the 5' end of eukaryotic genes?

GC box (-110), CAAT box (-70), TATA box (-30)

__________ mutations produce new traits and are usually dominant.

Gain-of-function

To study mammalian segmentation in the mouse, zygotically acting mutations are generated. A recessive mutation is identified. It causes all seven cervical vertebrae to be missing. Given the striking evolutionary conservation of many aspects of development in mice and flies, one way to determine which gene is mutated is to look for a gene affecting an analogous process in Drosophila. What type of segmentation gene in Drosophila is most analogous to the loss of seven cervical vertebrae produced by the recessive mouse mutation? Question options: Anterior-posterior morphogen gene Gap gene Pair-rule gene Segment-polarity gene Homeotic gene

Gap Gene

Define gene regulation. What are three ways gene regulation can be controlled in a cell?

Gene regulation is the control of a gene's transcript and protein product. One way a gene can be regulated is at the DNA level through chromatin remodelling. A second way is by the stability of the processed RNA, which will determine what transcript is translated. A third control is through transcription regulation of DNA.

What is the common influence of ultraviolet light on DNA? Note that simply stating "mutation" or "increase in mutation rate" is not an acceptable answer.

Generation of pyrimidine dimers

The action of genes controlled by _______ determines where and when they will be expressed or suppressed. Question 11 options: a) molecular toolboxes b) patterning c) genetic switches d) evolution e) None of the above

Genetic switches

The complete genetic makeup of any organism is its

Genome

Describe the difference between: genome and gene.

Genome - a complete set of genetic information gene - fundamental unit of heredity, an inherited factor that determines a character

This is the study of "all genes in an organism in their entirety."

Genomics

The expression of a maternal gene product is based on the _____________________________.

Gradient

28. Name the single individual whose work in the mid-1800s contributed to our understanding of the particulate nature of inheritance as well as the basic genetic transmission patterns. With what organism did this person work? Gregor Mendel, Pisum sativum Thomas Hunt Morgan, Drosophila (fruit fly) Calvin Bridges, Drosophila (fruit fly) George Beadle, Neurospora Boris Ephrussi, Ephestia

Gregor Mendel, Pisum sativum

self-excising Introns

Group I-found in rRNA, guanosine co-factor Group II-found in chloroplast and Mitochondria, no co-factor

H. leading strand

Males with an X-linked gene are said to be ___ for these X-linked genes

Hemizygous

How did the work of Hershey and Chase contribute to the model of DNA as the genetic material?

Hershey and Chase designed a series of experiments to determine whether phage protein or DNA is transmitted in phage replication. They used the model system E. coli and its phage T2. They used radioactive forms of Phosphorus (P32) to label the DNA and sulfur (S35) to label the protein. Initially, the infected bacteria were grown in the radioactive media, labeling the phages. In the next generation, the labeled phages were introduced to unlabeled bacteria, infecting them. When the bacteria were washed and centrifuged, the radioactive phosphorus was found to be present in the infected bacteria, and the sulfur was washed away with the protein coats, demonstrating that DNA had been passed on and was the genetic material of E. coli.

Codominant alleles are expressed individuals that are ___

Heterozygous

If the phenotype followed in Pedigree 3 is X-linked recessive, then the genotype of II-2 is

Heterozygous

Ability to roll the tongue is caused by a dominant allele. A woman is a "roller," but one of her parents is not. What is the woman's genotype?

Heterzygous

Genes a, b, and c are known to be in linear order in an organism. A testcross is done that yields 20 double crossover progeny out of a total of 1000 offspring. Assume that there is no interference. (a) Type a genetic map showing the distances between these genes. Is there more than one possible map? (b) What would the distances be if there was 10% interference? (c) What number of double crossover progeny would be expected if there was interference of 15%?

Hide Feedback The observed frequency of the double crossovers (DCOs) is 20/1000, or 0.02. If there is no interference then this will be the same as the expected, which is just the product of the single crossover frequencies, that is, SCO frequency (a-b) x SCO freq. (b-c) = 0.02. (a) Any combination of map distances whose product (a-b) x (b-c) = 0.02 is possible. However, three are most likely: a 20 mu b 10 mu c a 10 mu b 20 mu c a 14.14 mu b 14.14 mu c (b) The distances would be exactly the same. (c) The expected number of DCO progeny would be 17.

List two especially useful characteristics of cloning vectors. ability to integrate into the host chromosome and then cause a lytic cycle virulence and lysogenicity nonautonomous replication and transposition reverse transcriptase and ligase activities high copy number and antibiotic resistance gene(s)

High copy number and antibiotic resistance genes

What are homeotic genes and what do they do?

Homeotic genes determine which parts of the body will form which body part.

Describe the difference between homologous chromosomes and sister chromatids

Homologous chromosomes are found in diploid cells i.e they form after fertilization i.e after the union of haploid male "sperm" and haploid female sex cell "oocytes". so similar chromosomes pair.this chromosomes are similar because they are of the same length and they contain the same genes at the same loci, but the alleles for the traits may be different. While sister chromatids are formed prior to cell division.each homologous chromosome replicates itself and forms a sister chromatid,and sister chromatids are identical unlike homologous chromosomes which are just similar to each other

Which of the following is a concern of population genetics?

How many people have color blindness in Utah

In humans, the presence of the SRY gene, normally on Y, determines maleness. In Drosophila, an X: A (autosome) ratio of 0.5 determines maleness. Reference: Ref 4-4 Explain the genders of human and Drosophila XXY individuals.

Humans are based on XX and XY where Y determines maleness. In Drosophilia, the fly's sex is determined by the X:A ratio where if X:A =1.0 it is female, =0.5 it is male.

Nucleic acid blotting is widely used in recombinant DNA technology. In a Southern blot one generally ligates DNA with DNA ligase. examines amino acid substitutions with radioactive probes. cleaves RNA with restriction endonucleases hybridizes filter-bound DNA with a DNA probe hybridizes filter-bound RNA with a DNA probe.

Hybridizes filter bound DNA with a DNA probe

The role of tautomerism in causing mutations relates to the fact that the process ultimately affects the: a) hydrogen bonding properties of nitrogenous bases b) deoxiribose sugar c) ability of DNA to replicate at all d) covalent bonding affinities of nitrogenous bases

Hydrodgen bonding properties of nitrogenous bases

(I = lac repressor gene; Z, Y, A = lac operon structural genes; P = lac promoter; O = lac operator) Reference: Ref 16-2 I----P-O--Z---Y--A Which parts of the DNA region shown in the diagram encode proteins? Question options: P I, Z, Y, A P, O, Z, Y, A I, P, O, Z, Y, A

I, Z, Y, A

Which parts of the DNA region shown in the diagram encode proteins?

I, Z, Y, A

I. phosphodiester bonds at DNA nicks

A woman who has blood type A has a daughter who is type O and a son who is type B. Which of the following is a possible genotype for the son

IBi

In eukaryotes, RNA polymerase __ transcribes the genes that encode proteins.

Assume the following pathway: Precursor----> L ----->D------->C--------> Product Mutations for three genes (genes I, II, and III) have been isolated that interrupt this pathway. Addition of: L, D, C rescues mutations in gene III C rescues mutations in gene II D, C rescue mutations in gene I In what order do genes I, II, and III function in this pathway?

III,I,II

What properties must a molecule have to serve as a vector? a) It should be able to replicate itself independently, contain a number of unique restriction sites that would enable the insertion of DNA fragments cut with the same enzyme, carry a selectable marker, and be easy to retrieve. b) It should contain a selectable marker. c) It must be a bacterial plasmid. d) It should require insertion into the host genome to replicate, contain a number of restriction enzyme cleavage sites, and contain more than one cleavage position for a particular restriction enzyme.

IT should be able to replicate itself independently, contain a number of unique restriction sites that would enable the insertion of DNA fragments cut with the same enzyme, carry a selectable marker, and be easy to retrieve.

Mendel did not know of the existence of chromosomes. Had he known, what change might he have made in his second principle?

If Mendel had known of the existence of chromosomes, he would have realized that there are many more traits than chromosomes, and therefore that some traits will have to be coded for by genes occurring together on the same chromosome. He would have revised his second law to say that independent assortment will occur for traits on separate chromosomes. For traits on the same chromosome, however, the closer together they are the less likely they will assort independently.

What is the maximum recombination frequency observable from a cross? Why is it less than the true genetic distance in some cases?

If a double heterozygote is testcrossed and gametes are produced in a ratio of 1:1:1:1, this can be interpreted as unlinked genes or as genes that are 50 map units apart. Because gametes this far apart or more cannot be distinguished from gametes that are unlinked, it's not possible to ever get a ratio of gametes produced that indicates a distance of greater than 50 map units. Some genes that are farther apart but are still on the same chromosome may appear to be closer because the observed proportion of recombinant gametes neglects to count those double crossover events that occur between the genes. When a double crossover occurs, the parental gametes are formed again and it looks as if no crossovers have occurred at all.

How will variation for a gene in a given population be increased?

If migration from other populations brings into the recipient population gene alleles that are not already in the population or are present at a lower frequency

You are studying a population of kangaroo rats. You calculate the expected frequencies of the alleles for coat color. When you compare these to the observed genotype frequencies, there is a large discrepancy. What can you deduce, based on these findings?

If the expected genotype frequencies and the observed genotype frequencies are very different, then the population is not in Hardy-Weinberg equilibrium. At least one of the assumptions must be being violated. Random mating, large population, no mutation, no natural selection, no genetic drift (no evolution), no migration

Riboswitches were first discovered in 2002 and have been found in...

In all of the listed organisms

Which of the following is NOT true regarding the differences in mRNA between prokaryotic cells and eukaryotic cells?

In eukaryotic cells, the transcription to mRNA and the translation from mRNA are coupled, while in prokaryotic cells transcription and translation are not coupled.

Which of the following is NOTtrue regarding the differences in mRNA between prokaryotic cells and eukaryotic cells?

In eukaryotic cells, the transcription to mRNA and the translation from mRNA are coupled, while in prokaryotic cells transcription and translation are not coupled.

0.1% frequency of recombination is observed

In genes located very close to one another on the same chromosome

Under certain circumstances, one can make use of expression libraries to identify and clone a gene of interest. Describe an expression library and how one could be used to clone a gene.

In many cases a vector can be designed so that the cDNA will be expressed, frequently as a fusion protein. In this case the cDNA has been incorporated into a vector in a position where it is within a coding sequence of another protein. The vector also incorporates promoter sequences that allows the protein to be expressed (both transcribed and translated). When such a vector is used to make a library it is called an expression library*. Expression libraries have the advantage and disadvantage that the protein is present. In some cases this may mean that there may be selective pressure against the expression a cDNA of interest, but in many cases this expression allows for a novel screening approaches. The most straight forward of these is the use of antibodies to screen a library.

What is one feature of meiosis that produces genetic variability in gametes? In two or three sentences, explain how this feature causes genetic uniqueness.

In meiosis, there is the ability for chromosomes to experience crossing over, where genes switch chromosomes. Crossing over produces genetic variability. It creates chromosomes that are not identical.

Microscopy to look at a cell's chromosomes is often done when the cell is in mitotic metaphase. For example, karyotypes that extract chromosomes from a single cell and photograph them to look for abnormalities are done on metaphase, rather than interphase, cells. Why?

In metaphase, chromosomes are condensed and are more easily visualized.

Genes contain the instructions for building proteins. Where are those instructions located?

In the order of the DNA bases

A Barr body is a(n)

Inactivated X chromosome, visible in the nucleus of a cell that is from a female mammal.

Explain how inbreeding can have a positive effect on population fitness.

Inbreeding allows us to select for desirable traits. Crossing of inbred lines often leads to phenomenon of hybrid vigor. The hybrid is more robust than either parent strains becauss: dominance mask deleterious genes, and overdominance (i.e. heterozygote is superior to either homozygote).

Describe two mating patterns that have an impact on the genetic composition of a population.

Inbreeding—preferential mating with close relatives Assortative mating—preferential mating with individuals of dissimilar or similar genotype or phenotype.

How do incomplete and co-dominance differ?

Incomplete dominance- the phenotype of a heterozygote expresses an intermediate between the phenotypes of the two homozygotes. Co-dominance- the heterozygote simultaneously expresses traits of both homozygotes

Explain the differences between incomplete dominance and continuous variation.

Incomplete dominance: one allele is not completely dominant over the other allele, so an intermediate phenotype is observed. continuous variation: variation within a population where there are many intermediates that fall between the extremes (ex: height in people)

How do incomplete penetrance and variable expressivity differ?

Incomplete penetrance - the genotype does not always produce the expected phenotype.Variable expressivity - the degree to which a character is expressed. The range of signs and symptoms that can occur in different people with the same genotype.

Assume that a cross is made between AaBb and aabb plants and that the offspring fall into approximately equal numbers of the following groups: AaBb, Aabb, aaBb, aabb. These results are consistent with the following circumstance: alternation of generations hemizygosity codominance incomplete dominance independent assortment

Independent Assortment

The first commercial production of what human enzyme led to the explosion of the biotechnology industry? Polynucleotide Phosphorylase Inuslin Amylase Lactose Dehydrogenase

Insulin

During the cell cycle, chromosomal replication occurs in

Interphase

What might be a reasonable function of restriction endonucleases in a bacterium, distinct from their use by molecular biologists?

Isolated from bacteria restriction endonucleases resist or prevent viral infection by degrading the invading nucleic acid of the virus.

What is the function of cAMP in regulation of the lac operon?

It activates an activator protein.

What is the function of cAMP in regulation of the lac operon? It inactivates a repressor protein. It activates a repressor protein. It activates an activator protein. It inactivates an activator protein.

It activates an activator protein.

What is the function of peptidyl transferase activity? It charges tRNAs. It acetylates the end of a protein after translation. It cleaves the polypeptide from the last tRNA during termination. It moves ribosomes along mRNA during translation. It forms peptide bonds.

It forms peptide bonds

It forms peptide bonds.

What effect does mutation have on genetic variation?

It increases genetic variation by creating new alleles.

What is meant by polycistronic mRNA? Give an example.

It is a messenger RNA polymer that carries the code for more than one polypeptide chain; lactose and tryptophan operons would be examples.)

A mutation in the gene for the yeast regulatory protein GAL4 causes yeast to grow poorly on galactose. What is the function of GAL4?

It is a transcription activator for the galactose-digesting enzyme gene.

The human genome contains approximately 20,000 protein-coding genes, yet has the capacity to produce several hundred thousand gene products. What can account for the vast difference in gene number and product number? Every gene can be read in both directions, and each gene can have inversions and translocations. There are more exons than introns. It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing. There are more introns than exons. Much of the DNA is in the form of trinucleotide repeats, thus allowing multiple start sites for different genes.

It is estimated that 40 to 60 percent of human genes produce more than one protein by alternative splicing

The Hardy-Weinberg law (equation) is a mathematical model in which allele frequencies in populations remain constant from generation to generation. Given all the conditions that must be met for the Hardy-Weinberg equation to be valid, why is this equation useful for studying population genetics?

It is useful because if a population breaks from Hardy-Weinberg, you know that one of the conditions are not being met. This is a convenient way to mathematically decide if natural selection is occurring.

If mating occurs solely between relatives, eventually what will happen to the population?

It will be completely homozygous

A photograph of chromosome squash is called a

Karyotype

What do kinase enzymes do, and why are they important to researchers or diseases such as cancer?

Kinase enzymes add phosphate groups to other proteins. Deregulated kinase activity or mutated kinases are a frequent cause of disease, in particular, cancer. Kinase enzymes regulate many aspects that control cell growth, movement, and death.

Where on the chromatid are the microtubules attached?

Kinetochore

Which are abnormalities involving numbers of X chromosomes? Mark all that apply. Klinefelter syndrome XXXX syndrome Down syndrome Turner syndrome Huntington's disease

Klinefelter Syndrome XXXX syndrome Turner Syndrome

This new strand of DNA has its 3' end oriented in the opposite direction as that in which the replication fork travels.

Lagging strand

Leading Strand

This new strand of DNA has its 3' end oriented in the same direction as the replication fork travels.

Leading strand. (If opposite, lagging strand). Chain elongation occurs in the 5' --> 3' direction, addition of one nucleotide at a time to the growing 3' end.

Typically, bacterial DNA contains_____ (more or less?) repetitive DNA than eukaryotic DNA.

Less

Fill in the blanks in the "level of transcription" column of this table with: + for high levels of transcription, and - for minimal levels of transcription of the lac operon. Consider regulation by both the lac repressor and CAP (catabolite activator protein). The strain is wild type, with no partial diploidy. Please label your answer with numbers 1-4 based on the chart below. Medium conditions 1 high glucose, no lactose 2 no glucose, high lactose 3 high glucose, high lactose 4 no glucose, no lactose

Level of transcription 1. off 2 high 3 off 4 off

Why are rare X-linked recessive diseases more common in males than in females?

Males get their X chromosome from their mother and only have one X chromosomes, so any disease will be expressed. Males only need to inherit a single copy of the allele to express the disease, whereas females need two.

Two- and three-factor testcrosses can both be used to ___ and ___

Map gene loci and determine genotypes

Homologous chromosomes move toward opposite poles of the dividing cell during

Meiosis I

Describe the difference between meiosis I and meiosis II

Meiosis I - reduction division because the number of chromosomes per cell is reduced by half. Also, homologous pairs separate.Meiosis II - equational division and sister chromatids separate.

Chromosomes are randomly partitioned during ___, contributing to genetic diversity

Meiosis I anaphase

1. Describe the difference between meiosis I and meiosis II.

Meiosis I is the reductional phase in which the cell goes from diploid to haploid. Meiosis II is the equational phase, the cell goes from n to n+1.

Crossing over (genetic recombination) occurs in

Meiosis I prophase

Chromosomes are in unseparated, sister-chromatid form, at the end of which phase(s)?

Meiosis I prophase, Mitosis prophase

Sister chromatids separate during what phase(s)?

Meiosis II anaphase and Mitosis anaphase

The first stage after which a dividing cell that started as a diploid would be haploid,

Meiosis II prophase

Explain how it is that genetic variation is maintained in the population. Why is it that dominant alleles do not eventually take over?

Meiotic segregation in randomly mating populations results in an equilibrium distribution of genotypes after only one generation, so genetic variation is maintained. As long as there is random mating occurring, then the frequency of dominant and recessive alleles will remain the same.

In your own words, what does Mendel's First Law state?

Mendel's First Law States the law of segregation; that each individual diploid organism possesses two alleles for any particular characteristic. These two alleles segregate (separate) when gametes are formed, and one allele goes into each gamete. The two members of a gene pair separate from one another during meiosis/gamete formation.

State Mendel's Law of Independent Assortment. What is the basis of this law.

Mendel's second law states that during meioses, traits controlled by pairs of genes on different chromosomes assort independently of each other in the formation of gametes. The basis of the law is due to two reasons: i) genes occur in pairs and each allele resides on each chromosome ii) each chromosome separates from its partner into a different gamete during meiosis.

Explain why mitosis does not produce genetic variation and how meiosis leads to the production of tremendous genetic variation.

Mitosis is the division of nonsexual reproducing cells, in which two genetically identical cells that contain the same genetic instructions as the parent cell are produced. Mitosis is the process of replacing cells in normal body tissue, so genetic variation is not wanted. Genetically altered cells in mitosis will be identified as invaders and destroyed by the body. Meiosis leads to the production of tremendous genetic variation by crossing over in prophase I and the random distribution of maternal and paternal chromosomes in anaphase I. Crossing over occurs when one section of a chromosome randomly switches places with another section of a different chromosome in the cell.

The stage at which "sister chromatids go to opposite poles" immediately follows which stage listed below? Mitotic metaphase Mitotic anaphase Telophase of Meiosis I Telophase of Meiosis II

Mitotic Metaphase

A spontaneously aborted human embryo is characterized with respect to karyotype, and it is found to be normal except that it contains only one chromosome number two. This is an example of what type of aneuploidy?

Monosomy

Inbreeding in populations that are normally outbreeding leads to which of the following?

More individuals affected by rare diseases

Some vectors such as pUC18 and others of the pUC series contain a large number of restriction enzyme sites clustered in one region. What term is given to this advantageous arrangement of restriction sites? multiple cloning site consensus sequence palindrome β-galactosidase complementation

Multiple cloning site

Multi-factorial traits are influenced by ___ and ___

Multiple genes, environment

Which diagram shows a nucleotide as it would appear in DNA? See figure in quiz 7.

Must contain deoxyribose sugar (OH not present on 2' carbon), a phosphate group, and one nitrogenous base. Careful, DNA does not contain uracil (which has 2 C=O and no methyl group).

permanent, heritable changes in DNA are called:

Mutations

If a pair of homologous chromosomes fails to separate during anaphase of meiosis I, what will be the chromosome number of the four resulting gametes with respect to the normal haploid number (n)?

N+1, n+1; n-1, n-1

Master regulatory genes are ___________ and ____________ to determine cell fate.

Necessary and sufficient

In what way can 5'-azacytidine influence transcription?

Nitrogen is at the 5' position of 5'-azacytidine. The base can be incorporated into DNA in place of cytidine, but it cannot be methylated. Undermethylation of the CG dinucleotide increases transcription.

A friend gave you the following molecule and told you that it was a fragment of his RNA. Do you believe him? Justify your answer. 5' TCC TGA CGA TGC TAC CGA 3':

No, it contains thymine, not found in RNA, replaced by uracil.

Could the characteristic followed by the pedigree be caused by an autosomal dominant disease? Why or why not?

No, the offspring of I-1 and I-2 contradict an autosomal dominant inheritance. (Affected offspring must have an affected parent)

Are Okazaki fragments formed on the leading strand during DNA replication? Explain your answer

No. They are formed on the lagging strand during DNA replication. The strands of DNA unwind and the replication fork progresses down the helix. DNA polymerase III synthesizes DNA in only the 5' to 3' direction, so synthesis can only progress continually on one strand, the leading strand. On the lagging strand, many points of initiation are necessary, which results in discontinuous DNA synthesis of the lagging strand, and these pieces are called Okazaki fragments.

E. coli bacteria are placed into a medium containing glucose and lactose. Which of the genes below do you expect to be turned on?

None of the above

Which diagram shows a nucleotide that would be used to make RNA?

None, look for 2 OH groups.

In order to be functional, a chromosome requires all of the following except:

Nucleomeres

This organic subunit is the monomer from which nucleic acid is formed.

Nucleotides

How many Barr Bodies would you expect to see in an XXY individual

ONE

Short "bursts" of DNA synthesis on the lagging strand produce ___________.

Okazaki Fragments

Short "bursts" of DNA synthesis on the lagging strand produce ___________.

Okazaki fragments.

In what way are specific DNA sequences of the template amplified in the polymerase chain reaction? In other words, how does one target the target?

Oligonucleotide primers hydrogen bond to specific sections; primers are then extended.

The F1 offspring of Mendel's classic pea cross always looked like one of the two parental varieties because

One allele was completely dominant over another

Transcription factors appear to be important molecules relating to the regulation of gene activity. Regarding eukaryotes, two general classes exist. Briefly describe each.

One class assembles at promoter regions adjacent to the site of transcription. The other class binds at more distant regions (enhancers).

Transcription factors appear to be important molecules relating to the regulation of gene activity. Two general classes of transcription factors exist in eukaryotes. Briefly describe each.

One class assembles at promoter regions adjacent to the site of transcription. The other class binds at more distant regions (enhancers).

How many primase molecules are needed on the leading strand? The lagging strand?

One for the leading strand, many for the lagging strand.

What is a dominant epistatic gene?

One gene that suppressess the expression of another gene

The DNA of a eukaryotic chromosome is:

One long double helix

4. What are three of the characteristics of an autosomal dominant trait observed in a pedigree analysis?

One parent must be affected. Rarely skips generations. Males and females are affected equally

8. Extensive pedigree analysis on a characteristic shows all of the following:

Only males are affected affected fathers always pass the traits to sons What does this pedigree indicate: Y-linked

What term refers to a contiguous genetic complex that is under coordinate control? allosteric attenuation prototroph operon lysogen

Operon

_____________ are complexes where, among other activities, a great deal of RNA degradation takes place.

P bodies

Hershey and chase labeled DNA using this radioactive atom.

P32

The occurrence of partial expressivity and incomplete penetrance demonstrates that gene expression can be influenced by biological or environmental context. Explain this statement and give examples to support it.

Penetrance is the percentage of all individuals that show some degree of expression of the mutant genotype. It's pretty much the percentage of people with a genotype that express the expected phenotype. In the case of Huntington's disease, all with dominant mutant gene get the disease and penetrance is 100%. Expressivity is the degree to which a character is expressed. In the case of polydactylous persons, extra fingers/toes can be fully functional or there can be merely a small tag of skin. Both of these occurences are due to the effects of other genes and environmental factors that can alter or completely supress the effect of a particular gene. There are temperature dependent enzymes, for example.

A measurable or observable trait or characteristic is call a(n)

Phenotype

The classic Hershey and Chase (1952) experiment that offered evidence in support of DNA being the genetic material in bacteriophages made use of the following labeled components: tritium. hydrogen. nitrogen and oxygen. phosphorous and sulfur. None of these answers are correct.

Phosphorus and sulfur

Which of the following is not a way plants differ from animals regarding regulatory genes that affect their development? Question options: a) Plants have tremendous developmental plasticity. b) Future reproductive cells are not set aside during early plant development. c) Plant cells do not move relative to one another. d) Plant cells do not have MADS box genes and homeobox genes. e) None of the above

Plant cells do not have MADS box genes and homeobox genes (plants are always happy and never gay)

The ability of organisms to modify their development (and hence, their phenotype) in response to environmental stimuli is known as developmental _______.

Plasticity

Describe the difference between pluripotent and totipotent stem cells. Why are totipotent stem cells considered more valuable for research.

Pluripotent - are adult stem cells that can be made to differentiate more than one cell type.Totipotent - are embryonic stem cells that can differentiate into ANY cell type. Totipotent stem cells have a very wide application and are easier to grow.

Here is a list of eukaryotic RNA polymerases. Match them with what they transcribe. RNA Pol I; RNA Pol II; RNA Pol III.

Pol I: rRNA. Pol II: snRNA. Pol III: tRNA.

Degradation of a eukaryotic mRNA is generally preceded by shortening of the _____________.

Poly(A) tail

The ____________________ stabilizes the 5' cap, which must be removed before the mRNA molecule can be degraded from the 5' end.

Poly(A) tail

Which of the following is not a component within a single nucleotide of a nucleic acid?

Polymerase

Describe three characteristics of enhancers and silencers.

Position need not be fixed. Orientation may be inverted without significant effect. They can regulate other genes when inserted. They can act at a great distance from the promoter.

Which of the following terms best characterizes catabolite repression associated with the lactose operon in E. coli? a) inducible system b) negative control c) repressible system d) positive control e) constitutive

Positive control

What is the difference between positive and negative control? What is the difference between inducible and repressible operons?

Positive: requires an activator protein (stimulate transcription at the operon) Negative: requires repressor protein (turns off transcription at the operon) Inducible operon: requires an inducer molecule to stimulate transcription either by inactivating a repressor protein in a negative inducible operon or by stimulating the activator protein in a positive inducible operon. repressible operon: (Transcription normally occurs) transcription is turned off either by the repressor becoming active in a negative repressible operon or by the activator becoming inactive in a positive repressible operon.

Describe alternative splicing. What is the result of the alternative splicing mechanism?

Pre mRNA molecules are processed before leaving the nucleus. One such processing is the splicing of introns, non-gene coding RNA, out from between exons, gene coding RNA. If the enzymes do not splice, or cut, at every correct 5' and 3' end of the intron, these introns can be removed in different ways everytime a pre mRNA molecule is processed. For example, some introns may be left in the final RNA or some exons may be removed along with the introns. The resulting final RNA has the ability to code for and be translated into different gene products

24. Drosophila melanogaster, the fruit fly, has a 2n chromosome number of 8. Assume that you are microscopically examining the mitotic and meiotic cells of this organism. You note that in the female two chromosomal pairs are metacentric and that two pairs are acrocentric. What stage is represented in the drawing above? (Genes "P" and "C" are not relevant to this question). Mitotic metaphase Ootid (G1) Primary oocyte (metaphase) Secondary oocyte (metaphase)

Primary Ooctye (metaphase)

The DNA replication enzyme that most closely resembles RNA polymerase is DNA polymerase I. DNA polymerase III. primase. telomerase. helicase.

Primase

While actually a form of RNA polymerase, this enzyme lays down the initial nucleotides to set up a condition where DNA polymerase can then take over for replication.

Primase

Define RNA silencing (or interference). Explain how siRNAs arise and how they potentially affect gene expression. How are siRNAs different from the antisense RNA mechanism?

Process in which cleavage of double-stranded RNA produces small interfering RNAs (siRNAs) that bind to mRNAs containing complementary sequences and bring about their cleavage and degradation. siRNAs are produced by the cleavage and processing of double-stranded RNA. antisense RNA are small RNA molecule that base pairs with a complementary DNA or RNA sequence and affects its functioning.

A coworker in your lab discovered a strain of E. coli that has a nonfunctional RNA polymerase. He felt sorry for the suffering E. coli and decided to add an RNA polymerase enzyme and gene from Drosophila to this mutant E. coli to allow the mutant strain to survive. You think that this is a foolish idea that will not work. Put together an argument as to why the addition of a Drosophila RNA polymerase could not possibly allow this mutant E. coli to survive.

Prokaryotic and eukaryotic RNA polymerases are different. The Drosophila RNA polymerase will not be able to find the E. coli promoters and thus will not be able to transcribe any of the E. coli genes.

Why do eukaryotic chromosomes have multiple origins of replication, whereas prokaryotic chromosomes typically have only one origin?

Prokaryotic circular DNA is limited in size and so replication at a single site can form new strands in a reasonable amount of time. Larger, linear eukaryotic chromosomes contain too much DNA to be replicated readily and in a reasonable amount of time from a single origin.

Describe the function and general nature of promoters in eukaryotes.

Promoter regions are necessary for the initiation of transcription. Promoters that interact with RNA polymerase II are usually located within 100 bp upstream of a gene and usually contain a TATA box (-25 to -30) and a CAAT box (-70 to -80).

What are the basic regulatory elements in a strand of DNA that allow for genes to be regulated? Are these different in eukaryotes and prokaryotes? If so, how?

Promoters, operators in prokaryotes. Promoters, proximal promoter elements, enhancers, and silencers in eukaryotes. Eukaryotic transcription is different in a few ways, most notable in that prokaryotic genes are transcribed as operons, while eukaryotic genes are not. In addition, the role of the nucleosome is different in eukaryotic transcription.

Crossing over occurs during

Prophase

In eukaryotes, chromosomes do not contain:

Proteases

A poison suppresses the ability of the body to manufacture amino acids. Knowing this, the poison interferes most with the production of:

Proteins

PAR on Y

Pseodoautosomal region, allows pairing with x Chromosome

The nitrogenous base of a nucleotide may be of two types- a purine or a pyrimidine. Enter below the type (purine or pyrimidine) of the nitrogenous base in: adenine (box1) uracil (box2) guanine (box3) thymine (box4) cytosine (box5)

Purine Pyrimidine Purine Pyrimidine Pyrimidine

What are the two major components of the Tobacco Mosaic Virus? RNA and protein carbohydrates and nucleic acids RNA and DNA lipids and nucleic acids DNA and protein

RNA and Protein

______________ is also known as RNA silencing and posttranscriptional gene silencing.

RNA interference

_______________ is also known as RNA silencing and posttranscriptional gene silencing.

RNA interference, RNAi

Which of the following is TRUE for both prokaryotic and eukaryotic gene expression? A) mRNA is synthesized in the 3' → 5' direction. B) After transcription, a 3' poly-A tail and a 5' cap are added to mRNA. C) RNA polymerase binds to the promoter region to begin transcription. D) The mRNA is the exact complement of the gene from which it was copied.

RNA polymerase binds to the promoter region to begin transcription

Which of the following is TRUE for both prokaryotic and eukaryotic gene expression?

RNA polymerase binds to the promoter region to begin transcription.

This short piece of RNA is present only transiently in a newly-synthesized DNA molecule

RNA primer

Which of the following scientists performed experiments with eyeless and Pax6? Question options: a) Ed Lewis b) Francois Jacob c) Rebecca Quiring d) Barbara McClintock e) All of the above

Rebecca Quiring, whom was also a flaming lesbian and played rugby.

Discuss the differences, and at least one similarity, between recombination and independent assortment.

Recombination - the sorting of alleles into new combinationsIndependent assortment - in meiosis, each pair of homologous chromosomes assort independently of other homologous pairs.Recombination only shuffles already existing genetic variation and does not create new variation at the involved loci.Similarity - both result in an increase in genetic variation

Phenotypically, what two general categories of offspring did Sturtevant and Morgan observe in the F2 generation of their fly crosses?

Red-eyed and white-eyed (All females had red eyes, 1/2 of males had white eyes, 1/2 of males had red eyes)

Electrophoresis separates DNA fragments of different sizes, but this technique does not indicate which of the fragments contains the DNA piece of interest. This problem is solved by Identifying the molecular weights of the fragments in question None of the above Measuring the sizes of the bands on the gel Removing the bands from the gel and hybridizing them with a known strand of DNA complementary to the gene of interest

Removing the bands from the gel and hybridizing them with a knwon strand of DNA complementary to the gene if interest.

What is semiconservative replication?

Replication in which each of the original nucleotide strands remains intact, despite no longer being combined in the same molecule. The original DNA molecule is half conserved during replication. Each strand serves as a template for synthesis of a new strand. Production of two identical double strands of DNA consisting of one new strand and one original strand.

mRNAs are degraded by enzymes called ____________

Ribonucleases

Uridine contains ______ as sugar.

Ribose

The molecular nature of transposable elements was first understood in E. coli due to the simplicity of the E. coli genome. Which of the following types of DNA contribute significantly to the genome complexity of other organisms?

SINES, LINES

Protein synthesis in Eukaryotes

Same as Prokaryotes, 5' end of mRNA is capped with 7-methylguanosine, AUG calls for methionine

Why is genetic drift important only in small populations?

Sampling error causes there to not always be an accurate reflection of gene frequency from generation to generation.

The fundamental Mendelian process that involves the separation of contrasting genetic elements at the same locus would be called continuous variation. discontinuous variation. segregation. dominance or recessiveness. independent assortment.

Segregation

What is the mechanism that ensures Mendel's First Law of segregation?

Segregation of homologous chromosomes

This method of replication preserves the covalent links on one strand of DNA but allows permanent separation of the "parental" double helix to form two templates.

Semi-conservative

In what type of cell - in humans - would you expect to find meiosis occurring?

Sex cells

Homologous chromosomes are those that can be matched by virtue of their similar structure and function within a nucleus. What chromosomes making up the human genome do not follow the same characteristics of homology?

Sex chromosomes

What are sex-limited and sex-influenced traits and what is the difference between the two?

Sex-limited: an extreme form of sex-influenced inheritance. Encoded by autosomal genes that are expressed in only one sex, that trait has zero penetrance in the other sex. Sex-influenced traits: are determined by autosomal genes and are inherited according to Mendel's principles, but they are expressed differently in males and females. A particular trait is more readily expressed in one sex.

Extensive pedigree analysis on a characteristic shows all the following: • if a woman with an affected father has children with an unaffected man, half of the sons and none of the daughters are affected. • affected females always have an affected father and an affected maternal grandfather. • the trait is never passed from father to son. What mode of inheritance is suggested?

Sex-linked autosomal dominant

Hemizygosity would most likely be associated with which of the following?

Sex-linked inheritance

In some cases, genes undergo amplification (local, multiple duplications) when additional gene products are in high demand. Would you consider gene amplification as a form of genetic regulation in eukaryotes? Explain your answer.

Since gene amplification involves an increase in the number (copies) of genes, which, in turn, provides the potential for increasing the amount of a gene product because more copies of a given gene are present, one would probably consider gene amplification as a form of genetic regulation. Amplification of ribosomal genes is an example.

You are studying a single-gene locus with two alleles in a population that is in Hardy-Weinberg equilibrium. Examination of a large sample of individuals from the population reveals there are six times as many heterozygote as there are homozygote recessive individuals in this population. What is the frequency of the recessive allele?

So let's look at this algebraically. p + q = 1 No immediate help there. p^2 + 2pq + q^2 = 1 We might be able to do something with that. The homozygous recessives are represented by q^2 and the heterozygotes are represented by 2pq. Now, we're told that this relationship holds true: 2pq = 6q*2 Woof. Now that is so cool. Divide both sides by 2q and you get p=3q Now look at that first H-W equation again p + q = 1 and make the substitution so 3q + q = 1 4q = 1 q = 0.25 (answer) == Yeah, but does that hold up? Let's check our answer. q = 0.25 p = 1 - q = 0.75 p^2 + 2pq + q^2 = 1 0.75^2 + 2*0.75*.25 + 0.25^2 = 1 Check! Yay! So the answer q = 0.25 (answer) is correct, and we figured it out by math!

List two methods that we have discussed used to map human genes.

Somatic Cell Hybridization and Lod Score Method

In the lactose operon, the product of structural gene lacZ is capable of replacing hexokinase in the early steps of glycolysis. nonautonomous replication. splitting the β-linkage of lactose. forming ATP from pyruvate. forming lactose from two glucose molecules.

Splitting the β-linkage of lactose

A mutation that occurs naturally, without exposure to a known mutagen, is called a ________.

Spontaneous Mutation

The 3' untranslated region affects the ___ of mRNA and the ___ of the mRNA protein-coding sequence.

Stability, translation

Germ cells

Subset of cells do not become any particular tissue later migrate to the gonad then undergo meiosis to form gametes

Two modular elements that appear as consensus sequences upstream from RNA polymerase II transcription start sites are ________.

TATA and CAAT

Name three consensus sequences or modular DNA sequences that exist upstream from the coding regions of some eukaryotic genes.

TATA, CAAT sequences, and CG sequences

Which of the sequences could form a hairpin? TTCAATAATCGCTAATAACTGA CGCCAAAAAATCGCCCCCCAATTA TTACGGCGGTTCCGCCGGTG GCCGCCGCCGCCCCATTATTATTAT ATTATTTCGTACCCCCAATTTT ATTAGGCCCTACCGCCAATTTT

TTACGGCGGTTCCGCCGGTG

Telomeres regulate the replication of the ends of chromosomes in eukaryotes. Why is this structure implicated in human aging?

Telomeres are structures at the ends of eukaryotic chromosomes that contain tandem DNA sequences added to the 3′ ends by the enzyme telomerase. Telomeres stabilize chromosomes by preventing the loss of genomic information after each round of DNA replication. Human somatic cells contain little or no telomerase, and those that do get progressively shorter and enter premature senescence. People with diseases of premature aging such as Werner syndrome and dyskeratosis congenital have shorter telomeres than healthy people.

Eukaryotes have two of these per chromatid; prokaryotes have none.

Telomeres.

This term describes the sequence of nucleotides which direct the formation of a new nucleic acid strand.

Template strand

What is the Ames test, and how does it work?

The Ames test is a way to test for mutagenicity. It implores mutagens of histadine in its mechanism (his-). It also places the mutagens in a test tube that has liver cells because the liver cells will allow to mutagens to be expressed. the test tubes are then plated, presence of colonies indicates that a mutagen is present, absence of colonies means that a mutagen is not present.

Which of the following statements about manual Sanger sequencing is true? a) The DNA sequence is read from the top of the gel to the bottom. b) Each of the four terminating ddNTPs is labeled with the same fluorescent dye. c) The DNA sequence obtained is complementary to the template strand. d) The template sequence is directly obtained

The DNA sequence obtained is complementary to the template strand.

Developmental plasticity is Question options: a) the ability to express only one phenotype under different environmental conditions. b) None of the above c) found only in plants. d) the ability to express different genotypes under different environmental conditions.

The abililty to express different genotypes under different environmental conditions

Describe how nucleosomes may influence gene transcription.

The binding of transcription factors requires accessing nucleosomal DNA, and such factors may displace nucleosomes.

You are conducting a cross using Drosophila melanogaster, results of your cross indicate that the recombination frequency is very high. How do you fell about the accuracy of your map unit calculations based on this cross?

The calculations are not very accurate. The distance would be underestimated because double crossovers are not observed.

Which of the following statements is false? Question options: a) Eyes evolved many times independently within the animal kingdom. b) The cameralike eyes of mammals are composed of thousands of individual lenses known as ommatidia. c) eyeless/Pax 6 acts as a molecular switch. d) All of the above are true. e) Evolutionary developmental biology is often called "evo-devo

The cameralike eyes of mammals are composed of thousands of individual lenses known as ommatidia

Which of the following are role(s) of the 5' cap? The cap helps the RNA polymerase find the promoter and initiate transcription. The cap plays a role in the removal of introns. The cap acts as a binding site for the ribosome. The cap protects the RNA from degradation. none of the above

The cap plays a role in the removal of introns. The cap acts as a binding site for the ribosome. The cap protects the RNA from degradation.

In the G0 stage of the cell cycle, which of the following is true:

The cell exits the cell cycle

In the G0 stage of the cell cycle, which of the following is true: stem cells are produced the cell exits the cell cycle RNA replicates DNA content doubles the nuclear membrane disappears

The cell exits the cell cycle

The concept that genetic information passes from DNA to RNA to protein is called

The central dogma

Describe the centromere and kinetochore.

The centromere is the attachment point for spindle microtubules. Kinetochore is a protein complex that assembles in the centromere; later spindle microtubules attach to the kinetochore.

What is the chi-square test used for, and what does it tell you?

The chi-square test is used to evaluate the role of chance in producing deviations between observed and expected values. It tells you how well observed values fit the expected values.

In late interphase and early prophase of mitosis, what happens to the chromatin in a eukaryotic cell?

The chromatin becomes more densely coiled and condenses into distinguishable chromosomes.

A leading hypothesis regarding the source of some transposable elements is the integration into the genome of a virus. What evidence supports this hypothesis?

The conservation of some gene sequences between transposable elements and extant viral genes

How do daughter cells at the end of mitosis and cytokinesis compare with their parent cell when it was in G1 of the cell cycle?

The daughter cells have the same number of chromosomes and the same amount of DNA

How do the daughter cells at the end of mitosis and cytokinesis compare with their parent cell when it was in G1 of the cell cycle?

The daughter cells have the same number of chromosomes and the same amount of DNA

Genetic material must replicate faithfully. Describe how the double-stranded structure of DNA gives it this property

The double-stranded structure can be used as a template. Each strand is replicated so that the information is passed down correctly.

Alternative RNA splicing is a method that apparently evolved for the production of many different polypeptides from the same pre-mRNA. Provide an example of alternative splicing

The drosophilia protein Dscam has many sites that can be alternitively spliced(~38000)

A number of scientists have become interested in telomerase as a drug target. Why would they be interested in telomerase? How might cancer drug therapies that target telomerase work?

The enzyme telomerase allows for replacement of short bits of DNA known as telomeres, which are otherwise shortened when a cell divides via mitosis. In normal circumstances, without the presence of telomerase, if a cell divides recursively, at some point all the progeny will reach their Hayflick limit. With the presence of telomerase, each dividing cell can replace the lost bit of DNA, and any single cell can then divide unbounded. While this unbounded growth property has excited many researchers, caution is warranted in exploiting this property, as exactly this same unbounded growth is a crucial step in enabling cancerous growth. We might be able to target telomerases in the cancer cells to stop the cancer from spreading/growing.

A three point cross was carried out in Drosphila. The following phenotyes were observed in 1531 offspring of the F2 generation. Which of these groups represents the non-crossover groups (NCO), and which are the double crossover groups (DCO)? What is the relative gene order, and the map distance between these genes, based on the following results from this three point mapping cross: a B d 404 A b D 395 A B d 210 a b D 195 a B D 15 A b d 19 a b d 154 A B D 139

The first two groups(aBd,AbD) represent NCO. Groups 5 and 6 represent DCO(aBD&Abd). Map distances are measured by recombination frequencies: a-d=15+19+195+210/1531= 29 a-b=210+195+154+139/1531=46 b-d=15+19+154+139/1531=21 The gene order is therefore a-d-b

Which of the following statements is false? Question options: a) Ubx is a Hox gene. b) Deletions of the Ubx gene convert the third thoracic segment into the second thoracic segment. c) All of the above are true. d) Homologous genes encoding similar transcription factors are expressed in similar patterns along the anterior-posterior axes of both mammals and insects. e) The full-sized wing in Drosophila is normally produced on just the third thoracic segment.

The full sized wing in Drosophilia is normally produced on just the third thoracic segment.

The human metallothionein IIA gene (hMTIIA) is transcriptionally regulated through the interplay of regulatory elements and transcription factors. What is the function of this gene, and how is it regulated by environmental circumstances?

The gene hMTIIA produces a protein that binds to heavy metals and protects cells from their toxicity. The gene is transcribed at low levels in all cells but is induced to express at high levels in cells exposed to heavy metals.

When Thomas Hunt Morgan crossed his red-eyed F1 generation flies to each other, the F2 generation included both red- and white-eyed flies. Remarkably, all the white-eyed flies were male. What was the explanation for this result?

The gene involved is on the X chromosome

Which of the following is NOT an explanation as to why dominant disease-causing genes exist in populations? Question options: A) The genes may be the result of new mutations. B) The genes are masked and therefore are passed only through carriers. C) Despite the genes' effects, individuals stay healthy enough to reproduce. D) The genes exert their effects late in life, beyond reproductive age.

The genes are masked and therefore are passed only through carriers

The difference between the homogametic sex and heterogametic sex is that ___

The heterogametic sex determines the gender of the offspring

Bicoid (bcd) is a maternal effect gene required for anterior development in fruit flies. Suppose that a egg from a mutant mother is destined to develop into an embryo with two posterior ends. A scientist does an experiment with this embryo.

The injected DNA will have no effect since bicoid is not amaternal gene, the developing embryo will have larva with anterior and posterior ends.

In the late 1950s, Meselson and Stahl grew bacteria in a medium containing "heavy" nitrogen (15N) and then transferred them to a medium containing 14N. Which of the results in the above figure would be expected after one round of DNA replication in the presence of 14N? (See Figure)

The intermediate tube.

Explain why mutations in the lacI gene are trans in their effects, but mutations in the lacO gene are cis in their effects.

The lacI gene encodes the lac repressor protein, which can diffuse within the cell and attach to any operator. therefore affecting the expression of genes on the same or different molecules of DNA. The lacO encodes the operator. The binding of the lac repressor to the operator affects the binding of RNA polymerase to the DNA and therefore only affects the expression of genes on the same molecule of DNA.

Significant in the deciphering of the genetic code was the discovery of the enzyme polynucleotide phosphorylase. What was this enzyme used for? the manufacture of synthetic RNA for cell-free systems peptide bond formation production of ribosomal proteins degradation of RNA ribosomal translocation

The manufacture of synthetic RNA for cell-free systems

You found a mutant of the p53 gene product that will effect the G1/S checkpoint. What would you predict would be the effect of this mutation and a potential consequence?

The mutated p53 gene product will induce growth arrest by holding the cell cycle at the G1/S checkpoint due to DNA damage recognition. DNA will be repaired if possible and the cell will be allowed to continue the cell cycle. P53 can also induce apoptosis and cell death if the damaged DNA cannot be fixed.

What does it mean if a human female oocyte is no longer arrested in metaphase II of meiosis?

The oocyte has been fertilized and has had contact with sperm. The human female is pregnant.

Explain how one would use epistasis analysis to determine order of gene action in genetic networks?

The order of action of genes in a regulatory hierarchy that is governed by a signal can often be determined by the method of epistasis analysis, in which the phenotype of a double mutant is compared with that of single mutants. The epistatic mutation may be in either the upstream or the downstream gene, depending on the nature of the two mutations and the type of regulation. Nevertheless, when the regulatory hierarchy satisfies certain conditions, simple rules allow the position of the epistatic locus in the pathway to be determined without detailed knowledge of the nature of the mutations, the pathway, or the molecular mechanism of regulation.

Provide a general set of statements that describes an enhancer.

The position of an enhancer need not be fixed; it can be upstream, downstream, or within the gene it regulates. It is orientation independent and can act at large distances from the promoter.

3. A couple has one girl and is expecting a second child. What is the probability that this child will be a boy? After several years and several births, this couple now has six daughters and is expecting a seventh. What is the probability that this child will be a boy?

The probability of the child being a boy is 1/2, the probability of the seventh child being a boy is also 1/2, they are independent events so sexes of the previous children has no effect on it.

Trisomy 21 or Down syndrome occurs when there is a normal diploid chromosomal complement of 46 chromosomes plus one (extra) chromosome #21. Such individuals therefore have 47 chromosomes. Assume that a mating occurs between a female with Down syndrome and a normal 46-chromosome male. What proportion of the offspring would be expected to have Down syndrome? Justify your answer.

The proportion of offspring with Down syndrome would be 50%. Because down syndrome is a genetic defect, the mother would have a genotype that is homozygous recessive (dd). The father would be heterozygous (Dd) because everyone has the possibility of having a child with down syndrome. If a punnett square was done, you would have offspring that were either homozygous recessive for Down syndrome of heterozygous- Dd, Dd, dd, dd. That would make a 50% chance.

In what way is gene rearrangement related to gene regulation? Give an example.

The reshuffling of genes provides a way for certain gene segments to rearrange in order to produce new products or change their expression pattern. The relative positions of promoters and/or enhancers with respect to structural genes may influence transcription. Such gene reshuffling occurs in the production of immunoglobulins.

You and a close friend from the University of Tennessee go hiking in the mountains. You are surprised to see a salamander that is bright orange in color. Thinking that some overzealous Tennessee fans have painted this particular amphibian, you walk on. As you continue your hike, you find other salamanders of this species and note that there is variation in the coloration: some individuals are bright orange, but others are drab in color. You also note that these salamanders often eat bright orange insects. How might you explain the presence of the color polymorphism in this salamander species?

The salamander color is polygenic and multiple alleles code for it. It also is likely that the diet of the salamanders affects the expression of these genes

Briefly discuss the experimental evidence for the semi-conservative replication of DNA determined by in vitro experiments in the bacteria E. coli.

The semi-conservatice model implies that two parental strands seperate from eachother and each become a new template strand. The densities of 14N and 15N were used. Upon replication and a second round of replication, an immediate density would be observed implying that one was of the higher density and one of the lower. One strand is parental and one is a new strand.

What is the spliceosome?

The spliceosome is the RNA-protein complex that is responsible for intron-exon splicing in eukaryotes. Following the GU-AG rule, introns are excised and removed from mRNA and the exons are joined to form a mature mRNA molecule ready for translation. The spliceosome is made of five small nuclear ribonucleoproteins (snRNPs) which consists of proteins and one of five snRNAs (U1, U2, U4, U5 and U6) which together with over 100 proteins form the large biological machine used for splicing.

What role does RNA stability play in gene regulation? What controls RNA stability in eukaryotic cells?

The stability of mRNA influences gene expression by affecting the amount of mRNA available to be translated. The stability of mRNA is affected by the 5′ cap, the poly(A) tail, the 5′ UTR, the coding section, and sequences in 3′ UTR.

In DNA replication, the lagging strand is a) the strand which must be replicated in a direction toward the replication fork. b) the part of the DNA which is just about to be unwound. c) the strand which must be replicated in a direction away from the replication fork. d) the portion of the DNA that has been fully replicated. e) the portion of the helix that is not anti-parallel with its paired strand.

The strand which must be replicated in a direction away from the replication fork

In what way is 5'-azacytidine used (experimentally) in the treatment of sickle-cell anemia?

The use of 5'-azacytidine reduces the amount of methylation in certain hemoglobin genes and enhances expression (transcription).

17. The expected ratio of phenotypes among the progeny of a test cross is 1:1:1:1. Out of 200 total resulting progeny, 48 occur in one of the four phenotypic classes. Given this information, which of the following must also be true? a) Since 48 is so close to the expected value, there is no need to calculate chi square before drawing a conclusion about the ratio. b) The progeny of this cross do not conform to a 1:1:1:1ratio. c) At least one additional cell must also contain a count of 48. d) All of the other classes have observed values of 48 e) The value of observed - expected for this cell = -2.

The value for observed-expected for this cell=-2

Which of the following species is considered a genetic model organism?

The worm, Caenorhabditis elegans

Two highly inbred tobacco plants are crossed. One has dark green leaves. The other has yellow leaves. The F1 have light green leaves. Five hundred progeny from F1 × F1 crosses are analyzed. Their leaves show continuous variation in color, but none has dark green or yellow leaves. What do these data suggest about the number of genes determining this trait? Question options: There are 2 genes that determine this trait. There are 3 genes that determine this trait. There are 4 genes that determine this trait. There are more than 4 genes that determine this trait.

There are more than 4 genes that determine this trait

Approximately 5% of the cytosine residues are methylated in the genome of any given eukaryote. In what way is DNA methylation related to genetic regulation?

There is an inverse relationship between the degree of methylation of eukaryotic DNA and the degree of gene expression

What does it mean for a population to be in Hardy-Weinberg equilibrium?

There must be random mating in the population; there must be an infinite population size; and there must be no evolution occurring (no natural selection, no genetic drift, no migration and no mutation).

What happens to a chromosome that loses its centromere?

There would be no site for the attachment of spindle microtubules and so no separation of chromosomes during mitosis or meiosis. The chromosome is usually lost.

In the previous diagram, if there is a mutation in P and I, which of the following is true?

These are mutations that are, respectively, cis and trans acting on lac operon expression.

This Greek letter describes the shape of a bacterial chromosome mid-way through replication.

Theta

Which of the following statements about homologous chromosomes are true?

They always contain the same genes, They occur together in diploid cells

In what ways are eukaryotic transcription factors thought to function?

They appear to influence the structural organization of chromatin and possibly looping out of the DNA that separates the enhancer from the transcription initiation complex (transcription factors, promoter, RNA polymerase, etc.).

Prokaryotic chromosomes do no have telomeres because:

They are circular

Because real-life populations are, of course, not infinitely large, why is the Hardy-Weinberg condition of an "infinitely large population" usually met for natural populations?

They are met because many large populations are in the predicted Hardy-Weinberg proportions. Significant deviations arise only when population size is rather small. The chance factor has negligable effects, chance factors not effect, population is large

Which of the following is true of homeotic transformations in Drosophila? Question options: they can be passed on from generation to generation they are not amenable to genetic analysis they are caused by genes that are not conserved across species they are always caused by more than one mutation in these genes none of the above

They can be passed on from generation to generation

Which of the following statements about ddNTPs is true? They have a free 3′ hydroxyl group on the ribose sugar. DNA polymerase can add a new dNTP to a 3′ ddNTP. They have an oxygen at the 2′ carbon of the ribose sugar. They have a hydrogen at the 3′ carbon of the ribose sugar.

They have a hydrodgen at the 3' Carbon of the ribose sugar

What experimental methods led Avery, McCarty, and Macleod to determine that DNA was the "transforming material" in their classic experiments?

They injected a virulent strain, heat killed virulent strain, non virulent strain, and a combination of heat killed and non-virulent into mice. The combined strain resulted in death of the mice, hinting that the heat killed strain was able to transform the DNA of the non-virulent strain. They tested this by using RNAase, DNAase, and proteases to discover that transformation still occured with RNAase, and protease, but not with the DNAase. Hence, DNA is the transforming material, not RNA or proteins.

How did the work of Hershey and Chase contribute to the model of DNA as the genetic material?

They labeled bacteriophages DNA with P32, and their proteins with sulfur. After allowing a replication cycle the phage ghosts were removed from the product mixture, and the resultant progeny were infected with P32. This made it possibel to assume that DNA, not proteins were the genetic material of the cell.

Which three general characteristics must the genetic material possess?

They must contain complex information, replicate faithfully, and they must encode the phenotype.

Describe the direction of information flow in living systems. Use appropriate, scientific terms in your description.

This is also known as the central dogma, in which flow goes from DNA to RNA to proteins. The proteins are used by the living organism. They exist in many forms (primary, secondary, tertiary,quarteranry). Primary being a sequence of amino acids, and secondary being beta sheets and alpha helicies.

Nutritional mutations can be defined as those mutations that do not allow an organism to grow on minimal medium, but do allow the organism to grow on complete medium. all strains that are not auxotrophic. those mutations that change the composition of the medium. those mutations caused by site-specific mutagenesis. those mutations belonging to the group called prototrophs.

Those mutations that do not allow an organism to grow on minimal medium, but do allow the organism to grow on complete medium

Genetically speaking, brown eyes (B-) are dominant to blue eyes (bb). However, an individual can wear colored contacts in order to change his or her eye phenotype. Suppose a man with blue eyes (bb) marries a woman who appears to have blue eyes and together they have five children. Listed below are three possible outcomes. For each of the outcomes, predict the woman's genotype

Three children have blue eyes and two have brown eyes --> The woman naturally has brown eyes and is heterozygous for the traitAll five children have blue eyes --> The woman naturally has blue eyesAll five children have brown eyes --> The woman naturally has brown eyes and is homozygous for the trait.

What is the purpose of synteny testing?

To correlate the presence of particular chromosome with a particular gene product.

What is the purpose of a cDNA library? To produce a library of all genomic DNA of an organism. To produce a library of expressed genes. To replicate the genomic DNA. To produce a library of chloroplast genes.

To produce a library of expressed genes

DNA polymerase III adds nucleotides to internal sites in the DNA template. to the 5' end of the RNA primer. to both ends of the RNA primer. in the place of the primer RNA after it is removed. to the 3' end of the RNA primer.

To the 3' end of the RNA primer

Describe the general structure of a transcription factor.

Transcription factors are modular proteins with at least two functional domains: one binds to DNA in promoters and enhancers, and another activates transcription.

List the following events in the pre-RNA processing of a one intron-two exon gene in correct sequence order: •Attachment of snRNP U1 to the 5' splice site •Transesterification reaction at the branch point adenine •Transcription of the DNA template into the pre-mRNA molecule •Recognition and binding the 3' AAUAAA sequence by specific protein factors •Cleavage at the poly(A) site •Addition of the 5' cap •Export to the cytoplasm •Addition of the poly(A) tail •Release of lariat structure •Splicing together of exons

Transcription of DNA template into the pre-mRNA molecule Addition of 5' cap Recognition and binding the 3'AAUAAA sequence by specific protein factors Cleavage at the polyA site Addition of the polyA tail Attachment of snRNP U1 to the 5' splice site Transesterification reaction at the branch point adenine Release of lariat structure Splicing together of exons Export to the cytoplasm

Genetic regulation in eukaryotes can take place at a variety of levels from transcriptional to post-translational. At what level is genetic regulation considered most likely in prokaryotes? capping intron processing transcriptional polyadenylation of the 3' end of the mRNAs exon processing

Transcriptional

Regarding eukaryotic and prokaryotic genetic regulation, what process seems to be the most similar between the two? 5'-capping regulation intron/exon shuffling RNA splicing regulation poly(A) tail addition transcriptional regulation

Transcriptional regulation

When referring to attenuation in regulation of the tryptophan operon, it would be safe to say that when there are high levels of tryptophan available to the organism, translational termination is likely. transcriptional termination is likely. ribosomes are stalling during translation of the attenuator region. the tryptophan operon is being transcribed at relatively high levels. tryptophan is inactivating the repressor protein.

Transcriptional termination is likely

Process 2 is (see figure)

Translation

Process 2 is _____________. (diagram)

Translation

Two formal terms used to describe categories of mutational nucleotide substitutions in DNA are called error prone and spontaneous. transversions and transitions. base analogs and frameshift. euchromatic and heterochromatic. sense and antisense.

Transversions and transitions

A population may be in Hardy-Weinberg equilibrium for one locus but not for others. True False

True

All genetic drift arises from sampling errors and chance. True False

True

Genetic bottlenecks are a type of founder effect. True False

True

Genetic correlations result from pleiotropy. True False

True

Genetic variation must exist within a population before evolution can take place. True False

True

If an allele is "fixed" in a population, it has a frequency of 1.0. True False

True

In Drosophila homeotic genes are present in two gene complexes Question options: True False

True

Many plant cells remain totipotent throughout development. Question options: True False

True

Standard deviation is calculated in the same units as the original measurements, while variance is calculated in units squared. True False

True

T or F, A population may be in H-W equilibrium for one locus but not for others

True

T or F, An allele is fixed if it has a frequency of 1

True

T or F, Genetic Variation must exist in a population before evolution can take place

True

T or F, Genetic correlations result from pleiotropy.

True

T or F, Genetic drift arises from sampling errors and chance

True

T or F, Measures of heritability are specific to a defined population in a given environment.

True

T or F, The heritability of a individual cannot be estimated

True

T or F, When narrow-sense heritability is high for a particular trait, offspring tend to resemble their parents for that trait.

True

The heritability of an individual cannot be estimated. True False

True

When narrow-sense heritability is high for a particular trait, offspring tend to resemble their parents for that trait. True False

True

T or F, Standard deviation is calculated in the same units as the original measurements, while variance is calculated in units squared.

Ture

In what way do upstream activator sequences (UASs), regulatory sequences in yeast, differ from enhancers and silencers?

UASs function only upstream.

Transcription of the sequence AATGCGGTC would result in: TTACGCCAG Three amino acids UUACGCCAG Not enough information to tell

UUACGCCAG

Deletion of the _______ gene in Drosophila converts the third thoracic segment into the second thoracic segment, resulting in a fly with two sets of fully formed wings.

Ubx

What are some of the different signals that can initiate programmed cell death (apoptosis)?

Viral infection, DNA loss, Mitchondrial infection

According to Hardy-Weinberg, if we know the frequency of each allele in the population, what can we predict?

We can predict what genotypes and phenotypes we should see in the population.

The height and weight for three dogs are shown below. Fill in the blanks for the following table. (see quiz 2 q1)

Weight: mean 7, variance 9, SD 3 Height: mean 21, variance 81, SD 9

Explain how and why the h2 would change over generations of selective breeding for high egg-production. (see quiz 2 q2)

When a characteristic has been selected for many generations, the response eventually levels off. Because genetic variation may be exhausted, at some point all individuals are homozygous. When there is no more additive genetic variation, heritability equals zero and no further response to selection can occur.

Under the system of genetic control of the tryptophan operon, when there are high levels of tryptophan in the medium, transcription of CAP (CRP) occurs at high levels. when there are high levels of tryptophan in the medium, ribosomes "stall" and reduce the levels of tryptophan synthesized. when there is no tryptophan in the medium, transcription of the trp operon occurs at high levels. when there are high levels of tryptophan in the medium, transcription of the trp operon occurs at high levels. no transcription occurs under any nutritional circumstance because negative controls inhibit transcription.

When there is no tryptophan in the medium, transcription of teh trp operon occurs at high levels

Which of the following are not characteristics of maternal effect mutations? Question options: Wild-type offspring arise from crosses of heterozygous mutant fathers regardless of the genotype of the mother. When mutant offspring arise they account for 50% of the offspring. Heterozygous mutant fathers crossed to homozygous normal mothers will not produce normal offspring. Mutant offspring arise from homozygous mutant mothers irrespective of the genotypes of the father Mutant offspring arise from homozygous mutant fathers crossed to heterozygous mutant mothers.

Wild-type offsrping arise from crosses of heterozygous mutant fathers regardless of the genotype of the mother

Under certain conditions, the rate of mutation of a particular gene may be determined in humans. What properties of the mutation would favor the most direct determination of mutation rate in humans?

X-chromosome 100% penetrant fully expressed dominant

males and females are affected equally. affected fathers may have affected daughters, but never affected sons. half the children of affected mothers are affected.

X-linked dominant

-If a women with an affected father has children with an unaffected man, half of the sons and none of the daughters are affected.-Affected females always have an affected father and an affected maternal grandfather-The trait is never passed from father to son

X-linked recessive trait

What human condition is caused by unrepaired UV-induced lesions?

Xeroderma pigmentosum (XP)

Which modes of inheritance are influenced by the sex of individuals. Select all that apply. autosomal dominant Y-linked sex-limited X-linked autosomal recessive

Y-linked Sex-limited X-linked

Only males are affected.Affected fathers always pass the trait to sons.

Y-linked trait

are aminoacyl tRNA specific

Yes

Could the characteristics followed in the pedigree be caused by an X-linked recessive allele?

Yes, all individuals fit the X-linked recessive inheritance pattern.

During an experiment you come across a RF or 50%. What can you conclude about the two loci you are looking at?

You won't know if the two loci are either far apart on the same chromosome or are located on different chromosomes.

What are zinc fingers, and why are they frequently encountered in descriptions of genetic regulation in eukaryotes?

Zinc fingers consist of amino acid sequences containing two cysteine and two histidine residues at repeating intervals. Interspersed cysteine and histidine residues covalently bind zinc atoms, folding the amino acids into loops (zinc fingers). They are one of the major groups of eukaryotic transcription factors.

Which of these is a level of regulation in eukaryotes?

[x] processing [x] post-translational [x] transcriptional [ ] operon [x] transport

List in order of occurrence the phases of mitosis: Place one number, 1 through 5, in each box. ____prometaphase ____metaphase ____anaphase ______prophase ______telophase

_2___prometaphase __3__metaphase __4__anaphase ___1___prophase ____5__telophase

Match the Drosophila developmental stages with the gene families regulating the development of these stages. _____ Egg-polarity genes _____ Segmentation genes _____ Homeotic genes 1. Establishment of identity of each segment 2. Establishment of main body axis 3. Determination of number of body segments

__2___ Egg-polarity genes ___3__ Segmentation genes ___1__ Homeotic genes

Match the loss-of-function mutation phenotypes with the respective responsible gene classes ____ Segment-polarity genes ____ Gap genes ____ Pair-rule genes 1. Delete adjacent segments 2. Deletes every other segment 3. Affect polarity of segment; part of segment is replaced by mirror image of part of another segment.

__3__ Segment-polarity genes ___1_ Gap genes __2__ Pair-rule genes

Below are four processes common to most cloning experiments. Place components in the order in which they would most likely occur during a cloning experiment. Enter numbers 1-4 in the box below, with 1 indicating the process that you would do first. ______ ligating DNA fragments _____ plating bacteria on selective medium _____ cutting DNA with restriction endonucleases _____ transforming bacteria

___2____ ligating DNA fragments ___4__ plating bacteria on selective medium ____1_ cutting DNA with restriction endonucleases ___3__ transforming bacteria

6. Genetically speaking, brown eyes (B-) are dominant to blue eyes (bb). However, an individual can wear colored contacts in order to change his or her eye phenotype. Suppose a man with blue eyes (bb) marries a woman who appears to have blue eyes and together they have five children. Listed below are three possible outcomes. For each of the outcomes, predict the woman's genotype. ____ All five children have brown eyes. ____ Three children have blue eyes and two have brown eyes ____ All five children have blue eyes. Answers: 1. The woman naturally has blue eyes (bb). 2. The woman naturally has brown eyes and is heterozygous for the trait (Bb). 3. The woman naturally has brown eyes and is homozygous for the trait (BB).

____3___ All five children have brown eyes. _____2__ Three children have blue eyes and two have brown eyes. ___1___ All five children have blue eyes.

Match each term to the appropriate letter choice. a. additive, dominance, genic interaction b. distribution around the mean c. phenotype proportions d. pleiotropy e. bell-shaped f. regression coefficient g. relationship between variables h. correlation coefficient genetic varience

Match each term to the appropriate letter choice. a. All genetic information within a Mendelian population b. The mean trait value decreases from one generation to another c. Any change in allele frequencies within a population d. Probability of alleles being identical by descent e. Alleles may disappear from the population simply by chance f. Movement of genes g. Generation of new alleles gene pool

The chemical differences between DNA and RNA make RNA __________ stable than DNA and allow it to exist __________ in the life of most cells. Answer a) less, temporarily b) less, permanently c) more, permanently d) more, temporarily

Which enzyme catalyzes the elongation of a DNA strand in the 5' → 3' direction? a) DNA polymerase III b) topoisomerase c) DNA ligase d) primase

The following table lists several genotypes associated with the lac operon in E. coli. For each, indicate with a "+" or a "—" whether β-galactosidase would be expected to be produced at induced levels. (Assume that glucose is not present in the medium.) Genotype No lactose With lactose a I + O+ Z+/ F' I - O+ Z+ _________ _________ b I - Oc Z +/ F' I - O+ Z- __________ _________ c I s Oc Z +/ F' I + O+ Z+ __________ _________ d I - O+ Z +/ F' I - O+ Z+ __________ _________ I + = wild-type repressor I - = mutant repressor (unable to bind to the operator) I s = mutant repressor (insensitive to lactose) O+ = wild-type operator Oc = constitutive operator (insensitive to repressor)

a -,+ b -,+ c +,+ d-,-

UASs (upstream activating sequences) are DNase hypersensitive. This means that ________.

a UAS is constitutively open

What is a mutation?

a change in the DNA sequence

a) -,+ b)-,- c)+,+ d)+,+

Neurospora crassa was one of the first eukaryotic microbes to be adopted by geneticists as a model organism. It is a haploid fungus (n = 7) found growing on dead vegetation. When an assexual spore germinates, it produces a tubular structure that extends rapidy by tip growth, and throws off multiple side branches. The result is a mass of branched threads called hyphae, which consitute a colony. a) Give two reasons why Neurospora crassa lends itself well to its use as a model organism. b) Two albino strains of Neurospora crassa were isolated. When either one was mated with wild type (pink), it produced ½ albino and ½ wild-type. What can you deduce about the mutations on each of the albino strains?

a) Asexual colonies are easily and inexpensively maintained in the lab. The haploid state of Neurospora makes it ideal for mutational analyses as mutant alleles are always expressed directly in the phenotype. b) Each is a single gene mutation. Multiple-gene mutations would result in fewer wild-type progeny.

Translation is directly dependent on all of the following associations except _______. A) complementary base pairing between mRNA and DNA B) complementary base pairing between mRNA and rRNA C) association of the 30S and the 50S ribosomal subunits D) complementary base pairing between mRNA and tRNA

a) Complementary base pairing between mRNA and DNA

In trying to determine whether DNA or protein is the genetic material, Hershey and Chase made use of which of the following facts? a) DNA contains phosphorus, but protein does not b) DNA contains sulfur, whereas protein does not. c) DNA contains nitrogen, whereas protein does not. d) DNA contains purines, whereas protein includes pyrimidines

a) DNA contains phosphorus, but protein does not

Which of the following statements about the genetic code are TRUE? a) Most amino acids are encoded by more than one codon b) The code is ambiguous but not redundant c) There is only one codon for each amino acid d) Two consecutive bases specify an amino acid e) None of the above

a) Most amino acids are encoded by more than one codon

Which term describes a mutation that restores function to a loss-of-function mutant? a) Suppressor b) Balancer c) Conditional d) Enhancer

a) Suppressor

Which statement is true regarding negative supercoiled DNA? a) That negative supercoiled DNA is underrotated allows for easier strand separation during replication and transcription. b) Negative supercoiled DNA carries more negative charges than positive supercoiled DNA does. c) Negative supercoiled DNA is not usually seen in cells. d) All of the above statements are true. e) Negative supercoiled DNA has 10 base pairs per turn of its helix

a) That negative supercoiled DNA is underrotated allows for easier strand separation during replication and transcription.

How do the daughter cells at the end of mitosis and cytokinesis compare with their parent cell when it was in G1 of the cell cycle? a) The daughter cells have the same number of chromosomes and the same amount of DNA b) The daughter cells have half the number of chromosomes and half the amount of DNA c) The daughter cells have the same number of chromosomes and twice the amount of DNA d) The daughter cells have half the amoung of cytoplasm and half the amount of DNA e) The daughter cells have the same number of chromosomes and half the amount of DNA

a) The daughter cells have the same numbe rof chromosomes and the same amount of DNA

The genetic frequencies of two separate populations are: Population: AA Aa aa 1: 0.36 0.48 0.16 2: 0.55 0.10 0.35 a) What are the genotypic frequencies of the two populations? b) What are the allele frequencies? c) Are the populations in Hardy-Weinberg equilibrium?

a) expected frequencies are same as given b)1. A 0.6 a 0.4 2. A 0.74 a.26 c) yes population 1 is in hardy-weinberg equilibrium but population 2 is not

The chemical differences between DNA and RNA make RNA __________ stable than DNA and allow it to exist __________ in the life of most cells. a) less, temporarily b) less, permanently c) more, temporarily d) more, permanently

a) less, temporarily

Which of the following statements best describes the messenger RNA? a) mRNA is the only type of RNA that carries DNA's protein building instructions b) genetic information is permanently stored in mRNA c) mRNA consists of an anti-codon and an amino acid d) mRNA is synthesized by ribosomes in the endoplasmatic reticulum e) mRNA molecules have a double-helix structure

a) mRNA is the only type of RNA that carries DNA's protein building instructions

Homologous chromosomes move toward opposite poles of the dividing cell during a) meiosis I b) binary fission c) mitosis d) meiosis II

a) meiosis I

The antiparallel nature of DNA refers to a) the opposite direction of the two strands of nucleotides. b) its charged phosphate groups c) the formation of hydrogen bonds between bases from opposite strands d) the pairing of bases on one strand with bases on the other strand

a) the oppisite direction of the two strands of nucleotides

A new kind of tulip is produced that develops only purple or pink flowers. Assume that flower color is controlled by a single-gene locus, and that the purple allele (C) is dominant to the pink allele (c). A random sample of 1000 tulips from a large cultivated field yields 847 purple flowers, and 153 pink flowers. a) Determine the frequency of the purple and pink alleles in this field population. b) Estimate the proportion of all purple flowering plants that are heterozygotes and homozygotes

a)0.153 b)Heterozygotes:403 purple Homozygotes:315

Human blood type is determined by three alleles IA, IB, and IO. The alleles IA and IB are co-dominant to each other, and both are dominant to IO. Within a large, randomly mating population (540,000 individuals), the frequencies for the blood type alleles are 0.3 for the IA allele; 0.6 for IO, and 0.1 for the IB allele. a) Calculate the expected numbers of people in the population having each blood type A, B, AB, and O. b)Determine the percentage of type B people that are heterozygotes (IBIO). (p+q+r)2

a)A-243,000 (45%), B-70,200 (13%), AB-32,400 (6%), O-194,400 (36%) b)12%

. Drosophila melanogaster, the fruit fly, has a 2n chromosome number of 8. Assuming that a somatic G2 nucleus contains about 8.0 picograms of DNA, how many picograms of nuclear DNA would you expect in: a) Mitotic metaphase b) a primary oocyte (metaphase) c) a secondary oocyte (metaphae) d) a first polar body (metaphase) a-d: 8, 4, 2, 2 a-d: 8, 8, 4, 4 a-d: 8, 4, 4, 4 a-d: 4, 4, 8, 8

a-d:8,8,4,4

DNA gyrase: a.supercoil removal b.RNA primer synthesis c.3' → 5' exonuclease activity d.lagging strand esingle-strand breaks f.unidirectional replication g.strand invasion h.leading strand i.phosphodiester bonds at DNA nicks j.translesion DNA synthesis k.bidirectional circular replication

The antiparallel nature of DNA refers to a) the opposite direction of the two strands of nucleotides. b) the pairing of bases on one strand with bases on the other strand c) its charged phosphate groups d) the formation of hydrogen bonds between bases from opposite strands

A new kind of tulip is produced that develops only purple or pink flowers. Assume that flower color is controlled by a single-gene locus, and that the purple allele (C) is dominant to the pink allele (c). A random sample of 1000 tulips from a large cultivated field yields 847 purple flowers, and 153 pink flowers. a.Determine the frequency of the purple and pink alleles in this field population. b. Estimate the proportion of all purple flowering plants that are heterozygotes and homozygotes.

a. 0.153 b. Heterozygotes: 403 purple Homozygotes: 315

In a tropical human population in Hardy-Weinberg equilibrium for an autosomal locus determining presence/absence of pigment in the skin, the frequency of albinism (aa) is 1 in 10,000. The frequency of heterozygotes is approximately: a. 1 in 50 b. 1 in 100 c. 1 in 1000 d. 1 in 75 e. 1 in 25

a. 1 in 50

Which of these sequences could form a hairpin (stem-loop)? a. 5' GGGGTTTTCCCC 3' b. 5' AAAAAAAAAAAA 3' c. 5' ACACACACACAC 3' d. 5' TTTTTTCCCCCC 3'

a. 5' GGGGTTTTCCCC 3'. A hairpin loop is an unpaired loop of messenger RNA (mRNA) that is created when an mRNA strand folds and forms base pairs with another section of the same strand. The resulting structure looks like a loop or a U-shape.

Human blood type is determined by three alleles IA, IB, and IO. The alleles IA and IB are co-dominant to each other, and both are dominant to IO. Within a large, randomly mating population (540,000 individuals), the frequencies for the blood type alleles are 0.3 for the IA allele; 0.6 for IO, and 0.1 for the IB allele. a. Calculate the expected numbers of people in the population having each blood type A, B, AB, and O. b. Determine the percentage of type B people that are heterozygotes (IBIO).

a. A-243,000 (45%), B-70,200 (13%), AB-32,400 (6%), O-194,400 (36%) b. (p+q+r)2 92.3%

List some important differences between bacterial and eukaryotic cells that affect the way in which genes are regulated.

a. Bacterial genes organized into operons, while Eukaryotic genes are not organized into operons and are transcribed from its own promoter. b. In eukaryotic cells, DNA must be unwound from histone proteins prior totranscription occurring. c. In eukaryotic cells, activators are more common than in bacterial cells. d. In bacteria, transcription and translation can occur concurrently. In eukaryotes,the nuclear membrane separates transcription from translation (greater diversity)

The long-term storage of genetic information in a cell occurs in the: a) DNA b) microRNA c) mRNA d) RNA

a. DNA

a. Most amino acids are encoded by more than one codon.

Heinz Shuster collected the following data on the base composition of rib grass virus. On the basis of this information (see below) is the hereditary information of the ribgrass virus RNA or DNA? Is it likely to be single stranded or double stranded? Percent: A: 29.3 G: 25.8 C: 18.0 T: 0.0 U: 27.0 a. RNA b. DNA c. single stranded d. double stranded

a. RNA, c. single-stranded

Telomeres________________the end of chromosomes a) stabilize b) replicate c) transcribe d) destabilize

a. Stabilize

In peas, tall is dominant to short. A homozygous tall plant is crossed with a short plant. The F1 are self-fertilized to produce the F2. Both tall and short plants appear in the F2. a. If the tall F2 are self-fertilized, what types of offspring and proportions will be produced? b. If the short F2 are self-fertilized, what types of offspring and proportions will be produced?

a. The tall will produce a tall to 3 TT : 1 Tt b. The short will only produce all short tt

The anticodon on the tRNA molecule: a. binds to the mRNA in a complementary fashion. b. is oriented and written in the 5'→ 3' direction. c. is a catalytic part of protein synthesis. d. is the same for all tRNA molecules. e. contains amino-acyl-tRNA synthtase.

a. binds to the mRNA in a complementary fashion.

Once transcribed, eukaryotic mRNA typically undergoes substantial alteration that includes: a) excision of introns b) union with ribosomes c) fusion into circular forms known as plasmids d) linkage to histone molecules

a. excision of introns

A Mendelian population is defined by individuals a. interbreeding. b. inbreeding. c. evolving. d. living in close proximity. e. migrating.

a. interbreeding.

Which of the following evolutionary forces does NOT change allele frequencies? a. nonrandom mating b. mutation c. selection d. drift e. migration

a. nonrandom mating

a. supercoil removal

22. In a healthy male, how many sperm cells would be expected to be formed from (a) 400 primary spermatocytes? (b) 400 secondary spermatocytes? a) 800, b) 800 a) 1600, b) 1600 a) 1600, b) 800 a) 400, b) 400 a) 100, b) 800

a.)1600, b.)800

What modification neutralizes the charges on histones that promote ionic interaction with DNA?

acetylation

DNA methylation may be a significant mode of genetic regulation in eukaryotes. Methylation refers to altering RNA polymerase activity by methylation. addition of methyl groups to the cytosine of CG doublets. alteration of DNA polymerase activity by addition of methyl groups to glycine residues. changes in DNA-DNA hydrogen binding. altering translational activity especially of highly methylated tRNAs.

addition of methyl groups to the cytosine of CG doublets

DNA methylation may be a significant mode of genetic regulation in eukaryotes. Methylation refers to ________.

addition of methyl groups to the cytosine of CG doublets

DNA methylation may be a significant mode of genetic regulation in eukaryotes. Methylation refers to

addition of methyl groups to the cytosine of CG doublets.

The cumulative contribution made by all the genes that contribute to a quantitative trait

additive effects

After translation, eukaryotic proteins can be modified by

all of the above.

A form of a gene that has a slightly different sequence than other forms of the same gene but encodes the same type of an RNA or protein, is called a(n)

allele

Which of the following is the fastest way for an enzyme to respond to changing conditions in the cell? Question options: A) altering the enzyme's activity by allostearic effectors (activators or inhibitors) B) changing the enzyme's compartmentalization or location in the cell C) controlling the synthesis or degradation of the enzyme in the cell D) covalently modifying the enzyme in the cell (by phosphorylation)

altering the enzyme's activity by allostearic effectors (activators or inhibitors)

In each round of the elongation cycle of protein synthesis, a new _______ binds to the codon in the _______ site, then the peptide is transferred from the tRNA in the _______ site to the new aminoacyl-tRNA, and finally the entire _______ moves along the mRNA in a 5' to 3' direction: a. mRNA; E; P; polymerase b; tRNA; P; A; peptidyl-tRNA c. aminoacyl-tRNA; A; P; ribosome d. synthetase; P; A; ribosome

aminoacyl-tRNA; A; P; ribosome

QTL mapping requires all of the following except: Question options: genetic markers. offspring. a genetic map. a controlled cross. an estimate of homozygosity in the population.

an estimate of homozygosity in the population

human females with XY chromosome and a mutation in their receptor gene have:

androgen insensitivity syndrome

The bicoid mRNA is localized at the ________ end of the Drosophila egg.

The nanos mRNA is localized at the ________ end of the Drosophila egg.

In what part of the mRNA does degradation generally begin?

at the 3' end with the removal of the poly(A) tail

Extensive pedigree analysis on a characteristic shows all of the following: the characteristic affects males and females equally; two unaffected parents can have an affected child.; in families in which the parents are unaffected but the children are affected, 1/4 of the children are affected.

autosomal recessive

Match the phenomenon to its effect on populations. There is only one best answer for each number. You may use letters more than once. a. Allele frequencies become more similar across populations. b. Generation of new alleles changes allele frequencies very slowly. c. Alleles may disappear from the population simply by chance. d. Allele frequencies do not change. e. The mean trait value decreases from one generation to another. mutation

Two eukaryotic proteins were found to be very similar except for one domain that was very different. Which of the following processes is most likely to have contributed to this phenomenon? Question options: a) multiple random mutations within specific exons of the gene. b) differences in pre-mRNA splicing that results in an altered pattern of exon inclusion. c) differential acetylation of specific histone proteins prior to transcription. d) use of different transcriptional activators. e) All of the above.

Regulatory proteins that bind DNA have common motifs that interact with sequences of DNA. How do amino acids in DNA-binding proteins interact with DNA? Question options: a) By forming covalent bonds with DNA bases b) By forming hydrogen bonds with DNA bases c) By forming covalent bonds with DNA sugars d) None of the above. e) a) and c)

b) By forming hydrogen bonds with DNA bases

How do centromeres help control the cell cycle? a) by activating cell cycle control genes b) by inhibiting anaphase until spindle fibers are attached to chromosomes c) by inhibiting the S phase until the cell is ready to double its DNA content d) by causing DNA not attached to centromeres to be lostby inhibiting anaphase until spindle fibers are attached to chromosomes

b) by inhibiting anaphase until spindle fibers are attached to chromosomes

Which of the following terms best characterizes catabolite repression associated with the lactose operon in E. coli? Question options: a) constitutive b) positive control c) repressible system d) inducible system e) negative control

b) positive control

Nutritional mutations can be defined as Question options: a) all strains which are not auxotrophic. b) those mutations which do not allow an organism to grow on minimal medium, but do allow the organism to grow on complete medium. c) those mutations caused by site-specific mutagenesis d) those mutations which change the composition of the medium. e) those mutations which change the composition of the medium.

b) those mutations which do not allow an organism to grow on minimal medium, but do allow the organism to grow on complete medium.

Frameshift mutations are caused by the __________ or __________ of one or more nucleotides in DNA. a. chemical modification b. removal c. reversion d. insertion e. suppression

b, removal d. insertion

DNA primase a.supercoil removal b.RNA primer synthesis c.3' → 5' exonuclease activity d.lagging strand esingle-strand breaks f.unidirectional replication g.strand invasion h.leading strand i.phosphodiester bonds at DNA nicks j.translesion DNA synthesis k.bidirectional circular replication

An mRNA has the codon 5' UAC 3'. What tRNA anticodon will bind to it? a. 5' AUG 3' b. 3' AUG 5' c. 5' ATC 3' d. 3' ATC 5'

b. 3' AUG 5'

A particular triplet of bases in the template strand of DNA is 5' AGT 3'. The corresponding codon for the mRNA transcribed is: a) 3 'ACU 5' b) 3' UCA 5' c) 5' TCA 3' d) 3' UGA 5'

b. 3' UCA 5'

Which of the following is a concern of population genetics? a. How the cell copies its DNA b. How many people have color blindness in Utah c. How proteins fold under different pH conditions d. What causes sickle cell anemia? e. Why is cancer a difficult disease to treat?

b. How many people have color blindness in Utah

The "RNA World" theory suggests that a. RNA is the intermediate between DNA and proteins. b. RNA was the genetic material in the first living cells. c. many RNAs are capable of self-splicing. d. eventually RNA will become the genetic material of most living organisms. e. RNA viruses are more dangerous than DNA viruses.

b. RNA was the genetic material in the first living cells.

Translation of RNA into protein takes place on which cellular organelle? a) Nucleus b) Ribosome c) tRNA d) Polymerase

b. Ribosome

Which of the following are role(s) of the 5' cap? a. The cap helps the RNA polymerase find the promoter and initiate transcription. b. The cap plays a role in the removal of introns. c. The cap acts as a binding site for the ribosome. d. The cap protects the RNA from degradation. e. none of the above

b. The cap plays a role in the removal of introns. c. The cap acts as a binding site for the ribosome. d. The cap protects the RNA from degradation.

In DNA replication, the lagging strand is: a) the part of the DNA which is just about to be unwound. b) the strand which must be replicated in a direction away from the replication fork. c) the portion of the DNA that has been fully replicated. d) the strand which must be replicated in a direction toward the replication fork. e) the portion of the helix that is not anti-parallel with its paired strand.

b. The strand which must be replicated in a direction away from the replication fork.

In the DNA double helix: a) the number of hydrogen bonds between the participating bases is always constant b) a purine always pairs with a pyrimidine c) disulfide bridges are formed between the two DNA strands d) A pairs with G, and T pairs with C e) None of the above

b. a purine always pairs with a pyrimidine.

What secondary structures are formed when single-stranded DNA or RNA is inverted and complementary? a) double helix b) hairpin c) Z-DNA d) B-DNA

b. hairpin

Population genetics is concerned with: a. how genes produce proteins. b. how genes confer relative reproductive success on the individuals. c. whether allele frequencies are changing over time. d. how genes interact with one another. e. (b) and (c) above.

b. how genes confer relative reproductive success on the individuals. c. whether allele frequencies are changing over time.

The probability that two alleles are identical by descent is the __. a. coalescent b. inbreeding coefficient c. panmictic constant d. outcrossing rate e. relatedness

b. inbreeding coefficient

A major difference between Mendelian and quantitative traits is in _______________ a. small differences between average phenotypes compared to differences between individuals within genotypes b. large differences between average phenotypes compared to differences between individuals within genotypes c. that statistical properties of Mendelian traits are better understood d. that statistical properties of quantitative traits are better understood e. there are no differences between them

b. large differences between average phenotypes compared to differences between individuals within genotypes

A gene or a trait is said to be polymorphic if: a. one form exists in the population. b. more that one form exists in the population. c. the allele frequency is ~50:50 for each gene or trait. d. the allele frequency of one trait is dominant over all others. e. one allele occurs at a frequency of less than 1%

b. more that one form exists in the population.

Splicing of eukaryotic pre-mRNA involves ___ reactions and occurs in the ___ . a. methylation b. transesterification c. polyadenylation d. nucleus e. cytoplasm

b. transesterification, d. nucleus.

This structure forms when an extra X chromosome is methylated and largely inactivated. It is most commonly found in females.

barr body

A _________________, which binds to a core promoter, consists of general transcription factors and RNA polymerase.

basal transcription apparatus

High concentration of which which protein stimulates the development of anterior structures? Question options: Nanos Toll Bicoid Dorsal

bicoid

The lac repressor protein controls expression of the lac operon via ________________

binding to the lac operator site to repress expression

An insulator is also known as a __________________

boundary element

An insulator is also known as a(n) __________________ .

boundary element

Transcription of the sequence AATGCGGTC would result in: A) TTACGCCAG B) Three amino acids C) UUACGCCAG D) Not enough information to tell

Evolution occurs: a. only through natural selection. b. only when the environment is changing. c. only via natural selection, genetic drift, migration, or mutation. d. only via natural selection, genetic drift, migration, or mutation. e. by altering physical traits but not behavioral traits.

c&d. only via natural selection, genetic drift, migration, or mutation.

The spliceosome is a large enzyme that catalyzes removal of specific: a) junk sequences in the DNA by splicing different parts of a gene. b) amino acid sequences in the protein by splicing different parts of a protein. c) introns in pre-mRNAs. d) sequences in either a DNA or an RNA e) None of the above.

c) introns in pre-mRNAs.

Migration tends to __genetic variation between subpopulations and __ genetic variation within each subpopulation. a. increase b. not change c. reduce d. standardize e. invert

c, a

The poly(A) tails found in the 3' end of an mRNA are important for all the processes listed below except for ___ and ___. a. mRNA stability b. translation c. intron splicing d. protein stability

c, d.

The heterozygote genotype frequency term for a gene with two alternate alleles A (frequency of p) and a (frequency of q) in the Hardy-Weinberg equation is: a. p2 b. q2 c. 2pq d. (p+q) e. P+2pq+q2

c. 2pq

What is a gene? a) A sequence of amino acids that catalyze a reaction b) A sequence of DNA that tells polymerase where to begin transcription c) A sequence of DNA that encodes a protein d) A sequence of RNA that regulates expression

c. A sequence of DNA that encodes a protein.

In what cellular compartment are introns removed from pre-mRNA to make mature mRNA? a.Cytoplasm b. Endoplasmic Reticulum c. Nucleus d. Mitochondria e. Golgi apparatus

c. Nucleus

What would Avery, Macleod, and McCarty have concluded if their results had been that only RNAse treatment of the heat-killed bacteria prevented transformation of genetic virulence? a) that protein was the genetic material b) that DNAse or protease, but not RNase, stimulates transformation c) that RNA was the genetic material d) that DNA was the genetic material

c. That RNA was the genetic material

Which one of the following statements regarding eukaryotic transcriptions is not true? a. Eukaryotic transcription involves a core promoter and a regulatory promoter. b. There is no one generic promoter. c. A group of genes is transcribed into a polycistronic RNA. d. Chromatin remodeling is necessary before certain genes are transcribed.

c. a group of genes is transcribed into a polycistronic RNA

Which is a characteristic of DNA sequences at the telomeres? a) One strand protrudes beyond the other, creating some single-stranded DNA at the end. b) The consist of repeated sequences c) all choices are correct d) They consist of cytosine and adenine nucleotides

c. all choices are correct

Migration tends to __genetic variation between subpopulations and __ genetic variation within each subpopulation. a. increase b. not change c. reduce d. standardize e. invert

c. reduce a. increase

DNA consists of repeating units of nucleotides. Which is NOT a component of a nucleotide? a) a deoxyribose sugar b) purine or pyrimidine nitrogen-containing bases c) a ribose sugar d) DNA contains all of the above. e) phosphate

c. ribose

To translate a mRNA you require two other RNAs. These are: a. tRNA and mRNA. b. tRNA and miRNA. c. tRNA and rRNA. d. rRNA and siRNA

c. tRNA and rRNA

What would Hershey and Chase have concluded if phage ghosts contained 32P label but were absent from infected E. coli? Furthermore, they found 35S lacking in the ghosts and present in the infected E. coli. a) that protein and DNA together made up the genetic material b) that somehow the radioactivity prevented DNA from getting into E. coli c) that protein was the genetic material in phage d) that DNA was the genetic material in phage

c. that protein was the genetic material in phage.

In prokaryotes, translation of an mRNA is coupled to a) mRNA splicing b) mRNA processing c) transcription d) nuclear export e) None of the above

c. transcription

The "distance" between two linked gene pairs can be expressed as a percentage. Name the unit based on percent recombination that was created in honour of the scientist who pioneered the use of fruit flies for genetic research.

centimorgans

the attachment point on the chromosome for spindle microtubules

centromere

Recent discoveries on causes of fragile-X syndrome, myotonic dystrophy, and Huntington disease indicate what type of genetic alteration?

change in trinucleotide repeats

Recent discoveries on causes of fragile-X syndrome, myotonic dystrophy, and Huntington disease indicate what type of genetic alteration?

changes in trinucleotide repeats

During prophase I of meiosis, crossing over is indicated by what microscopically visible structure?

chiasma

The cellular organelles with inheritance independent of the nucleus are the _____________ and the ____________ .(comma in between)

chloroplasts, mitochondria

Proteins that affect chromatin structure without altering histone chemical structure are called _______________.

chromatin-remodeling complex

List the different types of chromosome mutations and define each one.

chromosome rearrangements: Alter the structure of chromosomes aneuploids: the number of chromosomes is altered polyploids: one or more complete sets of chromosomes are added

Within cells, genes are located on structures called

chromosomes

In anaphase

chromosomes move to opposite poles

A promoter that affects only genes that are on the same piece of DNA is ____________-acting.

cis

Which of the following clusters of terms applies when addressing enhancers as elements associated with eukaryotic genetic regulation?

cis-acting, variable orientation, variable position

Which of the following clusters of terms applies when addressing enhancers as elements associated with eukaryotic genetic regulation? Question options: cis-acting, vairable position, fixed orientation cis-acting, variable orientation, variable position trans-acting, fixed position, fixed orientation trans- and cis-acting, variable position cis-acting, fixed position, fixed orientation

cis-acting, variable orientation, variable position

Which of the following clusters of terms applies when addressing enhancers or silencers as elements associated with eukaryotic genetic regulation?

cis-acting, variable orientation, variable position

Name the two strategic methods that scientists are using to sequence genomes.

clone-by-clone method and shotgun sequencing

Which of the following polymorphisms is the most efficient for use in population genetics studies? Question options: Amino acid sequence polymorphisms Restriction site variation Chromosomal polymorphisms Complete sequence variation Variable number of tandem repeats

complete sequence variation

Mutations in the lacI and lacO genes in the lactose system often lead to full production of the three structural genes related to the lac operon even with no lactose available to the organism. Such mutations would be called________.

consitutive

A condition in which a gene or group of genes is expressed all the time.

constitutive

The Human Genome Project, which got under way in 1990, is an international effort to construct a physical map of the 3.3 billion base pairs in the human genome. collect samples of cells from all parts of the world in order to preserve human genetic diversity. clone beneficial genes from humans for eventual use in gene therapy. collect plant seeds in order to reduce the impact of human activity on plant extinction. clone deleterious genes from humans and study their mode of action.

contsruct a physical map of 3.3 billion base pairs in the human genome

Which of the following statistical term is a not measure of central tendency? Question options: The Mean The Mode The Median Correlation All of the above

correlation

backcross

crossing an F1 individual to either on the of the P1 parents

testcross

crossing of F2 offspring to a homozygous recessive individual to determine genotype of the F2 individual`

Human racial differences are produced by Question options: A) cultural factors as well as multiple genes that affect several traits. B) multiple genes that affect several traits. C) multiple genes that affect skin color. D) a single gene that affects skin color.

cultural factors as well as multiple genes that affect several traits

Which of the following best describes the addition of nucleotides to a growing DNA chain? a) A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate. b) A nucleoside triphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate. c) A nucleoside diphosphate is added to the 5' end of the DNA, releasing a molecule of pyrophosphate. d) A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate.

d) A nucleoside triphosphate is added to the 3' end of the DNA, releasing a molecule of pyrophosphate.

Which of the following polymorphisms is the most efficient for use in population genetics studies? a. Amino acid sequence polymorphisms b. Restriction site variation c. Chromosomal polymorphisms d. Complete sequence variation e. Variable number of tandem repeats

d) Complete sequence variation

Which of the following statements is NOT true about enhancers? a) Enhancers can be located thousands of nucleotides upstream of downstream of the gene they affect. b) Enhancers contain sequences that are recognized by transcription factors. c) Enhancers can differ for each gene in a eukaryotic cell (although overlap is possible). d) Enhancers are recognized by and bind directly to RNA polymerase. e) Enhancers represent control elements located far away from the promoter.

d) Enhancers are recognized by and bind directly to RNA polymerase.

As a ribosome translocates along an mRNA molecule by one codon, which of the following occurs? a) The tRNA that was in the A site departs from the ribosome via a tunnel. b) The tRNA that was in the A site moves to the E site and is released. c) The tRNA that was in the P site moves into the A site. d) The tRNA that was in the A site moves into the P site.

d) The tRNA that was in the A site moves into the P site.

DNA replication is semi-conservative in that a) DNA replication can only follow the replication fork on the leading strand. b) The two strands of the original helix are not conserved, but the base sequence in the DNA is preserved. c) The base sequence of a DNA a molecule is conserved, with very high fidelity, in DNA replication. d) The two stands of the original helix are conserved, but they become part of separate progeny DNAs.

d) The two stands of the original helix are conserved, but they become part of separate progeny DNAs.

The role of tautomerism in causing mutations relates to the fact that the process ultimately affects the: Question options: a) deoxiribose sugar b) ability of DNA to replicate at all c) covalent bonding affinities of nitrogenous bases d) hydrogen bonding affinities of nitrogenous bases

d) hydrogen bonding affinities of nitrogenous bases

The packaging of DNA into a confined space is what level of DNA structure? a) quaternary b) secondary c) primary d) tertiary

d) tertiary

The continuous distribution of quantitative traits is attributed to the fact that traits are influenced both by ______________ and by _____________ factors. a. environmental b. dominance c. measurement error d. many loci e. human error

d, a

Knowing the ___________ of a trait has great practical importance because it allows statistical predictions regarding the phenotypes of offspring to be made on the basis of the parent's _____________. a. variance b. inbreeding coefficient c. phenotype d. heritability e. genotype

d, c

Hairpins are formed in DNA as a result of a) sequences on the same strand that are identical b) sequences on the opposite strand that are identical c) sequences on the opposite strand that are complementary d) sequences on the same strand that are inverted and complementary

d- sequences on the same strand that are inverted and complementary

In a human population, the genotype frequencies at one locus are 0.5 AA, 0.4 Aa, and 0.1 aa. The frequency of the A allele is: a. 0.20 b. 0.32 c. 0.50 d. 0.70 e. 0.90

d. 0.70

If the following DNA strand was used as a template, what would the sequence of an RNA be? 5' GTACCGTC 3' a. 5' GUACCGUC 3' b. 5' GACGGTAC 3' c. 5' CAUGGCAG 3' d. 5' GACGGUAC 3' e. 5' GUCGGUAC 3'

d. 5' GACGGUAC 3'

d. 500

Which of the following statistical term is a not measure of central tendency? a. The Mean b. The Mode c. The Median d. Correlation e. All of the above

d. Correlation

Reverse transcriptase (from a retrovirus like HIV) generates: a) RNA from an RNA template b) DNA from DNA c) Genomic DNA from protein d) DNA from RNA e) RNA from a DNA template

d. DNA from RNA

When this molecule is synthesized, both strands of a DNA molecule are used as a template. a.RNA only b.DNA only c.both RNA and DNA d.neither RNA nor DNA

d. DNA only

______________ can cause the same genotype to produce a range of potential phenotypes. a. Epistasis b. The inbreeding coefficient c. Hybrid vigor d. Environmental effects e. Heritability

d. Environmental effects

Before DNA was known to be the genetic material, scientists knew that genetic material must do or be all of the following, EXCEPT that: a) genetic material must encode the phenotype. b) genetic material must contain complex coding information c) genetic material must replicate faithfully. d) genetic material must be composed of many different units to account for the variability seen in nature.

d. Genetic material must be composed of many different units to account for the variability seen in nature.

The TATA-binding protein (TBP) binds to the TATA box sequence in eukaryotic promoters. What is its function in transcriptional initiation? a. It blocks access of RNA polymerase to the promoter, until removed by general transcription factors. b. It is the subunit of prokaryotic RNA polymerase that is required to recognize promoters. c. It modifies histones so that nucleosomes can be removed from DNA for transcription. d. It bends and partly unwinds DNA at a promoter.

d. It bends and partly unwinds DNA at a promoter.

If mating occurs solely between relatives, eventually what will happen to the population? a. It will become completely heterozygous. b. It will remain in equilibrium. c. It will become polymorphic for all shared traits. d. It will become completely homozygous. e. The individuals in the population will have more dominant alleles.

d. It will become completely homozygous.

Inbreeding in populations that are normally outbreeding leads to which of the following? a. A smaller population b. A higher rate of mutation c. A higher rate of genetic drift d. More individuals affected by rare diseases e. An increase in the frequency of heterozygotes

d. More individuals affected by rare diseases

Which of the following statements is not true concerning RNA and DNA? a) DNA is transcribed into RNA which is translated into protein b) The sugar portion of RNA and DNA are different c) DNA is permanent in a cell, RNA is temporary d) RNA is more stable than DNA

d. RNA is more stable than DNA.

Two highly inbred tobacco plants are crossed. One has dark green leaves. The other has yellow leaves. The F1 have light green leaves. Five hundred progeny from F1 × F1 crosses are analyzed. Their leaves show continuous variation in color, but none has dark green or yellow leaves. What do these data suggest about the number of genes determining this trait? a. There are 2 genes that determine this trait. b. There are 3 genes that determine this trait. c. There are 4 genes that determine this trait. d. There are more than 4 genes that determine this trait.

d. There are more than 4 genes that determine this trait.

Which is not true of amino acids? a) There are 20 of them required in the body b) They are the building blocks of proteins c) tRNA brings them to the ribosome for protein synthesis d) all of the above are true

d. all of the above are true.

A bacterial protein is encoded by the following mRNA sequence: AUGGUGCUCAUGCCCTAA.... The second methionine codon (AUG) in this mRNA sequence will: a. serve as the initiation codon. b. encode N-formylmethionine. c. encode methionine that will eventually be removed. d. encode unformylated methionine.

d. encode unformylated methionine.

Any change in a population from Hardy-Weinberg equilibrium can be defined as ______. a. mutation b. genetic equilibrium c. migration d. evolution e. natural selection

d. evolution

d. heritability c. phenotype

Total phenotypic variance can be decomposed into all but one of these components: a. genetic-environment interaction variance. b. genetic variance. c. environmental variance. d. heritability.

d. heritability.

Okazaki Fragments: a.supercoil removal b.RNA primer synthesis c.3' → 5' exonuclease activity d.lagging strand e. single-strand breaks f.unidirectional replication g.strand invasion h.leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k.bidirectional circular replication

d. lagging strand

In a population in Hardy-Weinberg equilibrium, what will be the proportion of matings between homozygotes? a. p2 + 2pq b. P4 c. p4 + q4 d. p4 + q4 + 2p2q2 e. 4p2q2

d. p4 + q4 + 2p2q2

Which of the following is NOT an example of nonrandom mating? a. positive assortative mating b. inbreeding c. outbreeding d. panmixis e. negative assortative mating

d. panmixis

Mutations in the promoter region of the β-globin gene indicate that some areas are more sensitive than others. When mutations occur in consensus sequences (modular elements such as GC box, CAAT box, TATA box), does transcription usually increase or decrease?

decrease

Over the past decade, the most significant finding in biology has been the identification of miRNAs and siRNAs and their role in regulating the development of many multicellular organisms. Briefly describe the four different ways these small RNAs influence gene expression.

degrading mRNA: through slicer activity inhibiting transcription: transcriptional silencing due to methylation of either histone proteinsor DNA sequences inhibiting translation: binding of complementary regions with the mRNA molecule by miRNAs to prevent translation (premature termination) silence genes:slicer-independent mRNA degradation stimulated by miRNA binding to complementary regions in the 3' UTR of the mRNA

The ability of an organism to modify its development in response to environmental conditions is called Question options: a) macroevolution. b) change. c) use of molecular tools. d) developmental plasticity. e) genetic switching.

developmental plasticity

_______ is the ability to express different phenotypes under different environmental conditions. Question options: a) Modularity b) Regulatory malleability c) Developmental plasticity d) Heterochrony e) Heritability

developmental plasticity

Fluorescent Sanger dideoxy sequencing methods uses what method to discriminate between the 4 different nucleotides? Centrifugation sedimentation gradient. Fluorescently labeled dNTPs Fluoresently labeled dATP. Different fluorochromes attached to the four different ddNTPs.

different flourochromes attatched to the four different ddNTPs

Natural selection

differential reproduction of genotypes

Mutations in the promoter region of the b-globin gene indicate that some areas are more sensitive than others. When mutations occur in consensus sequences (modular elements such as GC box, CAAT box, TATA box) transcription ________________.

diminishes

LINES differ from retrotransposons in that LINES:

do not contain LTRs.

The process by which excessive numbers of a sex chromosome are corrected, often by methylating the X chromosome to form a Barr body.

dosage compensation

Which of the following parental genotypes will produce only heterozygous F1 offspring? a) AA x Aa b) Aa x Aa c) Aa x aa d) aa x aa e) AA x aa

e) AA x aa

Which of the following features distinguishes RNA from DNA? a) DNA has only purine bases b) RNA has a pentose sugar while DNA utilizes a hexose sugar c) Unlike RNA, DNA uses a phosphodiester backbone d) RNA has only pyrimidine bases e) None of the above

e) None of the above

Many of the genes that control development encode _______ that act on proteins in a cascade of events. Question options: a) ATP molecules b) energy resources c) lipids d) blueprints e) transcription factors

e) transcription factors

Rapid changes in allelic frequencies by __ take place in populations that are __. a. mutation b. evolving c. inbred d. small e. genetic drift

e, d

Which of the following statements about a mammalian messenger RNA are FALSE? a) It is synthesized in the nucleus. b) It is translated in the cytoplasm. c) It usually contains a cap at the 5' end. d) It is usually much smaller than the initial transcript (that is copied directly from the gene). e) None of the above

Which statement is true regarding heritability and continuous variation? a. Heritability measures the degree to which genes determine phenotype. b. As the number of gene loci that affect a trait increases, the proportion of extreme version of the trait also increases. c. The total variance used to calculate heritability measures all the variance in a population. d. A heritability value of 0.8% of the total variance is due to differences in the environment. e. A low heritability score means that genes are less influential than environment in determining phenotypic variation.

e. A low heritability score means that genes are less influential than environment in determining phenotypic variation.

Match each term to the appropriate letter choice: a. self-antigen b. cactus and toll c. anterior-posterior axis d. clonal selection e. genetic maternal effects f. antibody production g. programmed cell death h. homeotic gene i. segmentation gene j. Ernst Haeckel Reference: Ref 22-1 egg-polarity genes

e. Genetic maternal effects

QTL mapping requires all of the following except a. genetic markers. b. offspring. c. a genetic map. d. a controlled cross. e. an estimate of homozygosity in the population.

e. an estimate of homozygosity in the population.

Heterochromatin is characterized by all of the following, EXCEPT that it a) is present on most of the Y chromosome. b) is present all over the inactive X chromosomes in mammals. c) is present at centromeres and telomeres. d) remains highly condensed throughout the cell cycle. e) contains genes that require high levels of transcription.

e. contains genes that require high levels of transcription.

To establish that evolution by natural selection is operating in a population, one must demonstrate variability for a trait, heritability of that trait, differential reproductive success based on that trait, and: a. continuous change in the environment. b. progress. c. random mating. d. increased complexity of the organism. e. nothing else.

e. nothing else.

In a normal distribution, 99% of the measurements fall within a. 1% of the mean. b. 5% of the mean. c. plus or minus one standard deviation of the mean. d. plus or minus two standard deviations of the mean. e. plus or minus three standard deviations of the mean.

e. plus or minus three standard deviations of the mean.

Match with the closest type of DNA: gene-encoding sequence a. moderately repetitive DNA b. highly repetitive DNA c. short interspersed elements d. long interspersed elements e. unique-sequence DNA

e. unique-sequence DNA

e.) None of the above

Flies have _______ eyes, while mammals have _______ eyes. Question options: a) simple; compound b) cameralike; compound c) compound; heterochronic d) cameralike; binocular e) compound; cameralike

e.) compund, camerlike

Considering the location of genes in the interphase nucleus, certain chromosomal territories appear to exist. Specifically, ________.

each chromosome appears to occupy a discrete domain

The correct sequence in which Drosophila body axis genes act is: Question options: egg-polarity genes--->segment polarity--->gap genes--->pair-rule genes---->homeotic gens egg-polarity genes--->gap genes --->pair-rule genes---->segment polarity genes--->homeotic genes. homeotic genes--->segment polarity genes--->pair-rule genes--->gap genes--->egg-polarity genes gap genes--->segment polarity genes--->egg-polarity genes---->homeotic genes---> pair-rule genes egg-polarity genes--->homeotic genes---->segment polarity genes---->gap genes---->pair-rule genes

egg polarity genes-->Gap genes-->pair-rule-->segment polarity-->homeotic genes

A eukaryotic DNA sequence that affects transcription at distant promoters is called a(n) ________________.

enhancer

______________ can cause the same genotype to produce a range of potential phenotypes. Question options: Epistasis The inbreeding coefficient Hybrid vigor Environmental effects Heritability

environmental effects

Parts of chromosomes that are not methylated for inactivation, but rather are less dense-staining and are likely active in transcription in the cell.

euchromatin

Regulation of gene expression using siRNAs is found in

eukaryotes only.

Any change in a population from Hardy-Weinberg equilibrium can be defined as ______. Question options: mutation genetic equilibrium migration evolution natural selection

evolution

_________ is the change in allele frequency in a population over time

evolution

Alterations in the spatial expression patterns of regulatory genes can result in Question options: a) succession. b) mutant genotypes. c) mutant alleles. d) evolutionary change. e) None of the above

evolutionary change

a. chromosome spread b. protein c. plasmid d. centromere e. multiple hosts f. Taq polymerase g. DNA quantification h. protein/DNA interaction i. lacZ j. foreign DNA k. mRNA l. Agrobacterium tumefaciens Reference: Ref 19-1 PCR

f. Taq polymerase

Match with the best letter choice: rolling circle replication a. supercoil removal b. RNA primer synthesis c. 3' → 5' exonuclease activity d. lagging strand e single-strand breaks f. unidirectional replication g. strand invasion h. leading strand i. phosphodiester bonds at DNA nicks j. translesion DNA synthesis k. bidirectional circular replication

f. unidirectional replication

When the mammalian Pax6 gene is overexpressed in flies, Question options: a) flylike eyes develop. b) nothing happens. c) antennae grow. d) mammal-like eyes develop. e) another wing develops.

flylike eyes develop

A class of mutations which results in multiple contiguous amino acid changes in proteins is likely to be the following

frameshift

Since the binding of the _________ to the _________ prevents it from binding to _________ by causing a conformational change in its structure, it is called an _________ protein.

galactose, GAL3, GAL4, transcriptional activator

Egg-polarity genes regulate __ genes, which in turn modulate the activity of __ genes. a. homeotic b. gap c. Hox d. pair-rule e. segment-polarity

gap, pair-rule

unique-sequence DNA

gene-encoding sequence

What is the role of maternal-effect genes?

genes derived from the maternal genome are actively transcribed to support the zygote and are required for the proper patterning of the embryo. Mutant phenotypes of maternal effect reflect the phenotype of the mother.

Components of DNA, called _______ control how the molecular toolkit is used. Question 5 options: a) genes b) trans-acting elements c) cis-acting elements d) genetic switches e) transcription factors

genetic switches

Continuous synthesis a.supercoil removal b.RNA primer synthesis c.3' → 5' exonuclease activity d.lagging strand e. single-strand breaks f.unidirectional replication g.strand invasion h.leading strand i.phosphodiester bonds at DNA nicks j.translesion DNA synthesis k.bidirectional circular replication

h. leading strand

Genes that regulate development are conserved. This means that they Question options: a) are always turned on. b) have changed very little over the course of evolution. c) None of the above d) have evolved large differences among multicellular organisms.

have changed very little over the course of eveolution

List three major structural classifications of DNA-binding domains that are found in eukaryotic transcription factors.

helix-turn-helix (HTH), zinc finger, and leucine zipper

Genetic switches are involved in Question options: a) None of the above b) stopping development. c) ensuring that all modules develop into the same type. d) helping various modules develop differently.

helping various modules develop differentely

Total phenotypic variance can be decomposed into all but one of these components: Question options: genetic-environment interaction variance. genetic variance. environmental variance. heritability.

heritability

highly methylated

heterochromatin

_______ is a shift in the relative timing of two different developmental processes that can result in new morphology. Question options: a) Modularity b) Heterochrony c) Developmental plasticity d) Regulatory malleability e) Heritability

heterochromy

telomeres

highly repetitive DNA

The ____________________ consists of modifications to histone proteins that affect the expression of DNA sequences.

histone code

homeotic gene

The role of tautomerism in causing mutations relates to the fact that the process ultimately affects the:

hydrogen bonding properties of nitrogenous bases

What chemical group is found at the 3' end of a DNA molecule?

hydroxyl group

Because of the imprecision of molecular joining, recombination between LV and J regions shows considerable variation. Which additional circumstance contributes to this variation?

hypermutation

i. phosphodiester bonds at DNA nicks

i. segmentation rule

The probability that two alleles are identical by descent is the

inbreeding coefficient

When siRNAs are present, the rate of mRNA degradation_____________ and the rate of protein production ___________.

increases, decreases

When siRNAs or miRNAs are present, the rate of mRNA degradation_____________ , and the rate of protein production ___________.

increases, decreases

What is the function of allolactose in regulation of the lac operon?

inducer

Since the binding of the _________ to the _________ prevents it from binding to DNA by causing a conformational change in its structure, it is called an _________ protein.

inducer, repressor protein, allosteric

What term would be applied to a regulatory condition that occurs when protein greatly reduces transcription when associated with a particular section of DNA?

inhibition

Frameshift mutations are caused by the __________ or __________ of one or more nucleotides in DNA.

insertion or removal

A Mendelian population is defined by individuals Question options: interbreeding. inbreeding. evolving. living in close proximity. migrating.

interbreeding

Channels between chromosomes in the interphase nucleus are called ________.

interchromosomal compartments

The two major components of the immune system are humoral and cellular immunity. The humoral component ________.

is involved in the production of antibodies

j. Ernst Haeckel

Theta replication: a.supercoil removal b.RNA primer synthesis c.3' → 5' exonuclease activity d.lagging strand esingle-strand breaks f.unidirectional replication g.strand invasion h.leading strand i.phosphodiester bonds at DNA nicks j.translesion DNA synthesis k.bidirectional circular replication

A mutant E. coli strain, grown under conditions that normally induce the lac operon, produces high amounts of ß-galactosidase. What is a possible genotype of the cells?

lacI+ lacP+ lacOc lacZ+ lacY+ lacA+

A mutant E. coli strain, grown under conditions that normally induce the lac operon, produces high amounts of ß-galactosidase. What is a possible genotype of the cells? Question options: lacI+ lacP+ lacO+ lacZ- lacY+ lacA+ lacI+ lacP+ lacOc lacZ+ lacY+ lacA+ lacI- lacP+ lacO+ lacZ- lacY+ lacA+ lacI+ lacP- lacO+ lacZ+ lacY+ lacA+

lacI+ lacP+ lacOc lacZ+ lacY+ lacA+

A mutant E. coli strain, grown under conditions that normally induce the lac operon, does not produce ß-galactosidase. What is a possible genotype of the cells?

lacI+ lacP- lacO+ lacZ+ lacY+ lacA+

A mutant E. coli strain, grown under conditions that normally induce the lac operon, produces high amounts of ß-galactosidase. What is a possible genotype of the cells? lacI+ lacP- lacO+ lacZ+ lacY+ lacA+ lacI+ lacP+ lacO+ lacZ- lacY+ lacA+ lacI- lacP+ lacO+ lacZ- lacY+ lacA+ lacI+ lacP+ lacOc lacZ+ lacY+ lacA+

lacI+, lacP+, lacOc, lacZ+, lacY+, lacA+

Constitutive mutations may occur in various components of the lac operon. Name two genes of the lac operon in which constitutive mutations could occur.

lacI-, lacOc

What symbols are used to describe constitutive mutations in the lac operon?

lacOc

The lac repressor binds to:

lactose and DNA.

Compared with prokaryotic chromosomes, eukaryotic chromosomes are small, mainly organized in polycistronic transcription units without introns. large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns. large, mainly organized in polycistronic transcription units without introns. small, mainly organized in monocistronic transcription units with introns. large, mainly organized in monocistronic transcription units without introns.

large, linear, less densely packed with protein-coding genes, mainly organized in monocistronic units with introns

Within the control region of the tryptophan operon is a section of DNA that is sensitive to levels of tryptophan in the system. What is the name of this region?

leader or attenuator region

All of the following are general purpose translation components and could be used in the translation of any gene, except for one. Which one? tRNA mRNA Methionine Initiation factors

mRNA

The relationship between a gene and a messenger RNA is that all genes are made from mRNAs. messenger RNA is directly responsible for making Okazaki fragments. mRNAs are made from genes. mRNAs make proteins, which then code for genes. genes are made from mRNAs.

mRNAs are made from genes

List four terms used to describe the normal morphologies, with respect to arm ratio, of eukaryotic chromosomes.

metacentric submetacentric arocentric telocentric

Normal diploid somatic (body) cells of the mosquito, Culex pipiens, contain six chromosomes. The "m" superscript indicates that the homolog is maternally derived, while the "p" indicates a paternally derived homolog. Assume that in the genus Culex, the sex chromosomes are morphologically identical. In the drawing above, what stage is represented? Anaphase of Meiosis I Metaphase of Meiosis II Mitotic Metaphase Metaphase of Meiosis I

metaphase of meiosis I

How are miRNAs produced? How do miRNAs function to affect production of proteins? Provide sufficient detail in your answer for full credit.

miRNAs are produced from double stranded RNA in the cell that can be caused by virus infection. The Dicer enzyme cleaves the double stranded RNA into short miRNAs and siRNAs. The miRNA will then associate with either RISC or RITS complex. The RISC complex, with use one strand of the miRNA as an antisense RNA to match complementary strands in the cytoplasm, will degrade mRNA thus supressing translation. The RITS complex with use one strand of the miRNA to match complementary pairs in the nucleus that will undergo chromatin remodelling to suppress transcription.

nullisomy

missing pair of homologs

_______ allows morphological changes to occur without disrupting the entire organism. Question options: a) Heritability b) Heterochrony c) Modularity d) Regulatory malleability e) Developmental plasticity

modularity

A self-contained unit that is made up of other units is called a Question options: a) mutational unit. b) module. c) subunit. d) regulatory unit. e) master unit.

module

A gene or a trait is said to be polymorphic if

more that one form exists in the population

male mammals inherit an X chromosome from which of their parents?

mother

29. A situation where there are more than two alternative forms of a given gene would be called ________. codominance hemizygosity alternation of generations multiple alleles incomplete dominance

multiple alleles

An operon is controlled by a repressor. When the repressor binds to a small molecule, it is released from binding to DNA near the operon. The operon is never expressed if a mutation prevents the repressor from binding to the small molecule.

negative inducible

E. coli lac operon control by lac I

negative inducible

An operon is controlled by a repressor. When the repressor binds to a small molecule, it binds to DNA near the operon. The operon is constitutively expressed if a mutation prevents the repressor from binding to the small molecule.

negative repressible

What are the differences between neutral mutations and silent mutations?

neutral mutation: Changes the amino acid sequence of a protein but does not alter the function of the protein silent mutation: Alters a codon, but the codon still specifies the same amino acid.

Which of the below is not true about the location of enhancers?

no effect gene

An mRNA has the stop codon 5'UAA3'. What tRNA anticodon will bind to it? 5'ATT3' 5'AUC3" 5" ACU3' none

none

Which of the following evolutionary forces does NOT change allele frequencies? Question options: nonrandom mating mutation selection drift migration

nonrandom mating

A _________ mutation changes a codon that specifies an amino acid into one that terminates translation.

nonsense

A constitutive gene is _______ regulated and is expressed ____________.

not, continually

To establish that evolution by natural selection is operating in a population, one must demonstrate variability for a trait, heritability of that trait, differential reproductive success based on that trait, and: Question options: continuous change in the environment. progress. random mating. increased complexity of the organism. nothing else.

nothing else

Genes can be located in which organelles

nucleus, chloroplast, mitochondria

Indicate the level of activity of the lac operon under the medium conditions listed below: a) No lactose present, no glucose present b) Lactose present, no glucose present c) No lactose present, glucose present d) Lactose present, glucose present

off, high, off, off.

Evolution occurs:

only via natural selection, genetic drift, migration, or mutation

What term refers to a contiguous genetic complex that is under coordinate control?

operon

In prokaryotes, replication usually begins at a specific place on the chromosome called

origin of replication

In a population in Hardy-Weinberg equilibrium, what will be the proportion of matings between homozygotes? Question options: p2 + 2pq P4 p4 + q4 p4 + q4 + 2p2q2 4p2q2

p4 + q4 + 2p2q2

Which of the following is NOT an example of nonrandom mating? Question options: positive assortative mating inbreeding outbreeding panmixis negative assortative mating

panmixis

Conserved developmental genes can lead to _______ evolution. Question options: a) linear b) divergent c) convergent d) None of the above e) parallel

parallel

What chemical group is found at the 5' end of a DNA molecule? carboxyl group nitrogenous base hydroxyl group phosphate group sulfate group dideoxy group

phosphate group

The bonds that connect nucleotides in a strand are called _________bonds.

phosphodiester

pleiotropy

In a normal distribution, 99% of the measurements fall within Question options: 1% of the mean. 5% of the mean. plus or minus one standard deviation of the mean. plus or minus two standard deviations of the mean. plus or minus three standard deviations of the mean.

plus or minus three standard deviations of the mean

List three general pathways in which eukaryotic mRNA is typically degraded in eukaryotes.

poly-A binding protein, decapping, nonsense-mediated decay

Degredation of a eukaryotic mRNA is generally preceded by shortening of the _______.

poly-A tail

What enzyme is exploited to produce synthetic mRNAs? polynucleotide kinase polynucleotide phosphorylase ligase RNA polymerase II

polynucleotide phosphorylase

A catabolite-activating protein (CAP) exerts _____________control over the lac operon.

positive

When transcription factors interact with DNA, is the resulting genetic control typically positive or negative?

positive control

Which of the following terms best characterizes catabolite repression associated with the lactose operon in E. coli?

positive control

Choose the type of control illustrated by GAL4 in the control of genes for yeast galactose-metabolizing enzymes

positive inducible

Explain two different ways that intragenic suppressors may reverse the effects of mutations.

producing a codon that specifies the same amino acid as that specified by the original codon OR suppressing a frameshift mutation.

RNA polymerase must bind to a region of DNA called a(n) ____________ in order to begin transcription.

promoter

This is the region of a gene where RNA polymerase binds to initiate transcription.

promoter

What is the general position of the consensus sequence called the GC box? What is its sequence?

promoter; GGGCGG

The process of error correction of mismatched bases carried out by DNA polymerases is called

proof reading

The ribosome is the primary site of: oxidative phosphorylation. protein packaging. protein synthesis. cellular respiration. amino acid storage.

protein synthesis

What is the common influence of ultraviolet light on DNA?

pyrimidine dimer

regression coefficient

The general term for a protein that binds to an operator.

repressor

An example of a gene product encoded by a regulatory gene is

repressor protein.

The __________ is a type of _________ protein that binds to a region of DNA in the promoter of a gene called the _________ and prevents transcription from taking place in bacteria.

repressor, regulator, operator

The __________ is a type of _________ protein that binds to a region of DNA in the promoter of a gene called the _________ and prevents ______________ from taking place.

repressor, regulator, operator, transcription

mRNAs are degraded by enzymes called ____________.

ribonucleases

Two forms of snRNA

siRNA, miRMA

inactive through methylation

silent chromatin

Regions of chromosomes that are inactivated through methylation are termed this.

silent chromatins

Which of the following are general categories of mutations?

silent, conditional, lethal

Under certain conditions, the rate of mutation of a particular gene may be determined in humans. What properties of the mutation would favor the most direct determination of mutation rate in humans? Select all that apply: fully expressed 100% penetrant recessive dominant single locus

single locus dominant

Restriction endonucleases are especially useful if they generate "sticky" ends. What makes an end sticky? 5' cap blunt ends poly-A sequences single-stranded complementary tailes interference

single-stranded complementary tails

Insects have _______ legs. Question options: a) more than ten b) six c) eight d) ten e) four

six

repressor negative

slightly overlap

To use RNAi (RNA interference) as a research tool, investigators introduce short synthetic __________ RNA into cells.

small interfering (si)

Compared with eukaryotic chromosomes, bacterial chromosomes are small, with high gene density. large, mainly organized in monocistronic transcription units without introns. small, mainly organized in monocistronic transcription units with introns. large, triple-helix, Z-DNA, organized in monocistronic units with introns. large, mainly organized in polycistronic transcription units without introns.

small, with high gene density

In the lactose operon, the product of structural gene lacZ is capable of

splitting the β-linkage of lactose.

Mutations which arise in nature, from no particular artificial agent are called

spontaneous mutation

Mutations that arise in nature, from no particular artificial agent, are called

spontaneous mutations

In general, a "model organism" used in genetics studies is one in which there is a large body of genetic knowledge that has been compiled over decades of genetic research. In addition, model organisms have available their DNA sequences and collections of ________ that make detailed genetic analysis possible and efficient. Question options: epigenetic developmental system museum specimen complete metamorphic system strains with specific mutations incomplete metamorphic system

strains with specific mutations

In general, a "model organism" used in genetics studies is one in which there is a large body of genetic knowledge that has been compiled over decades of genetic research. In addition, model organisms have available their DNA sequences and collections of ________ that make detailed genetic analysis possible and efficient. Question options: epigenetic developmental systems incomplete metamorphic systems museum specimens complete metamorphic systems strains with specific mutations

strains with specific mutations

Mutations in homeotic genes often cause Question options: the absence of structures too many segments structures to appear in the wrong place the deletion of segments

structures to appear in the wrong place

Codon that specify the same amino acid are said to be _________________.

synonymous

After the peptide bond forms, what will happen? a. tRNA A will be carrying the polypeptide and it will shift to the P site. b. tRNA A will be carrying the polypeptide and it will shift to the A site. c. tRNA B will be carrying the polypeptide and it will shift to the P site. d. tRNA B will be carrying the polypeptide and it will shift to the A site.

tRNA B will be carrying the polypeptide and it will shift to the P site.

A chromosome with a centromere at the very end is called

telocentric

RNA polymerase II binds to the ____________ strand of DNA and uses it to guide transcription. In contrast, the strand not used to guide transcription is called the _____________ .

template strand, coding strand.

The packaging of DNA into a confined space is what level of DNA structure? a) tertiary b) secondary c) primary d) quaternary

tertiary

siRNAs and miRNAs are produced by

the cutting and processing of double-stranded RNA by Dicer enzymes.

Why do extra copies of genes sometimes cause drastic phenotypic effects?

the expression of some genes is balanced with the expression of other genes; the ratios of their gene products, usually proteins, must be maintained within a narrow range for proper cell function. Extra copies of one of these genes cause that gene to be expressed at proportionately higher levels, thereby upsetting the balance of gene products.

What is the general scheme for generating a transgenic mouse strain?

the gene of interest is injected into fertilized oocytes to be subsequently transferred into pseudo-pregnant recipient mothers. Pups are then screened for integration of the transgene.

Alternative splicing is known to be important in the regulation of

the mammalian SV40 virus.

It is possible for a repressor to negatively regulate the expression of an operon because

the repressor binding site overlaps the promoter site of the operon allowing it to physically block the binding of RNA polymerase.

Where would the lac repressor be bound in a (nonmutant) E. coli cell that is growing in low glucose and high lactose?

the repressor would not be bound

Insulators can block the effects of enhancers only when

they lie between an enhancer and a promoter

Nutritional mutations can be defined as

those mutations that do not allow an organism to grow on minimal medium, but do allow the organism to grow on complete medium.

If a restriction enzyme cuts a circular DNA into three fragments, how many restriction sites are there in the DNA? two three four five six

three

The transcription factors that govern pattern formation in multicellular organisms, and the genes that encode them, are components of what biologists call the molecular _______.

toolboxes

These are factors that need not be adjacent to the genes they control. An example would be the lac operon's repressor protein.

trans-acting

miRNA

transcribed from DNA, produces hairpin RNA strand, Diced, Binds to RISC, binds to complementary target mRNA and inhibits transcription

In eukaryotes, tRNAs are transcribed in the nucleus, and function in the nucleus. transcribed in the nucleus, but function in the cytoplasm. transcribed in the cytoplasm, and function in the cytoplasm. transcribed in both the nucleus and the cytoplasm, and function in the cytoplasm.

transcribed in the nucleus, but function in the cytoplasm.

The 5' cap on an mRNA is important for all the processes listed below except: a. intron removal b.stability c. initiation of translation d. transcription

transcription

The _________________, which binds to a core promoter, consists of general transcription factors and RNA polymerase.

transcription initiation complex

What is the function of eukaryotic RNA polymerase I? transcription of rRNA genes transcription of mRNA genes transcription of tRNA genes transcription of snRNAs initiation of transcription (but not elongation)

transcription of rRNA genes. (RNA pol I: transcribes rRNA. RNA pol II: transcribes DNA to mRNA and most snRNA and microRNA. Most well studied, requires wide range of transcription factors. RNA pol III: transcribes DNA to synthesize rRNA, tRNA and other small RNAs.)

Genetic regulation in eukaryotes can take place at a variety of levels from transcriptional to post-translational. At what level is genetic regulation considered most likely in prokaryotes?

transcriptional

Genetic regulation in eukaryotes can take place at a variety of levels from transcriptional to post-translational. At what level is genetic regulation considered most likely in prokaryotes? Question options: polyadenylation of the 3' end of the mRNAs intron processing capping exon processing transcriptional

transcriptional

____________________act as intermediaries between ______________________________ and specific _____ sequences to modify chromatin structure and activate transcription.

transcriptional activator protein, base

Regarding eukaryotic and prokaryotic genetic regulation, what process seems to be the most similar between the two?

transcriptional regulation

Which process seems to be the most similar between eukaryotic and prokaryotic genetic regulation?

transcriptional regulation

When referring to attenuation in regulation of the tryptophan operon it would be safe to say that when there are high levels of tryptophan available to the organism

transcriptional termination is likely.

List at least three levels or types of genetic regulation in eukaryotes.

transcriptional, DNA methylation, posttranscriptional regulation, posttranslational regulation

One type of mutation involves the replacement of a purine with a purine. What general term is associated with this mutational phenomena?

transition

List four levels at which gene control can take place in eukaryotes.

translational, initation of transcription, RNA stability, post transcriptional

What evidence indicates that steroid hormones exert their influence at the level of DNA?

translocation of the hormone-receptor complex from the cytoplasm to the nucleus, increase in the rate of transcription

One type of mutationinvolves the replacement of a pyrimidine with a purine. What general term is associated with this mutational phenomena?

transversion

One type of mutationinvolves the replacement of a pyrimidine with a purine. What general term is associated with this mutationalphenomena?

transversion

Two formal terms used to describe categories of mutational nucleotide substitutions in DNA are called

transversions and transitions

Measures of heritability are specific to a defined population in a given environment. True False

true

Natural selection is defined as the differential reproduction of genotypes. True False

true

The following may be caused by mobile genetic elements except ________________

undergo mutation

A(n) _______________ can function at variable distances and in either orientation. However, it differs from an enhancer in that it cannot function downstream of the transcription starting point.

upstream activator sequence, UAS

A measure of the dispersion of a continuous distribution.

varience

Under the system of genetic control of the tryptophan operon,

when there is no tryptophan in the medium, transcription of the trp operon occurs at high levels.

The human condition _____________ is caused by unrepaired UV-induced lesions.

xeroderma pigmentosum

Ultraviolet light causes pyrimidine dimers to form in DNA. Some individuals are genetically incapable of repairing some dimers at "normal" rates. Such individuals are likely to suffer from

xeroderma pigmentosum

Extensive pedigree analysis on a characteristic shows all of the following: only males are affected; affected fathers always pass the trait to sons; What does this pedigree indicate:

y-linked

सभी स्टडी सेट्स देखें

Molgen 4500 Final

संबंधित स्टडी सेट्स

Intermediate Accounting II - Chapter 18

chapter 11 Business 10

psych ch 13

Business Management 1 Final Exam Study Guide

Chapter 28 - Pulling it All Together : Integrated Head-to-Toe Assessment (Final)

Quiz 5 - Neuro 128

Psychology 1101: Chapter 7 Quiz

ATI Ch 32 Medications Affecting Labor and Delivery

Chapter 8 (Part 1) TCP/IP Internetworking I

Animal Farm

Community Health Exam 1

SF CDP

Chapter 21, PHY: Chap 22, Chap 23

Vocabulary 2b

ch 7 sec 4

Chapter 7

Finance 410 Chapter 17

Chapter 8 Test US History

QMB5616 Final

CH 6: Community Assessment