Study Guide 14

A function or characteristic of mRNA structure/sequence common to prokaryotes and eukaryotes.

Coding sequences flanked by 5' and 3' UTR sequences

(Passage II) What is the most likely quaternary structure of the transcription factor?

Homodimer

The cap structure is:

Formed by a 5' to 5' linkage to a G to the 5' end of mRNA

What are the conserved bases at the 5' and 3' ends of nuclear introns?

GU . . . AG

For the experiment below (Q 34), cDNA from kidney was labeled green, and cDNA from lung was labeled red. The probes from the two samples were mixed together and hybridized to a microarray, giving the results below. The numbers represent fluorescent intensity for genes AF. Assume that the red and green fluorescent labels give equivalent signal.

Gene B

Which of these processes are least likely to expand the coding capacity of the genome by creating mRNAs that are not directly encoded by the DNA?

RNA capping

_______________ permits a cell to recode genetic information in a systematic and regulated fashion.

RNA editing

Splicing of pre-mRNA is characterized by the formation of a

lariat structure

Eukaryotic messenger RNA molecules have _______________ at their 5' ends.

m7 G caps

The ______________ pathway blocks mRNA translation or causes mRNA degradation.

miRNA

Amino acid-coding regions within eukaryotic genes may be interrupted by ___________ regions

noncoding

The correct splicing of nuclear mRNA introns requires:

A protein complex and specific nucleotide sequences at the ends of the intron

GO OVER

1-4, 26-29

In spliceosome-mediated pre-mRNA splicing:

2' hydroxyl of the branch point adenosine

The nucleophile of the first step of spliceosome-mediated pre-mRNA splicing is the:

2' hydroxyl of the branch point adenosine

The chemical structure of the 5' mRNA cap includes _______________ covalently linked to the 5' terminal residue of the mRNA through a ________________ linkage.

7-methylguanosine; 5' to 5' triphosphate

Which of the following is NOT true of the reactions that methylate the 5' end of the primary mRNA transcripts? A. The reaction occurs after the entire transcript is synthesized. B. The methyl groups are derived from S-adenosylmethionine. C. The enzymes that catalyze the reactions are guanylyltransferases. D. The enzymes that catalyze the reactions are associated with the C-terminal domain of RNA polymerase II.

A. The reaction occurs after the entire transcript is synthesized

Which of the following is true regarding conserved sequences in pre-mRNA splice sites

AG at the 3' end of the intron

The enzyme adenosine deaminase acting on RNA (ADAR) catalyzes which of the following nucleotide conversions?

Adenosine to inosine

Certain amino acid changes in the C-terminal domain (CTD) of RNA polymerase II dramatically reduce the success of transcriptional intitiation. Changing the amino acids at which CTD sites would have this effect?

Amino acids that are targets for phosphorylation

Which of the following proteins is NOT associated with the C-terminal domain of RNA Polymerase II?

Aminoacyl-tRNA synthetase

Which of the following evidence supports the RNA world hypothesis? A. Experimentally, it is possible to select catalytically active RNA from randomized sequences. B. An RNA component of ribosomes catalyzes the synthesis of proteins. C. Components of RNA form spontaneously in "prebiotic soup" experiments. D. All of the above. E. None of the above.

An RNA component of ribosomes catalyzes the synthesis of proteins

One form of severe thalassemia is known to be the result of a mutation that causes abnormal RNA splicing because of a five nucleotide deletion that disrupts the first splice donor signal of the beta globin pre-mRNA. All thalassemias result in a reduced rate of synthesis of one of the globin chains (either alpha or beta globin) that make up hemoglobin. Which of the following techniques would best show the presence of the abnormal splicing in a suspected carrier of the disease?

Analysis to detect altered size of beta globin mRNA

(Passage I) What region of the DNA contains the TATA box?

B

Which of the following sequences contains is a direct repeat of three or more nucleotides? A. GAATTCATGA B. GTTACATGTTAA C. CAGGGGTCAAT D. GGGGTATACCCC E. ATCTGGGAGAT

B. GTTACATGTTAA

You want to clone an insert containing a gene-of-interest into a plasmid vector. Which of the following is TRUE? A. Both the insert and plasmid must be cut with the same restriction enzyme. B. Complementary sticky ends from different DNA molecules cannot base pair. C. After ligation, the next step is transposition into a bacterial host. D. A replication origin is required in both the plasmid and the insert. E. More than one of the above statements (A-D) is true.

Both the insert and plasmid must be cut by the same restriction enzyme

(Passage I) Where is the 5' cap added to the transcript?

C

A mRNA that is polycistronic

Codes for multiple different proteins

(Passage I) Which of the lettered regions of the primary transcript is removed by a spliceosome?

D

Which of the following is NOT usually involved in the processing of primary mRNA transcripts? A. Addition of multiple adenosines to the 3' end B. Covalent joining of exons C. Methylation of nucleotides at the 5' end D. Insertion of intron sequences

D. Insertion of intron sequences

In the RNAi response

DICER produces siRNAs from dsRNA. These become part of a RISC complex. The RISC complex contains SLICER and a siRNA. It is this complex that cuts up the mRNA

Which of the following is NOT an enzymatic function of the editosome? A. Uridylyltransferase B. Ligase C. Deaminase D. Ribonuclease

Deaminase

Which of the following eukaryotic RNA processing events does NOT occur in the nucleus?

Degradation of mRNA

Formation of double-stranded RNA regions is important for many examples of regulation by RNA. Which of the following is a mechanism by which double-stranded RNA can affect regulation?

Double-stranded RNA may create a site for degradation by specific ribonucleases

(Passage I) Where is the poly (A) tail added to the transcript?

E

Which of the following nuclear pre-mRNA nucleotide sequences potentially contains an intron? A. UGACCAUGGCGCUAACACUGCCAAUUGGCCAAUACUGACCUGAUAGCAUCAGCCAA B. UAGUCUCAUCUGUCCAUUGACUUCGAAACUGAAUCGUAACUCCUACGUCUAUGGA C. UAGCUGUUUGUCAUGACUGACUGGUCACUAUCGUACUAACCUGUCAUGCAAUGUC D. UAGCAGUUCUGUCGCCUCGUGGUGCUGGCUGGCCCUUCGUCGCUCGGGCUUAGCUA E. UAGGUUCGCAUUGACGUACUUCUGAGACUACUAACUACUAACGCAUCGAGUCUCAA

E

The human á-tropomyosin gene contains 13 exons and is alternatively spliced. Exons 2 and 3 are alternative exons used in different cell types. (Some cell types use exon 2 but not 3, some use exon 3 but not 2. The rest of the protein is translated in the same frame regardless of which exon is used.) Which of the following statements about exons 2 and 3 is the most accurate?

Exons 2 and 3 must contain a number of nucleotides that when divided by 3 leaves the same remainder

True or False. Eukaryotes use a variety of pathways to form 5'-m7 G caps.

False

Promoters are cis-acting. The promoter is considered a cis-acting site because:

It exclusively influences the expression of a gene to which the promoter is proximal

Two splicing intermediates resemble ______________.

Lariats

Which of the following is an experiment whose data is most likely to tell you whether a new protein, called BYU, that appears when cells are infected by a virus is encoded by host the host cell genome or the virus genome

Make a DNA probe based on the BYU protein sequence and use the probe in a southern blot of virus DNA in one lane and host cell genomic DNA in another lane (38)

(Passage II) Where is the DNA-binding domain located in the transcription factor?

Near the amino terminal end of the protein

What would be the most likely effect of a mutation in the eukaryotic gene for poly(A) polymerase?

Nonfunctional poly (A) polymerase is likely to destabilize all mRNAs by decreasing the polyA tail information

The carboxy terminal domain of the largest subunit of RNA polymerase II must be _______________ on Ser-5 to target a transcript for capping.

Phosphorylated

Which of the following events are NOT true of the polyadenylation of mRNA? A. Pol II extends the transcript beyond the site where the poly(A) tail is added. B. The site of poly(A) addition is marked by specific sequence elements in the transcript. C. The transcript is cleaved by an endonuclease that associates with the C-terminal domain of Pol II. D. Polyadenylate polymerase uses a poly(U) RNA template to synthesize the poly(A) tail.

Polyadenylate polymerase uses a poly(U) RNA template to synthesize the poly(A) tail

What is the key component of the catalytic site of the spliceosome?

RNA

Consider a individual with a mutation in the PKU gene caused by a point mutation at the 5' splice site of intron 3 that prevents the intron from being spliced out. The polypeptide made from the mutant gene is probably:

Shorter than it should be, but preventing it from functioning properly

Pre-mRNA requires specific sequences for precise __________ to occur.

Splicing

Which of the following types of the information CANNOT be determined using a Northern blot?

The amino acid sequence of the protein coded by an mRNA

Which of the following characteristics of Group I intron splicing is NOT true of Group II intron splicing?

The first nucleophile is a 3' hydroxyl

Which of the following is NOT a similarity between nuclear introns (involving spliceosomes) and Group II introns? A. Both share the presence of short conserved sequences at each end of the intron B. The excised intron forms a lariat structure in both cases. C. The intron lengths are conserved to sizes of 10-100 nucleotides in length D. Both have a branch sequence near the 3' end of the intron.

The inrton lengths are conserved to sizes of 10-100 nucleotides in length

A chromatography column in which oligo-T is linked to an inert substance is useful in separating eukaryotic mRNA from other RNA molecules. Which of the following is an accurate description of the principle by which this separation occurs?

The oligo-T binds to the polyA tail on mRNA

(Q 39) You have a cloned copy of the wild-type (functional) GCA coding sequence. As a first task, select a promoter that, when joined to the GCA gene, is most likely to ensure proper expression of the GCA gene in liver cells:

The promoter from the gene that encodes the CK-19 protein, which is normally transcribed only in the liver

What mechanism is used to generate the 3' ends of transcripts made by RNA polymerase II?

The transcript is cleaved at a specific polyadenylation site, and then the poly(A) tail is added

True or False. Exons tend to be conserved during evolution, whereas introns usually are not as tightly conserved.

True

True or False. Splicing begins as a cotranscriptional process and continues as a posttranscriptional process.

True

Which snRNA binds to the intron branch point, causing an adenine to bulge out?

U2

Which of the following events do NOT occur during spliceosome assembly on pre-mRNAs?

U6 snRNP binds to the 3' splice site

A ribonucleoprotein is:

a non-coding RNA complexed with protein

An RNA processing event that frequently leads to different protein products encoded by a single gene is:

alternative splicing

A ribozyme is:

an RNA molecule with enzymatic activity

Pre-mRNA splice sites are recognized by the spliceosome through:

base pairing with snRNAs

Your goal is to identify the protein-coding genes that significantly change in expression within the first 10 minutes of yeast exposure to a particular antifungal drug. You believe that only a small group of genes will fall into this category. With this goal in mind, which one of the following techniques would be appropriate?

cDNA microarray

Poly(A) site choice:

can generate multiple protein products from a single gene

An electrophoretic mobility shift assay is used to

determine if a protein binds to a DNA sequence

The trigger for RNA interference (RNAi) is

double stranded RNA

RNA editing by nucleotide insertion and deletion is catalyzed by the:

editosome

Which of the following is NOT true of small guide RNAs (gRNA) of the editosome complex? A. gRNAs are complementary to a target sequence in the pre-edited RNA. B. gRNAs of trypanosomes are encoded by mitochondrial DNA. C. Sequence differences between gRNA and pre-mRNA are copied to the mRNA. D. gRNAs typically contain a 5'- oligo(U) extension not complementary to the target sequence.

gRNAs typically contain a 5' - oligo(U) extension not complementary to the target sequence

Which of the following is NOT a typical example of mRNA editing?

insertion of one or more A residues

The splicing reactions require the breaking and re-making of

phosphodiester bonds

Transcription termination takes place downstream from the _______________

poly (A) site

Eukaryotic messenger RNA and hnRNA both have ___________ at their 3'-ends.

poly (A) tails

Eukaryotic messenger RNA has ___________ at their 3'-ends.

poly (A) tails

Transcription termination takes place closest to which one of the following?

poly(A) site

RNA interference (RNAi) is regulatory mechanism at the

post-transcriptional level

A single _____________ can be processed to produce two or more different mRNA molecules

pre-mRNA

A single _____________ can be processed to produce two or more different mRNA molecules.

pre-mRNA

Which of the following is NOT true of introns? A. RNA polymerase transcribes the intron DNA. B. More DNA of the human genome is devoted to introns than to exons. C. Introns are not found in bacteria. D. The sequence of mature mRNA can anneal to corresponding chromosomal DNA with intron sequences looped out.

s. Introns are not found in bacteria

_________________ molecules can silence gene expression.

short RNA

__________________ assemble to form a spliceosome, the splicing machine that excises introns.

snRNPs

A branched ("lariat") structure is formed during:

splicing of group II introns

If you used radioactively labeled mRNA produced from the galactose operon (encodes for the galE, galT, and galK genes) as a probe in a southern blot experiment, the mRNA probe would NOT hybridize to which one of following DNA sequences?

the galactose operon P1 or P2 promoters

Differential RNA processing may result in:

the production of two distinct proteins from a single gene

The main reason that mRNA transcripts are modified at the 5' and 3' ends is:

to protect the RNA from nucleolytic degradation

RNA processing that leads to mRNAs in which exon sequences are derived from different primary transcripts is called:

trans-splicing