363 Connect Ch 25.1 Quiz
A woman whose father has hemophilia and whose mother does not married a man with hemophilia. What is the probability that they will have a child with hemophilia?
1/2
If the couple from the previous question were to have another child what is the probability that it would have hemophilia?
1/2
A woman whose father has hemophilia and whose mother does not married a man that does not have hemophilia. What is the probability that they will have a child with hemophilia?
1/4
A young man knows that his grandfather had Huntington disease (genotype Hh). However, his father passed away at the age of 26 without ever being tested or showing signs of HD. Neither the young man's mother nor his grandmother had Huntington disease. What is the probability that this young man will develop HD when he is older?
1/4 - The young man's grandparents were Hh and hh. His father had a 50% (1/2) chance of being Hh. If his father was Hh, then his parents were Hh x hh, which would mean he'd have a 50% (1/2) chance of being Hh. 1/2 x 1/2 = 1/4.
Which of the following DNA sequence repeats within the Huntington gene would be associated with the development of HD?
CAGCAGCAGCAGCAGCAGCAGCAG
Both members of identical and fraternal twin pairs have the same likelihood of expressing the same genetic disease
False
Genetic diseases are spread by shared environmental conditions
False
Genetic diseases occur at the same rate in all human populations
False
Genetic disorders are more common in families with one affected member as compared to the general population
True
Many human and animal genetic disorders share similar characteristics
True
Most genetic diseases have a specific age of onset
True
A couple has four children, two sons and two daughters. One son has hemophilia and the other does not. One daughter has hemophilia and the other is a carrier. What were the genotypes of the mother and the father?
XHXh-A and Xh-AY
An affected offspring usually has one or two affected parents, and the trait occurs equally in both sexes
autosomal dominant
What type of inheritance pattern is being shown in the pedigree? Shaded symbols indicated affected individuals.
autosomal dominant
Frequently an affected offspring has two unaffected parents, and the trait occurs equally in both sexes
autosomal recessive
A geneticist cannot make sense of a pedigree he has put together for a newly discovered disease that he suspects is transmitted genetically. One possible explanation is
locus heterogeneity
Only females exhibit the trait when it is lethal to males, and affected mothers have a 50% chance of passing the trait to daughters.
x-linked dominant
Males are much more likely to exhibit the trait, and mothers of affected males often have brothers or fathers who are affected.
x-linked recessive
