Ap Bio Final

Lakukan tugas rumah & ujian kamu dengan baik sekarang menggunakan Quizwiz!

The number of days an animals spends in ARD does not significantly affect its times of survival after reintroduction of food.

Which of the following conclusions is most consistent with the data shown in Figure 2?

chart that says mean ph and Treatment group

Which of the following graphs is the most appropriate representation of the experimental result documented in the table?

Increasing the sample size of each treatment group

Which of the following modifications to the experimental design will best help reduce the standard errors of the means?

hybrid individuals are less likely to pass their genetic information on to subsequent generations

based on the model of speciation presented which of the following describes the most likely consequence to the populations over time

Golgi complex

A cell is treated with a drug that prevents the formation of new lysosomes. The cell continues to transcribe the genes that code fo the hydrolytic enzymes that are normally found in lysosomes and continues to translate the mRNA for those proteins on membrane bound ribosomes. The hydrolytic enzyme are most likely to accumulate in which of the following cellular structures?

If both have the allele for H, should an insurance company raise their rates because of the results of the test?

A man with high cholesterol levels is about to marry a women whose total cholesterol levels are also higher than the average. A physician has suggested they get tested for the HC allele. Which of the following is a valid ethical question concerning the test?

The amount of metabolic wastes in the water where the fish are being raised

A scientist is evaluating a proposal for raising large numbers of fish in the ocean pens for human consumption. As a . part of the evaluation, the scientist is designing a plan for investigating how the fish in the ocean pens might affect nearby ecosystems. Which of the following is the most appropriate factor to use as the dependent variable in the experimental investigation

the further the target flower from the hive the longer the waggle phase

As depicted in the diagram honeybees communicate the location of the flower patches to members other hives with waggle dances that give information about the direction and distance to the flower. Which of the following statements about how honeybees communicate the position of flower patches is most consistent with the model?

Different neurons in the same neutral network can release different amounts of neurotransmitter

Based in the model, which of the following best explains how regulation of neurotransmitter release might increase the range of responses to a stimulus in the nervous system?

The ability to enter ARD provides a strong selective advantage because reproduction can occur despite periods of food scarcity.

Based on the experimental results, which o the following is best evolutionary explanation for the occurrence of ARD in C elegans?

GFP contained in synaptic vesicles moved into the synaptic cleft by exocytosis

Based on the model, which of the following best explains why a bright green fluorescence was observed following stimulation of a presynaptic neuron?

CDK5 alters the activity of other proteins involved the movement of synaptic vesicles to the plasma membrane

Based on the model, which of the following describes the most likely mechanism by which CDK5 regulates neurotransmitters

Butterflies that express two variants of the enzyme are active over a-greater range of temperature.

Butterflies of the genus Colias live in the Rocky Mountains, where they experience a wide range of temperatures. Different variants of a particular glycolytic enzyme in the flight muscles are optimally active at different temperatures. Within the same population, some individual butterflies fly most effectively at 29 degrees celsius, while others fly most effectively at 40 degrees celsius. Still others can be equally active at both temperatures. Which of . the following claims is most consistent with the observed butterfly behavior?

Epinephrine binds to a cell- surface receptor; The activated receptor stimulates production of the second messenger, cAMP

Epinephrine is a protein hormone found in many animals. Epinephrine stimulates a signaling pathway that results in the breakdown of glycogen to glucose on the liver cells. Which if the following describes the initial steps n the process whereby epinephrine stimulates glycogen breakdown?

Met- Val- Thr-Lys-Phe-Gly-His

GACCGCAUGGUGACGAAAUUUGGCCAUUAA Based on the universal genetic code, Which if the following represents the correct polypeptide that will result from translation of the . mRNA molecule shown, beginning with the first available start codon?

Chart c

If the two finch populations are each in hardy Weinberg equilibrium and are isolated from each other, then which of the . following graphs correctly displays the relative genotype frequencies?

Peccaries eat cacti with a smaller number of spines, and wasp larvae with cacti with a greater number of spines

In a species of cactus, the number of spines on a plant is genetically determined. The graph above shows frequency distributions for populations of the cactus species growing in the presence or absence of two hebrivores: Peccaries ( A new world pig) and wasp larvae. Which of the following best accounts for the different frequency distribution in the graph?

The genes for body color and wing shape are located close to each other on the sam chromosome

In drosophila melanogaster the allele for wild type tan body color (B) dominate to the recessive allele for vestigial wing phenotype (v). In the cross diagrammed above, the expected and observed results are shown. Which of the following best explains the observed results of the cross?

without natural herbivores or competitors, C. taxifolia will grow rapidly and crowd out notice species of producers

In the year 2000, specimens of caulerpa taxifolia a green alga used tropical aquariums were found off the coast of California. Native to the Indian Ocean. taxifolia is known for aggressive growth and an ability to compete with sea grasses. It currently on an international list of invasive species. Which of the following best predicts the consequences of the introduction of C taxifolia to the California coast.

degradation of p35 results in increased synaptic activity

Previous experiments indicate that CDK5 is active only when attached to a protein called p35. Which of the following best predicts how p35 might play a role in regulating neuron function?

Production of a specific mRNA will increase as a result of the binding of the hormone- receptor complex to the DNA

Steroid hormones, such as testosterone, pass through the plasma membrane and bind to an intercellular protein, as shown in the diagram below. The hormone- receptor complex the enters the nucleus, where it interacts with DNA to promote transcription of a specific gene. Based on the information presented, which of the following will also occur in response to steroid signaling.

50

The average brood size per mated individual upon reintroduction of food following 30 days of ARD is closets to which of the following?

3

The cladogram above shows proposed phylogenetic relationships for several vertebrates. Selected derived characters are indicated on the cladogram by numbered labels. Based on the information presented, which of derived characters os shared by alligators and manatees but not salamanders? Give your answer as the number label of a character indicated on he cladogram.

The allele from blue is X linked dominant allele because there are no blue male offspring in cross 2

The data above represent the results of three different crosses involving the inheritance of a gene that determines whether a certain organism is blue or white. Which o the following best explains the mechanism of inheritance of the gene?

Addition of an H+ to GFP at acidic Ph changes the shape of protein, preventing fluorescence

Which of the following best explains why GFP might exhibit a bright green fluorescence in alkaline conditions but not in acidic conditions?

Phosphorylated p53 binds stimulates transcription of p21, and the resulting p21 protein suppresses cell division until DNA damage is repaired

The p53 regulates a cellular response to DNA damage. Based on the diagram above, which of the following best described the role of p53 in the response to DNA damage?

Maternal Mitochondrial mutations are inherited by all of a mothers offspring

The pedigree suggests that the gene is on a nuclear chromosome, and not on mitochondrial DNA, because?

Does the aquarium water contain living microorganisms

The results for treatment groups V and VI could suggest which of the following questions about the design of the experiment?

The conclusion is invalid because other variables in the experiment (both biotic and abiotic) affected the results.

The students concluded that pea plants grew better in compost than did melon plants. Which of the following best address the validity of the conclusion made by students?

the kidneys of reptiles and birds are highly efficient because little water is needed to excrete uric acid

The table below provides a comparison of nitrogenous waste production in selected organisms. Which of the . following statements is most consistent with the date in the table?

Genetic drift has occurred in population 1

The table shows the changes in allele frequencies of a specific gene in two populations of randomly mating small mammals after 30 years. The populations inhibit adjacent equatorial islands that have similar topography and climate. Which of the following is the most reliable conclusion that can be drawn from analysis of the data above?

Arginine to leucine at position x on the cladogram

The validity of the cladogram is best supported by molecular evidence fo which of the following changes in the amino acid composition of the beta hemoglobin protein during the evolution of these species?

If a proteolytic enzyme from one species is incubated with a precursors protein from another species, does correct cleavage occur

This mechanism of activating receptor- binding signaling proteins has been observed in a variety of organisms from bacteria to humans. Many membrane bound precursor proteins has been isolated and characterized. Which of the following questions would be most appropriate to investigate whether the proteolytic enzymes are evolutionarily conserved among species?

I and II

To investigate whether an organism in the study is capable of both photosynthesis and respiration, a comparison of which treatment groups is most appropriate?

Picture A Ca++ with aero going in

Transmission of an action potential across a synapse involves the release of neurotransmitters by the presynaptic neuron. The arrival of the action potential triggers a rise in the calcium concentration in the synaptic terminal, and the change in concentration triggers a release of neurotransmitters into the synaptic cleft. Which of the following representation of the movement of calcium, sodium, and potassium ions best shows how an action potential is transmitted to the postsynaptic neuron?

Mating with a well fed male consistently produced more offspring then did reproduction via self fertilization.

Which of following best describes the reproductive ability of C. Elegans following the ARD induced in the first experiment.?

Inhibition of CDK5 activity in neurons increases the movement of synaptic vesicles to the plasma membrane in response to a specific stimulus.

Which of the following observations best support the hypothesis that CDK5 negatively regulates neurotransmitter release?

the experimenters should remove the remains of salmon carcasses immediately after the salmon are eaten by the bear and determine the nitrogen content of the carcasses

Which of the following pieces of additional data would help further investigate the relationship between bears , salmons, and influx of nitrogen into the local environment?

Which molecular substance is actively transported across the plasma membrane?

Which of the following scientific questions is most relevant to the model represented in the figure above

Growth- factor signaling can trigger mitosis in cells that are in direct contact with other cells

Which of the following statement s accurately uses in formation presented to support the hypothesis that interruption of M function in a single body cell can result in cancer?

The nitrogen (n2) gas and ammonia (NH3) gas in the experiment 1 could provide the elemental nitrogen the phospholipid required by the first life form

Which of the following statements best justifies the claim that the conditions in at least one of the experiments could generate the molecular building blocks essential for life?

nitrogen influx will decrease because there wi be less bear salmon interactions

if a dam is built downstream and prevents salmon migration to test sites, which of the following most accurately predicts the impact on nitrogen influx?

intermediate stage

in a separate investigation individual mice from two poulatqos that in nature are geographically isolated from each other are mated in the laboratory. The hybrid offspring were then mated with individuals from either of the original populations.. Only the female hybrid offspring were fertile. The experimental results are most consistent with which of the stages that are depicted in the model?

an ancestral cell most likely engulfed an aerobes prokaryote in a relationship that proved beneficial for both cells

mitochondria are found in most eukaryotic cells and contain their own DNA and ribosomes that are similar to those typical of many prokaryotic cells. Which of the following statements is justified by these observations?

the presence of black bears and salmon correlates with significant increase in nitrogen influx

pacific salmon and black bears question Which o f the following statements is best supported by the data?

a single base pair substitution in the gene encoding the beta subunit

sickle cell anemia is associated with a mutation in the gene encoding the beta subunit f hemoglobin that results in a change from glutamic acid to valine at position . all other amino acids are identical to a normal hemoglobin molecule. Based on the information above which of the following mutations is the most likely cause of sickle cell anemia

bacteriophages DNA in the environmental activated bacterial cell division

some strains of the bacterium streptococcus pyogenes secret poisonous substances called exotoxins. The gene encoding the exotoxins are though to have originated in bacteriophages which are viruses that infect bacteria

the wolves were predators of the moose which were otherwise reproductively successful

the graph above represents the number of individuals in a population of wolves and in a population of moose observed in the same isolated geographic area over a 40 year time period from 1955 through 1955,. Which of the following statements about the two populations is best supported by information presented in the graph?

sterility would appear in females before appearing in males

using the model of speciation and applying it to a different population which of the following outcomes is most consistent for a different species in which the males are homogametic and the females are heterogametic?

sterile individuals make no genetic contribution to the next generation

which of the following best describe the reason for excluding hybrid males when calculating the allele frequencies of two interbreeding populations at the intermediate stage of speciation

the smaller population will be more affected than will the larger population because the smaller population has less genetic variation than the large population has

which of the following is the best prediction of how the new disease will affect the two populations

when bears consume salmon they leave parts of the carcasses on the ground which decompose releasing nitrogen into the environment

which of the following most likely describes how the interaction between bears and salmon influences nitrogen dynamics in the environment

The mean PH of the samples increased after one hour

which of the following observations provides the best evidence that photosynthesis occurred in treatment group 1?

RrXtxtxRrXTy

which of the following represents a cross between a white eyed female and a red eyed male


Set pelajaran terkait

econ of corp finance homework problems

View Set

Shock, Hemodynamics, Biliary tract

View Set

1.1.d. What features of structure and function are common to all humans?

View Set

BSC 101 Unit (What is science... ) (1/4)

View Set

Chemistry 151: Chapter 3 Mastering Practice Quesions

View Set

Review all about me (age, birthday, nationality)

View Set

Nutrition Quizzes combined- final

View Set