BIO325 Quizzes
Which parents could produce a girl with blood type A?
-AB and B -A and B -A and O -AB and O
Which ratio would indicate that a phenotype is controlled by more than one gene? 3:1 9:3:3:1 2:1 1:2:1
9:3:3:1
Different types of cancers can be caused by reciprocal translocations. Which of these scenarios would NOT cause a cancer phenotype?
A gene that blocks DNA replication in response to DNA damage is fused to a regulatory element that activates transcription always, so DNA is not replicated.
Example of a SNP
A single base change in the gene for β globin changes an amino acid and results in sickle cell anemia.
Which of these statements about constructing transgenic flies or fish using transposons is NOT true?
Injected embryos become transgenic - all cells have the transgene.
What type of mutation in a transposon would prevent it from mobilization even in the presence of a wild-type, autonomous transposon that belongs to the same family and can move on its own?
Point mutation in the inverted repeats prevents transposase from recognizing them. Deletion of one of the inverted repeats
Examples of post-transcriptional gene regulation
RNA localization Phosphorylation/dephosphorylation of proteins Alternative splicing of exons and introns. Ubiquitin-mediated protein degradation
Below is a pedigree for a common human trait (not a disease) controlled by a single gene that has two different alleles A or a. Shaded symbols are for individuals exhibiting the trait. Identify the mode of inheritance of the trait.
Recessive
NOT a post-transcriptional process prior to initiation of translation in eukaryotes
Scanning down the 5' end of mRNA to locate the first AUG
A particular cDNA clone is present in the mouse heart cDNA library but absent from the mouse kidney cDNA library. Why?
The gene represented by the cDNA clone is expressed in the mouse heart but expressed little or not at all in the kidney.
Which events produce Turner syndrome individuals or mosaics?
-Nondisjunction of X chromosome during second meiotic division -Mitotic nondisjunction of X chromosome -Nondisjunction of X chromosome during first meiotic division -Mitotic loss of X chromosome
Similarities between DNA replication and transcription
-Only one of the two DNA strands is used as a template for a gene. -New nucleotides are added to the 3' end of the growing chain. -Hydrogen bonds are broken and a single stranded template is used to add complementary bases. -Two DNA strands, which were separated, come back together by reforming H-bonds after the process is complete -Initiation occurs at a specific site.
Which of these could be caused by mutation within the coding region of a gene by altering the protein product? (Choose all that apply.) -Protein has lost its catalytic activity. -A leg-specific protein is also made in the antenna. -Changes in protein folding result in a novel function. -No functional protein is made (null). -A protein that specifies embryonic limb development is expressed throughout the lifetime of an organism (with no change in protein structure).
-Protein has lost its catalytic activity. -Changes in protein folding result in a novel function. -No functional protein is made (null).
Why do scientists think that all forms of life on earth have a common origin?
-Related genes from different organisms have similar nucleotide sequences -All living organisms use the same genetic code -Related genes from different organisms have similar amino acid sequences -Different organisms have related genes with similar functions
Which enzymes would you need to make a recombinant DNA molecule using an insert to be cut from the genomic DNA?
-Restriction endonuclease -DNA ligase
Translation
-Risosome translates the mRNA in the 5' to 3' direction. -Protein gets made from N-term to C-term. -The charged initiator tRNA sits in the ribosome to base-pair with the AUG start codon. -A new charged tRNA comes into the ribosome after it moves three nucleotides down the mRNA. -As pepetide bond forms, one tRNA becomes uncharged and will exit the ribosome.
What is the relationship between chromosomal instability and cell proliferation characteristics of tumorigenesis?
-The higher the frequency of cell division, the greater the chance for genomic instability because of more opportunities to create mutations -The greater the chromosomal inactivity, the higher the probability of increased cell proliferation due to driver mutations
What is true about DNA replication?
-The lagging strand is made in pieces that will be joined together into one strand -Leading strands are synthesized continuously in 5' to 3' direction -Replication bubble becomes larger as replication proceeds -Okazaki fragments are made of DNA and RNA nucleotides that are covalently bonded
embryonic stem cells...
-are undifferentiated. -can be grown in culture. -are pluripotent.
The appearance of a novel phenotype resulting from the substitution of a single base pair might be due to
-change in the time or location of gene expression. -change in the amount of RNA expressed. -change in the size of protein expressed. -change in the amino acid sequence.
The Temperature of Melting (Tm) is defined as the temperature at which 50% of double-stranded DNA is changed to single-stranded DNA. The Tm depends on both the length of the molecule, and the specific nucleotide sequence composition of that molecule (GC content as opposed to AT). The Tm will fall with
-decrease in length of DNA -increase in AT content
Factors affecting rate of mutation
-efficiency of DNA repair -dose of mutagen -gene size -number of cell divisions
What information CAN be determined from the DNA sequence of a cDNA clone?
-exon sequences - amino acid sequence of the encoded protein -UTR sequences -sequence of the spliced mRNA transcript
What techniques CAN be used to study loss-of-function phenotype of a gene?
-gene targeting to make knockout -gene targeting to make knockin -RNAi-mediated gene silencing
Chemical interactions involved in maintaining tertiary structure in protein molecules
-hydrophobic/hydrophilic interactions -hydrogen bond -covalent bond -ionic interactions
post-transcriptional processes prior to initiation of translation in eukaryotes
-mRNA export to the cytoplasm -Addition of a 5' cap -Addition of a poly-A tail on the 3' end -Splicing to remove introns and join exons together
Types of allele interactions of a single gene
-multiple alleles (polymorphism) - incomplete dominance -complete dominance -codominance
Meselson and Stahl relied on equilibrium density gradient centrifugation to resolve the DNA containing 14N from the DNA containing 15N. They started off with DNA in media containing the heavy isotope, then switched to media containing the lighter isotope and allowed DNA replication to take place. Under conservative model of DNA replication, after THREE rounds of replication, how many bands of DNA would you see and which band would contain more DNA molecules?
-two bands (one light, one heavy) -The light band contains more DNA molecules
In humans, the genes for red-green color blindness (R = normal, r = color blind) and hemophilia A (H = normal, h = hemophilia) are both X-linked and only 3 map units apart. A normal woman whose mother is colorblind and whose father has hemophilia A is pregnant with a boy. If the alleles for color blindness and hemophilia A are rare in the population, what is the probability that the boy will have normal vision and normal blood clotting?
.015
Allele frequencies for each locus are as follows: Locus 1, allele 10: 0.1 Locus 2, allele 11: 0.2 Locus 3, allele 6: 0.2; Locus 3, allele 9: 0.3 What is the probability of matching the genotype identified from the crime scene sample? And can you avoid wrongful conviction by ensuring that no two individuals have the same DNA fingerprint out of 7 billion human population just by analyzing the three given loci?
0.000048 No; more than the three SSR loci need to be genotyped to identify a culprit with confidence.
Fruit flies with one allele for curly wings (Cy) and one allele for normal wings (Cy+) have curly wings. Fruit flies with two copies of the Cy allele are never born. What is the ratio of curly flies to normal flies when two curly-winged flies are crossed? (Note that only live progeny are considered)
1 normal: 2 curly
Two alleles of gene C control hair color in horses: C¹ and C². Horses homozygous for C¹ allele are red, heterozygotes are yellow, and C² homozygotes are cream. In the offspring of mating between heterozygotes, what phenotypic ratio is expected?
1 red: 2 yellow: 1 cream
Which of these gametes are genetically balanced? Note that red and blue chromosomes are not homologous.
1, 5
A certain disease is caused by homozygosity of the g allele (G is the corresponding wild-type allele). However, the penetrance of the disease is 25%. Two individuals known to be heterozygotes have a child. What is the probability that the child exhibits the disease?
1/16
Hemophilia is caused by an X-linked recessive mutation in humans. If a woman whose sister is a hemophiliac marries a man whose brother is a hemophiliac, but the couple does not show symptoms of hemophilia, what is the probability that their first son they are expecting will have hemophilia? (Assume that the mutant allele is rare and completely penetrant, and carriers do not show any symptoms.)
1/2
Hypophosphatemia is controlled by an X-linked gene in humans. The allele that causes hypophosphatemia is dominant to the wild-type allele. A normal man and a woman with hypophosphatemia are married as first cousins. The mother of the woman and the father of the man are siblings and they both have hypophosphatemia. What is the probability that the child from this consanguineous mating will have hypophosphatemia? (Assume that the mutant allele is rare and completely penetrant, and there are no carriers who are normal. There is otherwise no history of the disease.)
1/2
Sickle cell anemia is a recessive disease in humans. In a cross between a father who has sickle cell anemia and a mother who is a carrier of the sickle cell allele, what is the probability that all of their first four children will have the disease?
1/2
In some genetically engineered corn plants, a Bt gene was added to a chromosome. The Bt gene specifies a protein called Bt that is lethal to certain flying insect pests that eat the corn plants. If the corn plant is heterozygous for the Bt gene (one homolog has the introduced Bt gene and the other does not), what proportion of the sperm would carry the Bt gene? And is the presence of the Bt gene (a mutation) dominant or recessive to its absence (the wild type) if the hybrid makes the Bt protein?
1/2; dominant
If you toss a coin twice and get two heads, what is the probability that you will get two tails on the next two coin tosses?
1/4
Below is a pedigree for a common human trait (not a disease) controlled by a single gene that has two different alleles A or a. Shaded symbols are for individuals exhibiting the trait. If individuals 4 and 7 have a child, what is the probability that the child will exhibit the trait?
1/6
In corn, having ligules (L) is dominant to liguleless (l), and green leaves (G) is dominant to white leaves (g). If a pure-breeding liguleless plant with green leaves is crossed to pure-breeding plant with ligules and white leaves to produce F1 progeny, predict the proportion of F2 progeny with the genotype Ll gg.
1/8
The figure below shows the pedigree of a family in which a completely penetrant, autosomal dominant disease is transmitted through three generations. The alleles for a SNP locus are shown (A or C). Assuming linkage between the disease gene and the SNP locus, what is the genetic distance between the two loci?
10 m.u.
The R/r and S/s genes are linked and 20 map units apart. In the cross Rs / rS x rs / rs what fraction of the progeny will be RS / rs?
10%
Imagine that DNA of a new species is composed of equal proportions of six different types of nucleotide, instead of the normal four. The six nucleotides are A, C, G, T, X, and Y. In this new type of DNA molecule, A pairs with T, C pairs with G, and X pairs with Y. What would be the average size of the DNA fragments produced when this new DNA is cut by a restriction endonuclease with a four-base recognition sequence?
1296 bp
In worms (Caenorhabditis elegans), the gene pes-1 encodes a transcription factor which is expressed during embryonic development. A different gene fkh-2 is also expressed in developing embryos. One wild-type copy of either gene (pes-1 or fkh-2) is sufficient for worms to live. But simultaneous disruption of the activity of both genes results in a lethal phenotype. Predict the phenotypic ratio of the F2 progeny of a cross between two pure-breeding worms (Parental), one homozygous for pes-1 mutation and the other homozygous for fkh-2 mutation.
15 live : 1 dead
If an individual has 10 gene pairs, how many different gametes can be formed if six of the gene pairs are homozygous and the remaining four gene pairs are heterozygous?
16
Had Hershey and Chase performed their experiment designed to determine the molecule of heredity using the 16N radioisotope, what would have been their results?
16N will label both DNA and protein, so radioactivity would be found within bacterial cells and on phage ghosts
A plasmid vector contains a single EcoRI site in the polylinker (multiple cloning site). A gene of interest is flanked by two EcoRI sites, one at each end. You cut the vector and the DNA containing your insert with EcoRI, and ligate the two. How many EcoRI site(s) is/are present in the recombinant DNA molecule and how many band(s) would you see when you run your digest of recombinant DNA on a gel? (Assume that there is no internal EcoRI site in the insert DNA.)
2 sites, 2 bands
Fifty-million sperm were examined for mutations in a specific gene and 100 mutations were found. What was the mutation rate for this gene?
2 x 10^-6 mutations per gene per gamete
If 30% of the bases in a region of the mouse genome are cytosine, what percentage in that region are adenine?
20%
Suppose a protein contains 100 amino acids. How many unique sequences could it potentially represent?
20^100
What is the sequence of the template DNA used for this sequencing reaction? 5' TTTGCTTTGTGAGCGGATAACAA 3'
3' AAACGAAACACTCGCCTATTGTT 5'
Given the following strand of DNA: 5' GTATCGGAAT 3' Which of the following sequences is the correct complementary DNA strand?
3' CATAGCCTTA 5'
The R/r and S/s genes are linked and 20 map units apart. In the cross Rs / rS x rs / rs what percentage of the progeny will be Rs / rs?
40%
What is an anticodon that base pairs with the codon 5' AUG 3' and which amino acid does it bind? (See Fig. 8.2 if needed.)
5' CAU 3' - Met
Which of the following sets of primers could you use to amplify the entire target DNA sequence below, which is part of the last protein-coding exon of the CFTR gene? 5' GGCTAAGATCTGAATTTTCCGAG....TTGGGCAATAATGTAGCGCCTT 3' 3' CCGATTCTAGACTTAAAAGGCTC....AACCCGTTATTACATCGCGGAA 5'
5' GGCTAAGATC 3' 3' CATCGCGGAA 5'
What is the probability that AJ's biological children are carriers of her BRCA 1 mutation?
50%
Which pieces of evidence are most likely to indicate a gene within a genomic DNA sequence? (Choose two that apply.)
50% of its sequence has 75% identity with a cDNA clone made from fly brain. A unique sequence within a genome is 80% similar in human, mouse, and zebrafish
Chronic myelogenous leukemia involves a reciprocal translocation between chromosomes 9 and 22, making a hybrid bcr-abl gene. If you design a probe for the bcr gene that can hybridize to either end of the breakpoint, how many fluorescent FISH signals would you detect in a translocation heterozygote in metaphase? (Note: Assume that the sister chromatids are both normal or both altered by the same translocation. This diagram shows chromosomes prior to replication: before S phase.)
6
The numbers of chromosomes in the somatic cells of several wheat varieties are einkorn wheat-14; durum wheat-28; and common wheat-42. What is the basic chromosome number (x) in wheat if einkorn wheat is diploid?
7
The numbers of chromosomes in the somatic cells of several wheat varieties are einkorn wheat-14; durum wheat-28; and common wheat-42. What is the gamete chromosome number (n) in wheat if einkorn wheat is diploid?
7; 14; 21
Assume that a series of compounds has been discovered in Neurospora (bread mold). Compounds A-F appear to be intermediates in a biochemical pathway. Conversion of one intermediate to the next is controlled by enzymes that are encoded by genes. Several mutations in these genes have been identified and Neurospora strains 1-4 each contain a single mutation. Strains 1-4 are grown on minimal media supplemented with one of the compounds A-F. The ability of each strain to grow when supplemented with different compounds is shown in the table (+ = growth; o = no growth). Which biochemical pathway fits the data presented and which strain has a mutation at the last step (rightmost) of the pathway?
A or B → C → D → F → E 3
Which individuals are most likely to be affected by Huntington disease, knowing it is an autosomal dominant disease? (Choose all that apply.)
A, B, C, E
Below is a pedigree for a common human trait (not a disease) controlled by a single gene that has two different alleles A or a. Shaded symbols are for individuals exhibiting the trait. What is/are the possible genotype(s) of person 5?
Aa
Bananas that you find in the supermarket are triploids, where x = 11. Why are organisms like bananas with an odd number of chromosome sets usually sterile? And what is the number of chromosomes in balanced gametes made by bananas?
Almost all gametes will have an unbalanced set of chromosomes. 11 or 22
The different forms of hemoglobin are adapted to most efficiently carry oxygen in different stages of development: embryonic, fetal, and adult stages. How is this functional diversification made possible?
As there were many copies of globin genes made after several rounds of duplication events, independent mutations allowed some globin genes to assume new specialized but related functions
How can a mutation in a tumor suppressor behave as a recessive allele at the cellular level but appear as a dominant allele in pedigree analysis?
At the cellular level, both alleles need to be mutated for an on effect, while in a pedigree the cancer may be dominantly inherited due to frequent less/inactivation of the normal allele
Gene TXF (TEXAS Fight) is usually expressed only in skin cells. To learn about the mechanism of TXF gene expression, you make clones that contain a GFP reporter and various parts of the upstream region of genomic DNA that normally surrounds the TXF gene (black lines) as shown below. The resulting clones were introduced into frog skin cells growing in the lab, and the level of GFP expression was monitored by measuring green fluorescence. The relative GFP fluorescence is indicated by +, with more +s equal to higher expression. (one + = basal expression level; three + = normal expression level) Which region contains the enhancer of TXF?
B
The trinucleotide repeat region of the Huntington disease (HD) locus in six individuals is amplified by PCR and analyzed by gel electrophoresis as shown; the numbers to the right indicate the sizes of the PCR products in base pairs. The 5' end of one primer is located 70 nucleotides upstream of the first CAG repeat, and the 5' end of the other primer is located 70 nucleotides downstream of the last CAG repeat. Normal alleles for HD gene contain up to 35 CAG repeats, while disease-causing alleles carry 36 or more. The more the repeats, the earlier the age of disease onset. In which of these individuals is the onset of disease likely to be earliest?
B
Which of these results would support a FAMILIAL origin of breast cancer?
Blood cells are heterozygous and tumor cells are homozygous mutant
NOT an example of post-transcriptional gene regulation
Chromatin remodeling
Which method cannot generate overlapping DNA fragments?
Complete digestion with a single restriction enzyme
Which region contains the promoter of TXF?
D
What is NOT true of genomic imprinting?
DNA methylation silences all imprinted genes found on one of the two homologs while all imprinted genes found on the other homolog remain transcriptionally active.
If a chemical inhibitor of DNA topoisomerase was added to bacterial cells after DNA replication initiation, the outcome would be
DNA would be supercoiled ahead of the replication fork and replication would not proceed to completion.
One problem associated with CRISPR/Cas9 technology is off-target effects. Part of the reason is that single base-pair mismatches between the target site and the sgRNA in the 20 bp DNA/RNA hybrid do not prevent Cas9 cleavage of the target site. What do you need to avoid if you want to replace the mutant Htt allele that causes Huntington disease with the wild-type allele, without off-target effects?
Design sgRNA that can base pair with several regions in the Htt gene to ensure efficient cleavage of the mutant allele.
What is the evidence that a codon is more than one nucleotide in length?
Different point mutations that affect the same amino acid can recombine to give wild-type protein.
In the United States, most newborns undergo a screening test for up to 60 genetic disorders. A few drops of blood is taken from each baby and the levels of various blood components are determined. The screening identifies babies who might have a genetic disorder, but is not diagnostic. Further testing is required if the screen shows a blood component is out of the normal range. Which of the following technologies could potentially be a low-cost replacement for the current newborn screening and would directly test most babies for the presence of many genetic disorders?
Exome sequencing and comparison with known mutations in databases
What is a feature unique to adeno-associated viral (AAV) vectors that is not shared with retroviral vectors?
Gene therapy needs to be repeated periodically to provide a constant supply of the therapy protein.
In humans, the genes for red-green color blindness (R = normal, r = color blind) and hemophilia A (H = normal, h = hemophilia) are both X-linked and only 3 map units apart. Suppose a woman has four sons, and two have color blindness but normal blood clotting, and two have hemophilia but normal color vision. What is the probable genotype (with correct arrangement of alleles) of the woman?
H r / h R
The following tree shows the evolutionary history of human hemoglobin and myoglobin genes, which are homologous. Which two statements incorrectly describe their relationship?
Hemoglobin epsilon gene is more closely related to hemoglobin beta gene than it is to hemoglobin gamma genes. The eight human hemoglobin genes shown above are orthologous
AJ's mom and maternal grandmother died of ovarian cancer. Her maternal aunt also died of breast cancer. AJ opted to have a blood test to see if she had a BCRA1 mutation and found that one copy of the gene was wild type and the other copy had a nonsense mutation that would cause production of a nonfunctional protein. What is the genotype of the non-tumor cells of her mother, maternal aunt, and maternal grandma id the mutant allele is rare in the population?
Heterozygous
p53 is a crucial tumor suppressor that responds to diverse stress signals by orchestrating specific cellular responses including transient cell cycle arrest (through activation of p21, a CDK inhibitor), DNA repairs, and apoptosis. What is least likely to occur from the inactivation of p53?
Increased propensity to arrest in G1 due to decreased phosphorylation of Rb
A protein has the amino acid sequence of N... Ala-Gly-Leu-Trp-Val-Thr ...C. A researcher identified several mutants that all produce a shortened protein with Leu as the terminal amino acid. The codon for Trp is 5' UGG 3'. What DNA single-base change would NOT cause truncation of this protein at Leu? -Insertion of A between G and G -Insertion of A between U and G -A substitution of the second G with A -A substitution of the third G with A -Insertion of G between U and G
Insertion of G between U and G
Which of the following is NOT true of DNA? -It is less stable than protein -Its information consists of variations in the base sequence -It is helical -It is acidic -It is more stable than RNA -It has a polarity (direction)
It is less stable than protein
In corn, having ligules (L) is dominant to liguleless (l), and green leaves (G) is dominant to white leaves (g). If a pure-breeding plant that is liguleless and has green leaves is crossed to a pure-breeding plant with ligules and white leaves, predict the genotype and phenotype of the F1.
LlGg; green and ligules
The cross L p q / l P Q x l p q / l p q is carried out. If the Q gene is in the middle, between genes L and P, what would be the genotypes of the double crossover gametes in this cross?
LpQ and lPq
In 2008, Margaret Binkele was murdered in her Georgia home. The number of repeats at three CODIS simple sequence repeat (SSR) loci were determined using crime scene samples and blood from three suspects. The results of genotyping three SSR loci are summarized in the table. According to the data, the crime scene sample matches the sample from which suspect?
None of the suspects is a match.
What type of mutation in a transposon would allow it to mobilize in the presence of a wild-type, autonomous transposon that belongs to the same family and can move on its own?
Nonsense mutation in the transposase gene makes non-functional transposase enzyme. Mutation in the promoter of the transposase gene inhibits transcription.
Which of these mutations would have the most severe effect on the protein function? -Conservative missense mutation -Nonsense mutation occurring near the 3' end of the coding sequence -Deletion of one amino acid in the unstructured/flexible region of a protein -Nonsense mutation occurring near the 5' end of the coding sequence
Nonsense mutation occurring near the 5' end of the coding sequence
Unique to DNA replication
Primer is required to initiate polymerization.
When the his- Salmonella strain used in the Ames test is exposed to substance X, his+ revertants are seen. If, however, rat liver enzymes are added to the cells along with substance X, revertants do not occur. Rat liver enzymes alone cannot induce reversion. How can you explain this result?
Rat liver enzymes converted a mutagenic substance X into a benign substance
Which polymorphism is most likely to cause a disease that is rare in a population?
SNP in the start codon of a protein-coding gene A rare SNP, linked to the disease phenotype and consistently present in the affected individuals of a family
Auxotrophic mutant strains of Neurospora are grown in minimal media with supplements as follows. Strains may carry more than one mutation. Growth is shown by (+) and no growth is shown by (o). Both strain a and strain b accumulate ornithine. Indicate the statement that is most correct regarding these two strains.
Strain a has mutations in ARG-F and ARG-H
You want to test an alkylating agent that adds an -CH2-CH3 (ethyl) group for mutagenicity by doing the Ames test. EMS adds -CH2-CH3 to guanine, and ethylated G pairs with T instead of C. There are different types of his- auxotrophs that you can choose from in order to detect reversion to his+ prototrophs in response to a compound under test. What type of his- mutants do you need to use when testing EMS for the Ames test?
Substitution mutant with G-C instead of A-T (wild type)
Fruit flies with one allele for curly wings (Cy) and one allele for normal wings (Cy+) have curly wings. Fruit flies with two copies of the Cy allele are never born. What is the dominant allele in terms of viability and wing phenotype?
The Cy+ allele is dominant for viability; the Cy allele is dominant for wing phenotype.
In some flowers, two genes control the flower pigmentation. The gene for purple pigmentation (P) is dominant to the gene for red pigmentation (p). However, in the presence of one dominant W allele, flowers are white regardless of the alleles of the other gene (P/p). When a plant with red flowers was crossed to a pure-breeding plant with white flowers, all of the F1 plants had white flowers. When the F1 plants were crossed to each other, the F2 consisted of 161 plants : 123 with white flowers, 29 with purple flowers, and 9 with red flowers. How do these results suggest that flower color is determined?
The dominant allele of one gene masks the effect of a second gene.
The following diagram shows the complex between an sgRNA and the target site in the genome so that Cas9 can cut the genomic DNA at the indicated positions. The protospacer adjacent motif or PAM site (5'-NGG-3' on one strand; N is any base) needs to be present adjacent to the target site in order for Cas9-mediated cleavage to occur. As discussed in lecture, CRISPR/Cas9 system evolved in bacteria to provide viral immunity. Bacteria have CRISPR locus in their genome but it does not contain any PAM sites, but the bacteriophage genome sequence targeted by CRISPR does. How is this fact crucial to keeping the bacterial genome intact and selectively destroying the phage genomes?
The presence of the PAM site in parts of the bacteriophage genome causes the phage DNA to be cleaved by Cas9. The absence of the PAM site in the bacterial CRISPR locus prevents the bacterial chromosome from being cleaved by Cas9.
Identical twins or monozygotic twins originate from the same zygote, which divides into an early embryo that splits into two cell masses that develop into two twins. Identical twins developed myoclonic epilepsy in their teens. One twin remained only mildly affected by this condition, but the other twin later developed other symptoms of full-blown MERRF (myoclonic epilepsy and ragged red fiber disease), including deafness, ragged red fibers, and ataxia (loss of the ability to control muscles). Which of the statements does NOT explain the observed phenotypic difference in these identical twins?
The zygote was heteroplasmic, but each of the two cell masses was homoplasmic to give rise to one homoplasmic wild-type twin and one homoplasmic mutant twin.
You are studying a histone complex that contains an unusually high level of modification with acetyl groups. What can you conclude about the nucleosomes containing this histone complex?
They contain actively transcribed genes.
Which of the following is NOT true of enhancers?
They regulate basal level of transcription.
Why is it necessary to prepare genomic DNA from multiple cells for sequencing a genome?
To produce enough fragments that could overlap in order to assemble the whole genome sequence
What is a feature unique to prokaryotic gene regulation?
Transcription and translation occur simultaneously in the same compartment.
A student analyzes a genomic DNA sequence of 100 nucleotides in order to determine if it is part of a gene. When she translates the sequence beginning at the first nucleotide, she finds that the tenth codon is TAA (a stop codon). What should she do next?
Translate the sequence in the other five reading frames.
True or False: If you cut a DNA molecule with a restriction enzyme that recognizes a four-base sequence, there would be a greater number of fragments than that generated by digesting the same DNA with a restriction enzyme that recognizes a six-base sequence; and the resulting fragments would be smaller on average than those produced by digesting with a six-base recognition sequence. (Assume that base-pair sequences are random and the proportion of each nucleotide is 1/4.)
True
How can you simultaneously target multiple genes for knockout using CRISPR?
Use multiple guide RNAs
In some flowers, two genes control the flower pigmentation. The gene for purple pigmentation (P) is dominant to the gene for red pigmentation (p). However, in the presence of one dominant W allele, flowers are white regardless of the alleles of the other gene (P/p). When a plant with red flowers was crossed to a pure-breeding plant with white flowers, all of the F1 plants had white flowers. When the F1 plants were crossed to each other, the F2 consisted of 161 plants : 123 with white flowers, 29 with purple flowers, and 9 with red flowers. What is the genotype of the parental plant with white flowers?
WWPP
In some flowers, two genes control the flower pigmentation. The gene for purple pigmentation (P) is dominant to the gene for red pigmentation (p). However, in the presence of one dominant W allele, flowers are white regardless of the alleles of the other gene (P/p). When a plant with red flowers was crossed to a pure-breeding plant with white flowers, all of the F1 plants had white flowers. When the F1 plants were crossed to each other, the F2 consisted of 161 plants : 123 with white flowers, 29 with purple flowers, and 9 with red flowers. What is the genotype of the F1 plant with white flowers?
WwPp
Which of these is NOT an explanation for why the the same genotype can give rise to different phenotypes? a) One gene may affect more than one characteristic, and the allele interaction can vary for each character. b) Temperature can influence the activity of an enzyme required for skin pigmentation. c) Some people are born genetically prone to lung cancer, but those who smoke have a much higher chance of developing the disease. d) Identical twins look subtly different because of the effect of random mutations. e) Even when two siblings inherit the same mutant allele that predisposes to heart disease, diet and exercise can affect the likelihood of developing the disease.
a) One gene may affect more than one characteristic, and the allele interaction can vary for each character.
In worms (Caenorhabditis elegans), the gene pes-1 encodes a transcription factor which is expressed during embryonic development. A different gene fkh-2 is also expressed in developing embryos. One wild-type copy of either gene (pes-1 or fkh-2) is sufficient for worms to live. But simultaneous disruption of the activity of both genes results in a lethal phenotype. What is the phenotypic ratio among the progeny of a cross between a worm heterozygous for both genes and a worm homozygous for fkh-2 mutation but homozygous wild-type for pes-1?
all live
The term mutation refers to
any heritable changes in the DNA of a cell.
The primary function of basal transcription factors is to
assist in associating RNA polymerase with the promoter.
Most breast and ovarian cancers are sporadic (that is, not inherited). but some are the result of inherited predisposition principally due to mutations in genes BCRA 1 and BCRA2. Individuals with breast cancer can undergo genetic testing to find if they inherited one of the mutant alleles or not. Which of these results would support a sporadic origin of breast cancer?
blood cells are homozygous wild type and tumor cells are homozygous mutant
In plants, genes E, F, and G are on one chromosome arm. Alternate dominant and recessive alleles of all three genes determine visible traits: E = normal leaf number, e = extra leaves; F = normal stems, f = furry stems; G = normal flower size, g = gigantic flowers. What is the phenotype of a plant that is homozygous for an inversion between two breakpoints shown below if one breakpoint disrupts the E gene by splitting it into two parts? (Assume there are no other genes in the vicinity of the three genes shown.) And does inversion change the number of genes?
extra leaves, normal stems, gigantic flowers No, inversion does not change the number of genes.
Hypophosphatemia is controlled by an X-linked gene in humans. The allele that causes hypophosphatemia is dominant to the wild-type allele. A normal man and a woman with hypophosphatemia are married as first cousins. The mother of the woman and the father of the man are siblings and they both have hypophosphatemia. Which one of the grandparents of these first cousins has hypophosphatemia for sure? (Assume that the mutant allele is rare and completely penetrant, and there are no carriers who are normal. There is otherwise no history of the disease.)
grandmother
A researcher is studying coat color in mice. Wild-type fur in mice is brown. Three pure-breeding strains of mice with white fur have been isolated: milky, blanc, and weiss. White fur is a recessive trait in each strain. These mice are crossed to each other in pairs and the progeny phenotypes are recorded. milky x blanc = all brown progeny milky x weiss = all white progeny blanc x weiss = all brown progeny What conclusion is consistent with these results?
milky and weiss have mutations in the same gene, blanc has a mutation in a different gene.
Inherited mutations in BCRA 1 or 2 increase the risk of several cancers in addition to breast and ovarian cancer, and inherited breast cancer is associated with young age of onset. How does inheritance of one mutant allele of a tumor suppressor gene can predispose the individual to cancer at an early age?
only one additional mutation in any somatic cell is required to inactivate both copies of a tumor suppressor gene
Is the following pedigree for a rare, recessive disease associated with maternal or paternal imprinting, and how many is/are carrier(s)? (There is one origin for the disease allele, which is completely penetrant.)
paternal imprinting; 1
What information CANNOT be determined from the DNA sequence of a cDNA clone?
promoter sequence
What technique CANNOT be used to study loss-of-function phenotype of a gene?
pronuclear injection into wild-type zygotes
p53 is a transcription factor whose function is lost in many factors. MDM2 binds to transcriptional activation domains of p53 thereby inhibiting the p53 activations functions. MDM2 also has an ubiquitinating activity that causes proteasome-mediated degradation of p53. Is MDM2 a tumor suppressor or proto-octogene?
proto-oncogene
Huntington disease is a dominant disease caused by expansion of the trinucleotide repeat region of the Htt gene that results in the production of a Huntingtin protein with an expanded number of glutamines. An animal model with most features of this syndrome could be created by
randomly inserting a transgene containing a disease-causing mutant allele of the Htt gene to a mouse or primate genome.
In worms (Caenorhabditis elegans), the gene pes-1 encodes a transcription factor which is expressed during embryonic development. A different gene fkh-2 is also expressed in developing embryos. One wild-type copy of either gene (pes-1 or fkh-2) is sufficient for worms to live. But simultaneous disruption of the activity of both genes results in a lethal phenotype. What gene interaction is illustrated here?
redundancy
Nondisjunction can occur at either the first or the second division of meiosis. XYY individuals would most likely arise from nondisjunction at the ______ meiotic division in the ______.
second; father
MAP kinase pathway is activated by ligand binding to a transmembrane receptor, which switches Ras on via GEF that counteracts GAP activity. Ras-GTP in turn activates the downstream signaling intermediates which are activated by phosphorylation. Which drug cannot be used to target cancer cells that have elevated receptor activation?
small molecule inhibitors that interfere with GAP activity
Which of the following probabilities is correct regarding a mating of an Ss RR individual to an individual who is Ss Rr ? ( - indicates the the second allele is either dominant or recessive.) Heterozygous both alleles: 50% or 1/2 S- RR: 75% or 3/4 Homozygous recessive: 10% or 1/10 ss R- : 25% or 1/4
ss R- : 25% or 1/4
Does KpnI that cuts 5' GGTAC^C 3' make sticky ends (with which overhangs) or blunt ends?
sticky ends with 3' overhangs
If an Ss x Ss mating is performed and the progeny have the following phenotypic ratios of 3 S_ , (- indicates that the other allele is unknown) and 1 ss, what is the dominance relationship?
the S allele is dominant to the s allele
A BLAST search can be used for which application?
to compare a nucleotide or amino acid sequence to databases from a variety of species
What is the purpose of plating bacterial cells on medium containing drugs like ampicillin during DNA cloning?
to select for transformants (recombinants + non-recombinants)
5 to 10% of all breast cancers which can affect both women and men have mutations in genes BCRA1 or BCRA2. Spectral karyotyping of these mutant cells reveals gross chromosomal rearrangements such as translocations and deletions as well as fusions, which all result in loss of function. Is the BCRA gene a tumor suppressor or a photo-oncogene?
tumor suppressor
In some flowers, two genes control the flower pigmentation. The gene for purple pigmentation (P) is dominant to the gene for red pigmentation (p). However, in the presence of one dominant W allele, flowers are white regardless of the alleles of the other gene (P/p). When a plant with red flowers was crossed to a pure-breeding plant with white flowers, all of the F1 plants had white flowers. When the F1 plants were crossed to each other, the F2 consisted of 161 plants : 123 with white flowers, 29 with purple flowers, and 9 with red flowers. Which phenotype can be represented by the most number of different genotypes?
white
