BIOL 111 Problem Set 9

Given below is the DNA sequence of a short protein: AUGACGCUAGCCGCAGCGAGCCACCUAGGAGGAUGA How many amino acids will the protein translated from this sequence have?

11- the last codon is a stop codon and isn't translated into anything. It just stops translation.

Cytosine makes up 24% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be guanine?

24%

Below is a piece of double stranded DNA. If RNA polymerase is moving from left to right , what is the product? 3'-GGACT-5' 5'-CCTGA-3'

5'-CCUGA-3'

Drosophila melanogaster, the common fruit fly, has 4 chromosomes in each of its gametes. How many chromosomes are in each somatic cell?

8

Which binding site on the ribosome does the recruited tRNA bind to first? - A - P - E

A

The anticodon of a particular tRNA molecule is A. complementary to the corresponding mRNA codon. B. complementary to the corresponding triplet in rRNA. C. the part of tRNA that bonds to a specific amino acid. D. catalytic, making the tRNA a ribozyme.

A. complementary to the corresponding mRNA codon.

Histone acetylation ________ transcription; whereas DNA methylation _________ transcription. A. promotes; reduces B. None of the options C. slows down; speeds up D. reduces; promotes

A. promotes; reduces

The process of converting DNA to RNA is called

Transcription

Proteins are polymers of what type of molecule? - Carbohydrates - Nucleic acids - Sugars - Amino acids

Amino Acids

Which of these could lead to conversion of a proto-oncogene into an oncogene? A. Amplification of a proto-oncogene through gene duplication. B. Translocation of proto-oncogenes near an active promoter. C. All of these D. A point mutation in proto-oncogene or its regulatory elements

C. All of these

A pre-mRNA 5000 nucleotides long makes a protein consisting of approximately 500 amino acids. This result is best explained by which of the following? A. The RNA polymerase enzyme breaks off and re-attaches to the DNA strand at intervals. B. There is redundancy in the genetic code. C. Several stretches of termination sequences occur within pre-mRNA. D. Introns are present in the pre-mRNA and are spliced out during pre-mRNA processing. E. Ribosomes repeatedly pause and reinitiate translation after skipping several nucleotides.

D. Introns are present in the pre-mRNA and are spliced out during pre-mRNA processing.

Different types of cells in your body look and function differently. The basis for these differences is Different types of DNA in each cell Different amounts of DNA in each cell Different numbers of chromosomes Different patterns of gene expression

Different patterns of gene expression

A primary function of DNA in somatic cells is - Converting glucose to pyruvate - Encoding mRNAs and subsequently proteins - DNA has no function in somatic cells - Synthesizing membrane phospholipids

Encoding mRNAs and subsequently proteins

Which of the following statements best describes the effect a nonsense mutation would have on a gene? - It renders the gene completely useless/ineffective. - It introduces a premature stop codon into the mRNA. - It alters the reading frame of the mRNA. - It changes an amino acid in the encoded protein. - It has no effect on the amino acid sequence of the encoded protein.

It introduces a premature stop codon into the mRNA

Why can certain types of viruses promote cancer in humans especially? - The medicine used to treat the virus is what causes most cancers. - The virus can mutate an oncogene into a proto-oncogene. - The body overcompensates for damaged organs and mass produces cells. - The viruses cause silent mutations in the host's genome. - They insert their DNA into the host genome and can cause massive damage.

They insert their DNA into the host genome and can cause massive damage.

Which of the following is an example of post- transcriptional control of gene expression? - alternative splicing of exons - mRNA degradation - protein processing and degradation - all of the options

all of the options

Arrange the events taking place during transcription in order: i) The pre-RNA undergoes processing ii) RNA polymerase moves downstream, unwinding the DNA iii) RNA polymerase binds to the promoter iv) RNA transcript is released and polymerase detaches from the DNA v) Polymerase initiates RNA synthesis at the start point on the template strand

iii, v, ii, iv, i

The first stage of translation and transcription is - initiation - elongation - termination

initiation

Given below is a list of events taking place during translation. Arrange these in proper sequence. i) The anticodon of tRNA base pairs with the mRNA codon at the A site ii) Peptide bond formation between amino group of amino acid in A site and the carboxyl end of the polypeptide in the P site iii) Translocation of tRNA from the A site to the P site iv) A small ribosomal subunit binds with mRNA

iv, i, ii, iii

Below is a fully processed mRNA transcript. What will be the amino acid sequence produced by translation of this message? 5'GCCGCAACAUGUCUUCGUUAUCCUAGGGGUAAUAAACCCGUAUAAAAAAAAAAA 3' met-glu-arg-arg-glu-leu met-ser-leu-ser-leu-ser ser-ala-thr-cys-leu-arg-tyr-pro-arg-gly-asn-lys-pro-val met-arg-glu-arg-glu-arg met-ser-ser-leu-ser

met-ser-ser-leu-ser

A point mutation that changes a codon for an amino acid to a stop codon is called: A. Stop mutation B. Missense mutation C. Nonsense mutation D. Frameshift mutation

nonsense mutation

The purpose of a spliceosome is to: - add a 3' cap to mRNA - remove introns and bring together exons in an mRNA molecule - link Okazaki fragments together on the lagging strand - remove mRNA from the nucleus - add a poly A tail to mRNA

remove introns and bring together exons in an mRNA molecule