Biology 111 Problem Set 1-12

5'-CCUGA-3'

(P9/12) Below is a piece of double stranded DNA. If RNA polymerase is moving from left to right (direction of the arrow), what is the product? -5'-CCUGA-3' -3'-GGACU-5' -3'-CCUGA-5' -None of the above -5'-GGACU-3'

phosphorylation, transferring a phosphate to other molecules

ATP drives endergonic reactions by the process of _________, which is the _________________. -phosphorylation, transferring a phosphate to other molecules -hydrolysis, the breaking of a chemical bond by the addition of a water molecule -dehydration synthesis, the joining of two molecules by the removal of a water -dephosphorylation, the removing a phosphate group from an organic compound

false

According to most scientists today, viruses are technically defined as living. (T/F)

is composed of a fluid bilayer of phospholipids with embedded amphipathic proteins

According to the fluid mosaic model, a membrane ________. -is composed of a fluid bilayer of phospholipids with embedded amphipathic proteins -is composed of a fluid bilayer of phospholipids between two layers of hydrophilic proteins -is composed of a single layer of fluid phospholipids between two layers of hydrophilic proteins -is composed of a mosaic of fluid polysaccharides and amphipathic proteins

The entropy of the universe increases with any energy change that occurs.

According to the second law of thermodynamics: -The free energy of the universe decreases with any energy change that occurs. -The entropy of the universe increases with any energy change that occurs. -The free energy of the universe increases with any energy change that occurs. -The entropy of the universe decreases with any energy change that occurs.

activated because the histones bind less tightly to the DNA than unacetylated histones.

Acetylation of histones in the vicinity of a gene causes the gene to be -activated because the histones bind less tightly to the DNA than unacetylated histones. -silenced because the histones bind less tightly to the DNA than unacetylated histones. -activated because the histones bind more tightly to the DNA than unacetylated histones. -silenced because the histones bind more tightly to the DNA than unacetylated histones.

96

After 5 cycles of PCR, there are 3 million copies of a 100 bp DNA fragment. How many copies would be present after 10 cycles? ______ million

Anaphase I

After a certain meiotic division 4 gametes were obtained with the following number of chromosomes: 22, 22, 24, 24. In which stage of the cell cycle did an error take place? -Metaphase II -Anaphase II -Anaphase I -Telophase I

true

Among different species, genomes vary in size, number of genes, and gene density. (T/F)

25.5 g

An aqueous 2 M solution of hydrochloric acid is prepared with a total volume of 0.350 L (350 ml). The molecular weight of hydrochloric acid is 36.46 g/mol. How much hydrochloric acid (in grams) is needed for the solution? -72.9 g -34.5 g -25.5 g -12.8 g

be chemically inert.

An atom with 8 electrons in its outer shell tends to -bond to itself. -be a cation in aqueous solution. -bond to hydrogen in aqueous solution. -be an anion in aqueous solution. -be chemically inert.

iii, v, ii, iv, i

Arrange the events taking place during transcription in order: i) The pre-RNA undergoes processing ii) RNA polymerase moves downstream, unwinding the DNA iii) RNA polymerase binds to the promoter iv) RNA transcript is released and polymerase detaches from the DNA v) Polymerase initiates RNA synthesis at the start point on the template strand -iv, iii, ii, i, v -iii, v, ii, iv, i -i, iii, v, ii, iv -v, ii, i, iii, iv

Ca2+ < glucose < H2O < N2

Arrange the following molecules according to increasing rate of diffusion across a lipid bilayer without the aid of any membrane protein: glucose, Ca2+ N2, H2O. -H2O < N2 < Ca2+ < glucose -N2 < H2O < glucose < Ca2+ -glucose < Ca2+ < N2 < H2O -Ca2+ < glucose < H2O < N2

It is used to establish and maintain a proton gradient for the generation of ATP.

As electrons pass through the system of electron carriers associated with photosystem II, they lose energy. What happens to this energy? -It excites electrons of the reaction center of photosystem I. -It is lost as heat. -It is used to establish and maintain a proton gradient for the generation of ATP. -It is used for phosphorylation of NAD+ to NADPH, while NADPH accepts electrons from the photosystem I.

Lettuce cells are hypertonic to fresh water making them turgid and fresh-looking, but hypotonic to the salt solution, hence plasmolyzed.

As you were taking lettuce in the grocery store, you were surprised when water sprinklers suddenly went on, spraying fresh water on the produce. When you got back home, you immersed the lettuce in a salt solution, and within several minutes they became limp and soft. What are the explanations for the spraying procedure in the store, and your observation at home? -Lettuce cells are isotonic to freshwater making them turgid and fresh-looking, but hypertonic to the salt solution, hence plasmolyzed. -Lettuce cells are hypertonic to freshwater making them turgid and fresh-looking, but hypotonic to the salt solution, hence plasmolyzed. -Lettuce cells are isotonic to freshwater making them turgid and fresh-looking, but hypotonic to the salt solution, hence plasmolyzed. -Lettuce cells are hypotonic to freshwater making them turgid and fresh-looking, but hypertonic to the salt solution, hence plasmolyzed.

mostly photosynthesis

At midday (noon), what is happening in the leaf of a plant? -Mostly photosynthesis -Mostly respiration -Both photosynthesis and respiration -Neither, this is the time most plants are dormant -Mostly the Calvin cycle

mostly respiration

At midnight, what is happening in the leaf of a plant? -Mostly photosynthesis -Mostly respiration -Both photosynthesis and respiration -Neither, this is the time most plants are dormant -Mostly the Calvin cycle

<100

Based on your understanding of biological macromolecules, the number of unique monomer molecules that is common to living organisms is closest to which number? -10,000 ->100000 -1,000 -<100

met-ser-ser-leu-ser

Below is a fully processed mRNA transcript. What will be the amino acid sequence produced by translation of this message?5' GCCGCAACAUGUCUUCGUUAUCCUAGGGGUAAUAAACCCGUAUAAAAAAAAAAA 3' -met-glu-arg-arg-glu-leu -met-ser-leu-ser-leu-ser -met-ser-ser-leu-ser -ser-ala-thr-cys-leu-arg-tyr-pro-arg-gly-asn-lys-pro-val -met-arg-glu-arg-glu-arg

using DNA technology to combine DNA from different organisms in a test tube.

Bioinformatics includes all of the following except: -developing computer-based tools for genome analysis and study. -using DNA technology to combine DNA from different organisms in a test tube. -using mathematical tools to make sense of biological systems. -using computer software to align DNA sequences.

Buffers, H+ ions, H+ ions

Biological fluids regulate pH values using __________. This is achieved by accepting _________ when pH is low and donating _________ when pH is high. -Buffers, OH- ions, H+ ions -Bases, H+ ions, OH- ions -Acids, OH- ions, H+ ions -Buffers, H+ ions, H+ ions -None of the above

The increased temperature denatures the proteins in the egg.

Biologically speaking, what is going on in the picture above? -The increased temperature denatures the proteins in the egg. -Exposure to oxygen decreases the pH of the proteins in the egg. -This is an example of competitive inhibition. -The increased temperature lowers the activation energy needed to cook the egg. -This is an example of allosteric regulation.

hydrogen bonds

Both alpha- and beta-hemoglobin chains have mostly alpha-helices, and no beta-sheets. What forces or bonds are responsible for formation and stabilization of alpha-helices? -hydrophobic interactions -ionic bonds -Van der Waals interactions -hydrogen bonds -covalent disulfide bonds

In cellular respiration, the electron source originates in energy rich food; in photosynthesis the electron source is water.

Both cellular respiration and photosynthesis rely on electron transport chains embedded in membranes to produce ATP molecules. Which of the following correctly describes the difference between the two types of electron transport chains? -In cellular respiration, the electron source is water; in photosynthesis the electron source is CO2. -In cellular respiration, the electron source originates in energy rich food; in photosynthesis the electron source is water. -In cellular respiration, the final electron acceptor is CO2; in photosynthesis, the final electron acceptor is NADPH. -Both b. and c.

which pigments are involved in the light reactions

By matching the absorption spectrum of pigments in chloroplasts with the action spectrum of photosynthesis, it is possible to determine __________. -Whether oxygen is released from water or carbon dioxide -Which pigments are involved in the light reactions -The efficiency of energy transfer -The free energy of light absorption -All of the above are true.

More acid

CO2 + H2O <> H2CO3 <> (H^+) + HCO3- If heavy exercise produces lots of CO2 in the body, will the blood become more acid or more basic? -Neither -More acid -Can't determine -More basic

No, the light reactions require products of the Calvin cycle to produce ATP and NADPH

Can the light reactions of photosynthesis continue on indefinitely without the Calvin cycle? -Yes, the light reactions can produce ATP and NADPH without inputs from the Calvin cycle -No, the light reactions require products of the Calvin cycle to produce ATP and NADPH

1/1000

Carbon-14 decays to nitrogen-14 with a half-life of approximately 5700 years. After 57,000 years, approximately what fraction of the initial carbon-14 would be left in an organic sample? -1/1000 -1/2 -1/10 -1/20 -1/100

chemical energy stored in newly synthesized sugars

Cells in a plant root are non-photosynthetic, but they still depend on the light energy harvested during photosynthesis in leaves. In what form is the light energy transferred to the root cells? -chemical energy stored in newly synthesized sugars -chemical energy stored in newly synthesized ATP -electrons from the oxidation of CO2 -electrons from the oxidation of water

A mechanism for evolution that was supported by evidence.

Charles Darwin was the first person to propose which of the following? -A mechanism for evolution that was supported by evidence. -That Earth is MUCH older than a few thousand years. -That evolution occurs. -That cells contain the hereditary information in the form of DNA.

rich in actively expressed genes and comprised of loosely packed nucleosomes.

Compared to heterochromatin, euchromatin is -rich in actively expressed genes and comprised of densely packed nucleosomes. -poor in actively expressed genes and comprised of densely packed nucleosomes. -rich in actively expressed genes and comprised of loosely packed nucleosomes. -poor in actively expressed genes and comprised of loosely packed nucleosomes. -rich in poorly expressed genes and completely lacking nucleosomes.

Basic

Compared to human blood is seawater acid or basic? -Acidic -Neither (neutral) -Cannot determine from this diagram -Basic

the site that the inhibitor binds to the enzyme.

Competitive inhibition differs from non-competitive inhibition by: -the inhibitor concentration required to reduce enzyme activity. -the site that the inhibitor binds to the substrate. -the size of the inhibitor that can fit into the active site. -the site that the inhibitor binds to the enzyme.

There is not carbon remaining to form the byproduct CO2 in lactic acid fermentation

Consider the images. Why is CO2 produced as a product in alcoholic fermentation, but not in lactic acid fermentation? (HINT: count the carbons!) -There is not carbon remaining to form the byproduct CO2 in lactic acid fermentation -The lactate consumes the CO2 in lactic acid fermentation -The NADH consumes the CO2 in lactic acid fermentation -Glycolysis prevents CO2 formation in lactic acid fermentation

increase, then eventually decrease as base continues to be added.

Consider the reaction profile for three enzymes, A, B and C. A solution with enzyme B and its substrate is kept at pH 4. If a weak base is gradually added to it, the activity of enzyme B will most likely: -decrease continuously as base is added. -decrease, then increase as base continues to be added. -increase continuously as base is added. -increase, then eventually decrease as base continues to be added.

False, minimal amounts of DNA are needed for PCR.

Consider the statement "large amounts of DNA are required to perform PCR". -False, minimal amounts of DNA are needed for PCR. -There are no requirements for the amount of DNA in PCR. -True, large amounts of DNA are needed to ensure successful amplification.

24%

Cytosine makes up 24% of the nucleotides in a sample of DNA from an organism. Approximately what percentage of the nucleotides in this sample will be guanine? -52% -26% -12% -48% -24%

miss scarlet and mrs white

DNA isolated from blood found at a crime scene was amplified by PCR then separated by gel electrophoresis. The same procedure was done with DNA isolated from several suspects. Which of these suspects are most likely to be involved in the crime? -Miss Scarlett and Mrs. White -Professor Plum and Mrs. White -Mrs. Peacock and Miss Scarlett -Mrs. White and Mrs. Peacock

Each new double helix consists of one old and one new strand.

DNA replication is said to be semiconservative. What does this mean? -One strand of the new double helix is made of DNA and the other strand is made of RNA. -Each new double helix consists of one old and one new strand. -One of the two resulting double helices is made of two old strands, and the other is made of two new strands. -The old double helix is degraded and half of its nucleotides are used in the construction of two new double helices. -Half of the old strand is degraded and half is used as a template for the replication of a new strand.

Each new double-stranded DNA helix contains one completely old strand and one completely new strand.

DNA replication is semiconservative in nature because -Each new double-stranded DNA helix contains one completely old strand and one completely new strand. -Half of a newly synthesized DNA molecules comes from one parent and the other half from the other parent. -Each strand of both daughter molecules contain a mixture of old and newly synthesized DNA. -The two parental strands reassociate after acting as templates for new strands, restoring parental double helix.

Different patterns of gene expression

Different types of cells in your body look and function differently. The basis for these differences is -Different types of DNA in each cell -Different amounts of DNA in each cell -Different patterns of gene expression -Different numbers of chromosomes

8

Drosophila melanogaster, the common fruit fly, has 4 chromosomes in each of its gametes. How many chromosomes are in each somatic cell? (enter number below)

All 6 carbons are completely oxidized to CO2.

During cellular respiration, what happens to the 6 carbons in glucose? -3 carbons are oxidized to CO2 and 3 carbons are reduced to CO2. -All 6 carbons are reduced to CO2. -All 6 carbons are completely oxidized to CO2. -All 6 carbons are used in the synthesis of ATP.

water

During photosynthesis, O2 is liberated. What is the source of this O2? -the atmosphere -simple sugars -complex sugars -water -CO2 -ATP

in all cells all the time

Even though plants carry on photosynthesis, plant cells still use their mitochondria for breaking down carbohydrates. When and where will this occur? -in photosynthetic cells in the light, while photosynthesis occurs concurrently -in nonphotosynthesizing cells only -in cells that are storing glucose only -in all cells all the time -in photosynthesizing cells in the light and in other tissues in the dark

Glycolysis

Fermentation relies on which of the following stage(s) of cellular respiration? -Electron transport chain -Glycolysis -Krebs' Cycle -Glycolysis and Krebs' Cycle -Glycolysis and Electron transport chain

Spontaneous

Free energy decreases and the stability of a system increases during which types of reactions? -Spontaneous -Nonspontaneous -Never -Endergonic

BDCA

Genes A, B , C and D are present on the same chromosome. The recombination frequency between the genes is as follows: A and B: 24%, A and D: 16%, B and C: 18%, C and D: 10%. What is the correct order of genes along the chromosome? -CBAD -ACBD -BCDA -ABCD -BDCA

iv, i, ii, iii

Given below is a list of events taking place during translation. Arrange these in proper sequence. i) The anticodon of tRNA base pairs with the mRNA codon at the A site ii) Peptide bond formation between amino group of amino acid in A site and the carboxyl end of the polypeptide in the P site iii) Translocation of tRNA from the A site to the P site iv) A small ribosomal subunit binds with mRNA -ii, i, iv, iii -iv, i, iii, ii -i, ii, iv, iii -iv, i, ii, iii

11

Given below is the DNA sequence of a short protein: AUGACGCUAGCCGCAGCGAGCCACCUAGGAGGAUGA How many amino acids will the protein translated from this sequence have? -9 -11 -12 -10

None of these

Given that a virus divides every 10 minutes, and that a cell lyses (explodes) after it reaches a viral load of 500,000 units, how long will it take a virus starting at 250 units to lyse the cell? -~220 minutes -None of these -~75 minutes -~11 hours -~440 minutes

promotes; reduces

Histone acetylation ________ transcription; whereas DNA methylation _________ transcription. -reduces; promotes -promotes; reduces -slows down; speeds up -None of the options

Divide your current points earned by the total number of points that have been assigned and graded.

How can you calculate your grade at any point in the semester?

4

How many covalent bonds can a Carbon atom form? -6 -4 -2 -0 -8

64

How many different types of gametes can be produced by a plant with genotype AaBbCcDdEeFf? -32 -16 -8 -64

2.9 g

How much NaCl would you need to make a 0.100 L (100 ml) of a 0.5 molar solution? NaCl has a molecular weight of 58.44 g. -58.4 g -2.9 g -5.84 g -29 g

Log into the TAMU Google Drive with your TAMU credentials.

How should you access the Google Drive to review* lectures that have been recorded?*Remember, these lectures are recorded for any technical issues we may have. They are NOT recorded for students to use to "take" the course. This means that you will not be able to binge-watch these lectures and succeed in the course. -Log into Google Drive with your Google credentials. -Log into the TAMU Google Drive with your TAMU credentials. -Log into the TAMU Google Drive with any Google credentials. -Log into Google Drive with your TAMU Google credentials.

The individual's ATP production will not change significantly.

How will a healthy individual's ATP production change during an eight-hour fast? -The individual's ATP production will increase significantly. -The individual's ATP production will decrease significantly. -The individual's ATP production will not change significantly.

alternative splicing of exons

Humans contain about 20,000 genes but can make 75,000- 100,000 different proteins. The most likely explanation for this is: -Exon shuffling -Alternative splicing of exons -Redundancy of the genetic code -All of them contribute

conversion of glucose to starch

Hydrolysis is involved in each of the following EXCEPT -conversion of glycogen to glucose -conversion of glucose to starch -conversion of DNA to a mixture of -four deoxynucleotides -conversion of triacylglycerol to a mixture of fatty acids and glycerol

control groups

Hypothesis based science requires: -ignoring experimental evidence that does not fit with the original hypothesis -that the hypothesis be correct -control groups -being able to test and prove your hypothesis

Either the tattoo or the missing toe.

If LaMarck was correct in his idea about the inheritance of acquired traits, which of the following would you be able to pass along to your offspring? -A tattoo you got on your 30th birthday. -Your natural blue eye color. -Your missing big toe after you lost it in an unfortunate corn hole accident. -Either the tattoo or the missing toe.

3

If an atom has 5 electrons in its outer shell, how many of these electrons are unpaired? -1 -2 -8 -3 -None of these -5

In the plasma membrane

If prokaryotes do not have mitochondria, then where are the enzymes for cellular respiration located? -Nuclear membrane -An enzyme complex in the cytoplasm -Somewhere within the cytoskeleton -In the plasma membrane -Prokaryotes do not perform cellular respiration

10^-11

If the H+ ion concentration of a household item is 10-3, how many OH- ions does it have? -10^-14 -10^-3 -10^-13 -10^-11

Adenine= 24%, thymine= 24%, cytosine=26%

If the percentage of guanine in E.coli is 26%, then the percentage of other nitrogenous bases would be: -Adenine=26%, Thymine=24%, Cytosine=26% -Adenine=26%, Thymine=24%, Cytosine=24% -Adenine=24%, Thymine=24%, Cytosine=26% -Adenine=48%, Thymine=48%, Cytosine=26%

15 minutes

If transcription progresses at the rate of 40 nucleotides per second, how long it would take to transcribe a sequence that is 3.6 X 104 bases long? -11 minutes -110 seconds -90 seconds -15 minutes

Normal: affected = 3:1

If two people with the sickle-cell trait have offspring, what would be the predicted ratio of phenotypically "normal" to affected (sickle-cell disease) offspring? -Normal: affected = 2:1 -Normal: affected = 3:1 -Normal: affected = 1:3 -Normal: affected = 1:1

No. No you cannot do this. Please do not do this. This is considered academic dishonesty and we have no choice but to report you to the honor's council.This is the answer. This is the only answer, because we ALL need to understand this. This literally happens every semester and it's not fun for anyone. Please do not do this.

If you are retaking this course, you can resubmit your lab assignments for credit with no penalty.

Your actual TA

If you have questions regarding a lab assignment or experiment, who should you contact first? -Your lab partner. -Your lecturer. -Your friends/roommate's TA. -Your actual TA.

have turned off or slowed down the process of transcription.

If you were to observe the activity of methylated DNA, you would expect it to -be replicating nearly continuously. -be very actively transcribed and translated. have turned off or slowed down the process of transcription. -induce protein synthesis by not allowing repressors to bind to it. -be unwinding in preparation for protein synthesis.

She is heterozygous for red eyes.

In Drosophila, red-eye color is dominant over white-eye color. A female Drosophila with red eyes and unknown genotype was crossed to a male with red eyes. Half of the male progeny have red eyes. The following may be true about the female with unknown genotype. -She is hemizygous for red eyes. -She is homozygous for red eyes. -She is heterozygous for red eyes. -None of these

the inner mitochondrial membrane.

In a eukaryotic cell, electron transport takes place within: -the inner mitochondrial membrane. -the outer mitochondrial membrane. -the plasma membrane. -the cytosplasm. -the mitochondrial matrix.

None

In a genetic cross between AaBbCcDdEe and Aabbccddee what fraction of the offspring will be homozygous for all dominant alleles? -1/128 -1/64 -None -1/32

8

In a genetic cross between a heterozygous tall plant with homozygous purple flowers and a homozygous short plant with heterozygous purple flowers, how many short plants will you expect in the F2 generation if you sample 16 individuals? Both tall and purple flowers are completely dominant to their respective alternative traits.

mutation

In an asexually reproducing organism it is expected that the offspring will be genetically identical to the parent. However, in one particular event of asexual reproduction the offspring was found to be differing from the parent. The reason behind this could be __________________. -mutation -cross over of sister chromatids -crossing over of non-sister chromatids -independent assortment of alleles

large; small

In gel electrophoresis of DNA, __________ fragments migrate slower than __________ fragments. -bacterial chromosome; eukaryotic chromosome -large; small -broken; intact -small; large

Mixing a heat-killed pathogenic strain of bacteria with a living nonpathogenic strain can convert some of the living cells into the pathogenic form.

In his transformation experiments, what phenomenon did Griffith observe? -No matter the strain of bacteria injected the mice died from pneumonia. -Mice infected with a pathogenic strain of bacteria can spread the infection to other mice. -Infecting mice with nonpathogenic strains of bacteria makes them resistant to pathogenic strains. -Mixing a heat-killed pathogenic strain of bacteria with a living nonpathogenic strain can convert some of the living cells into the pathogenic form. -Mixing a heat-killed nonpathogenic strain of bacteria with a living pathogenic strain makes the pathogenic strain nonpathogenic.

Mixing a heat-killed pathogenic strain of bacteria with a living nonpathogenic strain can convert some of the living cells into the pathogenic form.

In his transformation experiments, what phenomenon did Griffith observe? -No matter the strain of bacteria injected the mice died from pneumonia. -Mixing a heat-killed nonpathogenic strain of bacteria with a living pathogenic strain makes the pathogenic strain nonpathogenic. -Infecting mice with nonpathogenic strains of bacteria makes them resistant to pathogenic strains. -Mixing a heat-killed pathogenic strain of bacteria with a living nonpathogenic strain can convert some of the living cells into the pathogenic form. -Mice infected with a pathogenic strain of bacteria can spread the infection to other mice.

It increases the surface area for oxidative phosphorylation.

In liver cells, the inner mitochondrial membranes (cristae) are about five times the area of the outer mitochondrial membranes. What does this folding cause? -It allows for an increased rate of glycolysis. -It increases the surface area for oxidative phosphorylation. -It causes a decreased rate for glycolysis as more distance has to be covered. -It increases the surface area for substrate-level phosphorylation. -It allows for an increased rate of the citric acid cycle.

Two species in the same family must be in the same taxonomic "Order".

In taxonomy, what is true about the hierarchal rank of "family"? -Two species in the same family must be in the same taxonomic "Order". -One species can belong to more than one family (but no more than 3 families). -Members of the same taxonomic family can have some species with a nucleus and some without. -Two species in the same family must be in the same taxonomic "Genus". -A family will usually include far fewer taxa (plural of taxon) than a genus.

the G 1 phase of interphase

In the cell cycle, most of the growth in volume and contents of the cell occurs during __________. -the S phase of interphase -the G1 phase of interphase -the G2 phase of interphase -the mitotic phase -the G0 phase of interphase

one substrate gains electrons while the other substrate loses electrons.

In the generic redox reaction: A + B → C + D, -a single substrate gains electrons. -both substrates gain electrons and both products lose electrons. -both substrates and both products gain electrons. -both substrates and both products lose electrons. -one substrate gains electrons while the other substrate loses electrons. -a single substrate loses electrons.

citric acid cycle

In the image, what phase of cell respiration is occurring at #2? -glycolysis -citric acid cycle -electron transport chain -Chemiosmosis -photosynthesis

annealing

In which stage of polymerase chain reaction (PCR) are the specific primers added to the DNA strands? -Denaturation -Annealing -Elongation -Termination

Yes, you can participate in in-class Learning Catalytics (LC) sessions.

Is there any opportunities to "bump" up your overall course grade?

1) C 2) A 3) B

Match the following conditions to the most stable arrangement that they will assume. 1)Amphipathic molecules vigorously mixed with vegetable oil 2)Amphipathic molecules surrounding an oil droplet in the cells of plant seeds 3)Amphipathic molecules at air-water interface

1) A.Prophase I 2) B.Anaphase I 3) C.Crossing over 4) D.Anaphase II

Match the following events with the appropriate stage/ process of cell division: 1) Centrosome movement 2) Homologous chromosomes separate 3) DNA exchange 4) Chromatids separate A.Prophase I B.Anaphase I C.Crossing over D.Anaphase II E.Prophase II F.Telophase I

A- DNA replication (S-phase) B- Telophase I C- Telophase II

Match the following letters with the events of cell cycle. -Telophase II -Mitosis -DNA replication (S-phase) -Telophase I -Cytokinesis

A. Lysosome B. Nucleus C. Mitochondriaria D. Peroxisome E. Vacuole F. Golgi Apparatus

Match the organelles to their respective functions. -Peroxisome -Nucleus -Mitochondria -Golgi Apparatus -Lysosome -Vacuole A. breakdown of ingested macromolecules and other substances B. physically separate the DNA from most metabolic processes C. convert energy to forms that cells can use for work D. metabolic compartment enclosed by a single membrane E. storage and waste disposal F. protein, glycoprotein and phospholipid modification

Genomic imprinting

Mating between a tiger and a lion can produce two types of offspring. A mating event between a male tiger and female lion produces a tigon, which is often smaller than either parent. A mating event between a male lion and a female tiger produces a liger, which is much larger than either parent. This is an example of: -Sex-linked inheritance -Inheritance of organellar genes -Genomic imprinting -Co-dominance

Both monohybrid and dihybrid crosses

Mendel's law of segregation applies to: -Both monohybrid and dihybrid crosses -Monohybrid crosses only -Dihybrid crosses only -Both monohybrid and dihybrid crosses, but not higher order crosses (i.e. trihybrid, tetrahybrid).

Sexual reproduction

Mendel's laws of inheritance are valid for -Both sexual and asexual reproduction -Sexual reproduction -Vegetative reproduction -Asexual reproduction -All forms of reproduction

Only in eukaryotes

Mitochondria are found -Only in animal cells -In all cells -Only in prokaryotes -Only in eukaryotes

Stomach

Most of the enzymes in our bodies function at or very close to neutral (pH ~ 7.0). There are a few exceptions. Which area of your body should be an exception to this "rule"? -Brain -Heart/Blood -Stomach -Skin

air

Most of the organic material in plants comes from: -soil/dirt -air -sunlight -water

oxidized; reduced

NAD+ is the ______ form of NADH while NADH is the _____ form of NAD+. -cation; anion -oxidized; reduced -product; substrate -reduced; oxidized -substrate; product

differential reproductive success of different phenotypes

Natural selection is: -a product of the genotype and environmental factors -differential reproductive success of different phenotypes -the natural "force" causing random changes in the gene pool -change over time -the ability to survive and leave offspring

Proteins

Nearly all enzymes are what kind of biomolecule? -Proteins -Carbs -Lipids -Nucleic Acids -Polymers

Golgi apparatus, vacuole, endoplasmic r

Of the following cell components, which group comprises the endomembrane system? -Lysosome, vacuole, peroxisomes -Golgi apparatus, vacuole, endoplasmic reticulum -Nuclear membrane, nucleolus, Golgi apparatus -Peroxisomes, mitochondria, endoplasmic reticulum

active transport

On the basis of energy requirement, which does NOT belong to the group? -passive transport -active transport -facilitated diffusion -osmosis

ATP synthesis is decreased.

One can measure ATP production from isolated mitochondria in vitro (in a test tube). Changing the pH of the solution that the mitochondria are in results in a similar change the pH of the intemembrane space. If the pH of the solution that the isolated mitochondria are in is raised and everything else remains constant, what is the effect on ATP synthesis? -ATP synthesis is decreased. -ATP synthesis is increased. -ATP synthesis is unchanged.

ATP synthesis is decreased.

One can measure ATP production from isolated mitochondria in vitro (in a test tube). Changing the pH of the solution that the mitochondria are in results in a similar change the pH of the intermembrane space. If the pH of the solution that the isolated mitochondria are in is raised and everything else remains constant, what is the effect on ATP synthesis? -ATP synthesis is increased. -ATP synthesis is decreased. -ATP synthesis is unchanged.

50%

Phoebe's mother is red-green colorblind and her father is not. What is the probability that Phoebe's son is red-green colorblind? Colorblindness is almost always inherited as a recessive X-linked trait. -75% -50% -25% -0%

2 weeks

Phosphorus-32 undergoes radioactive decay at a constant rate. Estimate its half-life from the graph below showing its radioactivity measured over time. -3 weeks -6 weeks -4 weeks -1 week -2 weeks -None of these

0%

Pollen from a pea plant with a mutation in the mitochondrial DNA is used to fertilize a pea plant that has no mutation. What percentage of progeny in the F2 generation is expected to have the mutation? -Depends on zygosity of parents -75% -Information is insufficient to answer the question. -25% -0%

amino acids

Proteins are polymers of what type of molecule? -Amino acids -Nucleic acids -Carbohydrates -Sugars

is the overall shape of two or more polypeptide chains that associate to form one functional macromolecule.

Quaternary structure -is only possible for identical polypeptide subunits. -is the overall shape of two or more polypeptide chains that associate to form one functional macromolecule -is observed for proteins such as α-keratin. -is a protein's overall size

2

Refer to the phylogenetic tree above to answer this question. The most recent common ancestor of the minke whale and the sheep is at branchpoint 4 3 5 1 2

Most of the active sites of the enzyme are occupied by the substrate.

Refer to the plot showing the rate of an enzyme-catalyzed reaction as a function of substrate concentration. Why is the curve starting to level off? -Most of the cells start to die as substrate concentration increases. -Most of the active sites of the enzyme are occupied by the substrate. -Reaction product competes with the substrate for enzyme interaction. -Too much substrate distorts the structure of the enzyme, making the enzyme inactive.

32

Saccharomyces cerevisiae, the yeast used to make bread and beer, has 16 chromosomes. How many chromatids are in a cell in G2?(enter number below)

It is similar to cellulose except for the group shown by the arrow in the chitin monomer structure.

Shown below is a structure of the chitin monomer. Which of the following is TRUE regarding chitin? -The chitin monomer is in the "a" configuration. -It is similar to cellulose except for the group shown by the arrow in the chitin monomer structure. -Chitin is a structural polysaccharide not only in animals, but also in plants. -Fungi are the only organisms that do not make use of chitin.

the growth or height of the plants

Suppose you wanted to test the effect of fertilizer on the growth of tomato plants. What is the dependent variable? -The growth, or height, of the plants. -The amount of time that the plant was allowed to grow. -The type of fertilizer used. -The presence or absence of fertilizer. -The amount of water applied to each plant.

Taxol prevents spindle formation and separation of chromatids.

Taxol is a drug that comes from the bark of a tree that binds and irreversibly stabilizes microtubules. It is often used during chemotherapy to kill dividing cancer cells. How does taxol block cell division? -Taxol prevents the contractile ring from forming and dividing the cell in two. -Taxol prevents DNA replication. -Taxol prevents spindle formation and separation of chromatids. -Taxol prevents chromosome condensation during prophase.

binding incoming charged tRNAs (A), retention of the growing peptide (P), exit for uncharged tRNAs (E)

The A site, P site, and E sites each control ________________ during translation. -binding incoming charged tRNAs (A), retention of the growing peptide (P), exit for uncharged tRNAs (E) -activation of tRNAs (A), release of the protein product (P), exit of empty rRNAs (E) -activation of ribosome activity (A), processing of amino acids (P), elongation of the peptide chain (E) -amino acid bond transfer (A), protein processing (P) and elongation of the peptide chain (E)

tumor suppressor gene

The BRCA-1 genes in humans encode proteins that have role in maintaining DNA stability. Mutation in this gene results in formation of non-functional protein, which is not able to repair damaged DNA, resulting in a significantly increased risk of breast cancer. BRCA-1 is a/an: -Tumor suppressor gene -Proto-oncogene -Homeotic gene -Oncogene

C (stroma)

The Calvin cycle take place in this location: -A. -B. -C. -the entire membrane enclosed space shown.

complementary to the corresponding mRNA codon.

The anticodon of a particular tRNA molecule is: -complementary to the corresponding mRNA codon. -complementary to the corresponding triplet in rRNA. -the part of tRNA that bonds to a specific amino acid. -catalytic, making the tRNA a ribozyme.

differences in genome sequences.

The basis for dividing the prokaryotes into two domains is: -none of the choices -differences in the ability to survive in extreme conditions. -differences in genome sequences. -differences in metabolic properties.

0.25 or 25%

The brown-eye allele is dominant over blue-eye allele. A couple currently has 3 children with brown eyes. What is the probability that their next baby will have blue eyes if both parents are heterozygous for eye color? -0.75 or 75% -0.5 or 50% -0 -1.0 or 100% -0.25 or 25%

dehydration; covalent

The construction of macromolecules requires a series of ______________ reactions that form _____________ bonds between monomers. -dehydration; covalent -cohesive; ionic -hydrophilic; covalent -denaturation; ionic -hydrolysis; polymer

synthesized discontinuously

The dashed blue part (arrow) of the newly synthesized strand of DNA is: -Synthesized continuously -Synthesized discontinuously -Not synthesized at all -Synthesized conservatively

starch

The end product(s) of photosynthesis in plants are oxygen and _____? Don't think about the chemical equation, what ultimately happens to the CO2 in plants? -Glucose -Starch -Water -Chlorophyll -Carbon dioxide

light

The energy source for photosynthesis is: -light -CO2 -heat -ATP -glucose

evolutionary related

The fact that genetic codon is universal indicates that all living organisms are -evolutionarily related. -genetically identical. -None of these -have the same genomic sequence. -have the same anticodon sequence.

Reverse transcription

The figure above represents the central dogma of molecular biology. Which of the following is an exception to the flow of genetic information within a biological system by the central dogma? -All of them -DNA replication -Synthesis of polypeptide using information in mRNA -Reverse transcription

Only E

The figure above shows a vital biochemical pathway involving synthesis of final product E from substrate A through a series of intermediate steps. Each step requires a particular enzyme, which is encoded by a specific gene. Suppose there is a mutation in gene D so that an individual no longer produces a functional version of enzyme D. For survival, this individual requires dietary supplement of: -A and E -A and D -Only E -A, B, C, D -Only A

meiosis

The figure diagrams one of the genetic crosses that helped Mendel form his theories of inheritance. Which process distributes P alleles to approximately one half of the F1 gametes and the p allele to the other half? -independent -assortment -mitosis -meiosis

active transport

The figure shown above depicts the movement of a substance across a cell membrane. The best way to describe what is occuring in the figure would be -active transport -facilitated diffusion -facilitated endocytosis -endocytosis -osmosis

The H2O level is higher in side A than side B, and both sides are red in color.

The figure shows a U-shaped glass tube with a selectively permeable membrane separating two sugar solutions with red dye added to side B of the tube. Water and dye molecules can pass through the membrane pores, but sugar molecules (black circles) cannot. Predict what will happen after the system reaches equilibrium. -The H2O level is still equal on both sides but only side A is red in color. -The H2O level is higher in side A than side B, and both sides are red in color. -The H2O level is higher in side B than side A, and both sides are red in color. -The H2O level is still equal on both sides but only side B is red in color.

Oxygen

The final electron acceptor for cellular respiration is: -FAD -NAD+ -Oxygen -ETC -ADP

initiation

The first stage of translation and transcription is __________. -Initiation -Termination -Elongation

Non-disjunction

The following type of karyotype is caused by: -Translocation -Mitotic division -Non-disjunction -Triploidy -Duplication

recessive

The frequency of a lethal allele in a population is greatest when it is: -co-dominant -manifested in infancy -dominant -recessive

one amino acid can be encoded by more than one triplet codon.

The genetic code is said to be redundant because -many amino acids are encoded by one single triplet codon. -only one triplet codon encodes one amino acid. -one triplet codon specifies more than one amino acid. -one amino acid can be encoded by more than one triplet codon.

one amino acid can be encoded by more than one triplet codon.

The genetic code is said to be redundant because -one triplet codon specifies more than one amino acid. -only one triplet codon encodes one amino acid. -one amino acid can be encoded by more than one triplet codon. -many amino acids are encoded by one single triplet codon.

nucleotides, gene, chromosome, nucleus, cell

The hierarchical nature of cellular structure is accurately illustrated in which of the following lists of substances (from smallest to largest)? -nucleotides, chromosome, gene, nucleus, cell -nucleotides, nucleus, gene, chromosome, cell -nucleotides, gene, chromosome, nucleus, cell -protein, membrane, amino acids, chloroplast, cell

B. (thylakoid discs)

The light reactions take place in this location: -A. -B. -C. -the entire membrane enclosed space shown.

ATP

The most common usable form of energy in a cell is -Glucose -ATP -Phosphate -deoxy-ATP

one million fold

The nerve cell that extends from the big toe to the base of the spine can be one meter long. A typical bacterial cell is one micrometer long. Therefore, the nerve cell is _____ longer than the bacterial cell. -one billion fold -one million fold -10^3 fold -one thousand fold -10^5 fold -None of these

half the number of chromosomes present in the somatic cells.

The number of chromosomes present in a germ cell of an organism is: -one quarter the number of chromosomes present in the somatic cells. -half the number of chromosomes present in the somatic cells. -the same of chromosomes present in somatic cells. -double the number of chromosomes present in the somatic cells.

Sodium ions out of the cell and potassium ions into the cell

The operation of the sodium potassium "pump" moves ________- -sodium ions into the cell and potassium ions out of the cell -sodium and potassium ions out of the cell -Sodium ions out of the cell and potassium ions into the cell -sodium and potassium ions into the mitochondria -sodium and potassium ions into the cell

Basic 10^-13

The pH of an item is 13. Is this acidic or basic and how many H+ ions does it have? -Acidic 10^-13 -Basic 10^-13 -Acidic 10^-1 -Basic 10^-1

a lipid bilayer

The primary barrier of biological membranes consists of -Fatty acids -A lipid monolayer -A lipid bilayer -Polysaccharides

transcription

The process of converting DNA to RNA is called _______. -Translation -Transcription -Replication

remove introns and bring together exons in an mRNA molecule

The purpose of a spliceosome is to: -remove introns and bring together exons in an mRNA molecule -remove mRNA from the nucleus -add a poly A tail to mRNA -link Okazaki fragments together on the lagging strand -add a 3' cap to mRNA

accept electrons and pass them to the electron transport chain.

The role of NAD+ in cellular respiration is to: -oxidize glucose to CO2. -accept electrons and pass them to the electron transport chain. -reduce glucose to CO2. -donate electrons and accept them from the electron transport chain.

proving the hypothesis

The scientific method has great flexibility in the order of operations. Which of these is NOT a step in the process? -proper experimental design -making an observation -proving the hypothesis -communicating the results -repeating the experiment

The red circle line was the result of yeast growing aerobically and the orange square line was from cells grown anaerobically.

The yeast Saccharomyces cerevisiae is a single cell organism that can grow and divide under either aerobic or anaerobic conditions. The rate of cell division is limited only by the cell's ability to generate the energy required to synthesize and duplicate necessary macromolecules. Using the following growth curves, which statement is correct? -The orange square line was the result of yeast growing aerobically and the red circle line was from cells grown anaerobically. -The red circle line was the result of yeast growing aerobically and the orange square line was from cells grown anaerobically. -The red circle line was the result of yeast growing aerobically and the blue triangle was from cells grown anaerobically. -The blue triangle line was the result of yeast growing aerobically and the orange square line was from cells grown anaerobically. -The orange square line was the result of yeast growing aerobically and the blue triangle line was from cells grown anaerobically.

10

The zygote of an organism has 10 pairs of homologous chromosomes. The total number of chromosomes in the germ cell of the organism is _____________. (enter numeric answer below)

They differ in the arrangement of their covalent bonds.

They differ in the arrangement of their covalent bonds. Which statement about enantiomers is FALSE? -All statements are true for enantiomers. -All enantiomer forms have the same chemical formula. -They differ in the arrangement of their covalent bonds. -Their multiple forms are mirror images. -Their placement of atoms differ by having an asymmetric carbon.

cytokinesis

This cell is in: -anaphase -interphase -prophase -metaphase -cytokinesis

metaphase

This cell is in: -interphase -big trouble -prophase -cytokinesis -metaphase

Tt and tt

Two pea plants were crossed and 93 of 200 progeny were short and the rest were tall. Tall is dominant. The most likely genotypes of the parents are: -TT and tt -TT and Tt -Tt and Tt -Tt and tt

Species A has more chances to become extinct.

Two species of organisms A and B inhabit a particular geographic location. Organism A reproduces asexually while Organism B undergoes sexual reproduction. Due to natural calamities, there have been major changes in the biogeography of the habitat. Which of the following is true? -Species A has more chances to become extinct. -Species B has more chances of becoming extinct. -Species A and B do not become extinct, as they were original inhabitants of the region. -Species A and B have equal chances of becoming extinct.

Thymine dimer formation

Ultraviolet exposure can commonly result in which of the following forms of DNA damage? -DNA base insertion -DNA base deletion -Thymine dimer formation -Mismatch pairing

Thymine dimer formation

Ultraviolet exposure can commonly result in which of the following forms of DNA damage? -Mismatch pairing -DNA base insertion -Thymine dimer formation -DNA base deletion

6

Under aerobic conditions, _____ moles of CO2 are produced for each mole of glucose oxidized. (Enter a number below.)

Green curve (right)

Use the following information to answer the question below. Which enzyme would have the most dramatic changes if placed in stomach acid? -Red curve (left) -Blue curve (middle) -Green curve (right) -No affect on any

Chlorophylls

What are the major absorbing pigments in photosynthesis? -Cholorpylls -carotenoids -PSII -absorption spectra

Denaturation, Annealing, Extension

What are the three basic steps of conventional PCR?- -Synthesis, Annealing, Extension -Strand displacement, Synthesis, Release -Denaturation, Annealing, Strand displacement -Denaturation, Annealing, Extension

lipid

What class of biomolecules is shown in the image below? -protein -lipid -carbohydrate -nucleic acid

Cells in a malignant tumor can survive and proliferate at another site in the body while cells in a benign tumor cannot.

What defines the difference between benign and malignant tumors? -Cells in a malignant tumor are unable to respond to any extracellular signals while cells in a benign tumor can still respond to some signaling. -Cells in a malignant tumor do not need to replicate their DNA before division while cells in a benign tumor must. -Cells in a malignant tumor do not respond to density-dependent inhibition signals while cells in a benign tumor stop proliferating when they reach appropriate density. -Cells in a malignant tumor can survive and proliferate at another site in the body while cells in a benign tumor cannot.

Centrioles

What do animal cells have to the exclusion of plant cells? -Centrioles -Chloroplasts -Mitocondria -Ribosomes

dehydration reaction

What do we call a reaction like this, where water is removed? -hydrolysis reaction -futile reaction -dehydration reaction -peptide reaction -catalyzed reaction

The class will be held on the days and times as denoted on Howdy. Meaning, attendance is required.

What does it mean to be in an online course that is taught synchronously? -The class will be held on the days and times as denoted on Howdy. But, attendance is not required. -The class can be taken at your pace, no days/times are mandatory you just need to get the work done. -The class will be held on the days and times as denoted on Howdy. Meaning, attendance is required. -Only lectures are online.

CO2 becomes bonded to an organic compound.

What does it mean to say that CO2 becomes "fixed" in talking about photosynthesis? -CO2 acts as an electron acceptor. -CO2 acts as an electron donor. -CO2 is released during cellular respiration. -CO2 becomes bonded to an organic compound.

Hydroxyl groups

What functional group that you learned about are there a lot of in sugars? -Hydroxyl groups -Amino group -Phosphate groups -Carboxyl groups -Methyl groups

H2O is oxidized, CO2 is reduced.

What happens during the sum total of photosynthesis? -CO2 is fixed by glucose. -H2O is reduced, CO2 is oxidized. -H2O is oxidized, CO2 is reduced. -Green wavelengths are highly absorbed by plant leaves for use in reactions. -O2 is taken in by the plant and CO2 is released.

highly folded surface of the inner mitochondrial membrane

What improves the productivity of cellular respiration? -highly folded surface of the inner mitochondrial membrane -the presence of an intermembrane space -the presence of free ribosomes in the mitochondrial matrix -the presence of multiple circular DNA molecules in the mitochondria

The DNA must first be replicated.

What is common to both prokaryotic and eukaryotic cell division? -Chromosomes will condense. -The DNA will be replicated and condensed. -A spindle will separate the DNA into the two daughter cells. -The DNA must first be replicated. -The DNA will replicate and a spindle will separate the DNA into the daughter cells.

Storage of fuel (energy).

What is one function of triacylglycerols living organisms? -Catalysis of chemical reactions. -Cell structure. -Storing genetic information. -Storage of fuel (energy). -Synthesis of hormones.

Ethanol

What is produced when yeast undergo fermentation? -Light -Ethanol -Oxygen -Sugar -Lactic acid

10^-11

What is the [OH-] in a solution with a pH of 3? -10^-11 -None of the above -10^11 -10^3 -10^-3

RNA polymerase

What is the main enzyme used during transcription? -DNA polymerase -Helicase -Ligase -RNA polymerase

180 g/mol

What is the molecular weight of Glucose? C6H12O6 (C = 12; H = 1; 0 = 16)? -180 g/mol -432 g/mol -29 g/mol -342 g/mol

Substrate

What is the name of letter C depicted in the figure above? -Substrate -Active site -Product(s) -Enzyme -Substrate/Enzyme complex

water

What is the original source of electrons for PSII? -carbon dioxide (CO2) -molecular oxygen (O2) -water -sunlight

Creating membranes.

What is the predominant role of phospholipids in organisms? -Storage of fuel (energy). -Catalysis of chemical reactions. -Synthesizing hormones. -Creating membranes.

ATP

What is the source of energy during the energy investment phase of glycolysis? -glucose -ATP -NAD+ -heat -NADH -light

glucose

What is the substrate for the first step in glycolysis? -glucose -pyruvate -ATP -carbon dioxide-CO2

G3P

What is/are the end product(s) of the Calvin Cycle? -G3P -All of these -Glucose -NADPH

the transfer of electrons in the ETC

What part of the cellular respiration pathway is affected by cyanide? -the breakdown of sugars in glycolysis -the transfer of electrons in the ETC -the production of NADH in the Krebs cycle -in ability of oxygen to enter the mitochondria

DNA has phosphorus and protein has sulfur

What properties of DNA and protein did Hershey and Chase use to uniquely tag each of them in their experiment to show that DNA is the heredity material of phage? -DNA and proteins have both phosphorous and sulfur -DNA and proteins have phosphorous -DNA has sulfur and protein has phosphorous -DNA and proteins have sulfur -DNA has phosphorous and protein has sulfur

They temporarily bind to an enzyme to change its shape or configuration to assist a reaction.

What role do cofactors play, specifically coezymes, in enzymatic reactions? -They function to change the free energy released from the reaction. -They temporarily bind to an enzyme to change its shape or configuration to assist a reaction. -They are usually lipid based enzymes that regulate reactions. -They function as allosteric regulators via the process of cooperactivity. -They temporarily bind to a substrate to change its shape or configuration to assist a reaction.

Non polar

What type of covalent bonds exist in methane? -Ionic -Hydrogen -Polar -Non polar

large and polar

What type of molecules will require the most help to pass through a cell membrane? -large and nonpolar -large and polar -small and nonpolar -small and polar

C48H82O41

What would be the molecular formula for a polymer made from eight glucose (C6H12O6) molecules linked together by dehydration reactions? -C48H80O40 -C48H96O48 -C48H110O62 -C48H82O41 -None of the above

monomers

When a macromolecule goes through complete hydrolysis, the products are -monomers. -salts. -ions. -individual atoms. -polymers.

it lowers the activation energy necessary to break the bonds of the reactants.

When an enzyme speeds up metabolic reactions, -it is consumed by the reaction and cannot be reused for other processes. -it lowers the ΔG of the overall reaction. -it increases the ΔG of the overall reaction. -it lowers the activation energy necessary to break the bonds of the reactants.

it lowers the activation energy necessary to break the bonds of the reactants.

When an enzyme speeds up metabolic reactions, -it lowers the activation energy necessary to break the bonds of the reactants. -it is consumed by the reaction and cannot be reused for other processes. -it lowers the ΔG of the overall reaction. -it increases the ΔG of the overall reaction.

mutation

When an error occurs in replication, it changes the nucleotide sequence of the DNA. This phenomenon is called a [A].

They are due each Monday by 7:59AM (CST) no matter what day or time your lab session is.

When are your weekly PRE lab quizzes due?

Friday, Dec 4th from 11:00am - 1:30pm CST.

When is your BIOL 111 Fall 2020 Final Exam? -We don't have a final exam for this course. -Friday, Dec 4th from 11:00am - 1:30pm CST. -Whenever you complete the material for the course and feel ready. -Friday, Dec 4th from 2:55pm - 3:45pm CST.

The alleles are co-dominant

When two alleles express equally in a heterozygous individual then the following is true: -One allele is dominant over the other -The phenotype is an effect of epistasis -One allele is not completely dominant over the other. -The alleles are co-dominant

the release of O2 from the process of photosynthesis

When you put aspirated spinach leaf disks in a beaker of sodium bicarbonate and place them in different colors of light, some disks float faster & more abundantly than others dependent on what color, if any, they were in. What made them able to float? -The release of O2 from the process of photosynthesis. -The sodium bicarbonate dissolving the cholorphyll in the leaf. -The release of CO2 from the process of photosynthesis. -The release of O2 from the process of respiration. -The green light condition/treatment.

A

Which binding site on the ribosome does the recruited tRNA bind to first? -Z -A -E -P

NADH

Which molecule is a common output of glycolysis, pyruvate oxidation, AND the citric acid cycle? -ADP -Pyruvate -Glucose -NAD+ -O2 -NADH

Cholesterol

Which molecule is important in regulating cell membrane fluidity? -Phospholipid -Cholesterol -Protein -Glucose

All cells have a nucleus

Which of following is not a tenet of the cell theory? -Cells can only arise by division from a preexisting cell -All organisms are composed of one or more cells -All cells have a nucleus -The cell is the structural unit of life

The energy of the universe is never constant.

Which of the following DOES NOT pertain to the first law of thermodynamics? -Energy is neither created nor destroyed. -It supports the idea that energy is conserved. -The energy of the universe is never constant. -An example to support it is the use of light that can be harnessed, to produce starch that has stored chemical energy.

Chloroplasts and mitochondria have the same sizes.

Which of the following DOES NOT support the endosymbiotic theory? -Chloroplasts and mitochondria are both double-membrane bound. -Chloroplasts and mitochondria contain their own DNA. -Chloroplasts and mitochondria contain bacteria-like ribosomes. -Chloroplasts and mitochondria have the same sizes.

Membrane proteins from cells of two different organisms will never be found mixed together in a hybrid cell.

Which of the following DOES NOT support the fluid mosaic model? -The presence of cholesterol greatly influences membrane fluidity. -Membrane is composed of various biomolecules with properties affected by temperatures changes. -Phospholipids move laterally within the plane of the membrane. -Membrane proteins from cells of two different organisms will never be found mixed together in a hybrid cell.

Aquaporins

Which of the following allows the fast and efficient bulk transport of water across cell membranes? -Aquaporins -ATP -Cholesterol -the sodium-potassium pump

nucleotides and amino acids

Which of the following basic molecular building blocks would be found in chromosomes? -nucleotides and lipids -nucleotides and amino acids -nucleotides and carbohydrates -nucleotides only

DNA is a very stable molecule, RNA is very unstable (ever changing, degrading).

Which of the following best describes the difference between DNA and RNA? -DNA is a very stable molecule, RNA is very unstable (ever changing, degrading). -In RNA, phosphate and hydroxyl groups are attached to the 5' and 3' ends, respectively. The opposite is seen in DNA. -RNA is usually double-stranded, while DNA never forms a double-stranded structure. -In RNA, adenine pairs with thymine, while in DNA, adenine pairs with uracil.

B

Which of the following cells is in Metaphase I? -A -B -C -D

identical cell wall composition

Which of the following characteristics is NOT shared by bacteria and archaea? -identical cell wall composition -presence of plasma membrane -presence of ribosomes -absence of nuclear membrane

Lipids

Which of the following class of biomolecules is NOT considered as a true polymer? -Lipids -Proteins -Nucleic acids -Carbohydrates

the presence or absence of internal membranes partitioning the cell

Which of the following distinguishes a eukaryotic cell from a prokaryotic cell? -the presence or absence of double-stranded DNA -whether or not ribosomes are present -the number of cells present (i.e. unicellular vs. multicellular) -the presence or absence of internal membranes partitioning the cell

Its protein and lipid components are symmetrically distributed

Which of the following does NOT describe a biological membrane? -Its protein and lipid components are symmetrically distributed. -Carbohydrate portion of its glycoproteins are positioned on the extracellular face. -It is a collage of proteins, embedded in the fluid matrix of the lipid bilayer. -Its components get transported through vesicles, whose outside face becomes continuous with the membrane cytoplasmic face.

co-dominance

Which of the following does not follow Mendel's laws? -dominance of alleles -recessive alleles -segregation of alleles -independent assortment of alleles -co-dominance

DNA is synthesized.

Which of the following does not take place during the G1 or G2 phase of the cell cycle? -Proteins are synthesized. -The mitochondria grow, expand and divide. -DNA is synthesized. -Energy is utilized.

The spindle is formed in preparation for chromatid separation.

Which of the following does not take place during the S-phase of the cell cycle? -Energy is utilized. -Proteins are synthesized. -The spindle is formed in preparation for chromatid separation. -The mitochondria grow, expand and divide. -DNA is synthesized.

The spindle is formed in preparation for chromatid separation.

Which of the following does not take place during the S-phase of the cell cycle? -The mitochondria grow, expand and divide. -The spindle is formed in preparation for chromatid separation. -Energy is utilized. -DNA is synthesized. -Proteins are synthesized.

Cells age and begin to lose function.

Which of the following effects might be caused by reduced or very little active telomerase activity? -Telomere lengthens in germ cells -Cells maintain normal functioning. -Cells age and begin to lose function. -Cells may become cancerous.

Because humans lack the enzyme which recognizes β-1,4-glycosidic linkages

Which of the following explains why humans can digest starch but not cellulose? -Because humans lack the enzyme which recognizes α-1,4-glycosidic linkages -Because cellulose has a lot of branched regions making it difficult for the enzymes to find the cleavage points for complete digestion in humans -Because humans lack the enzyme which recognizes β-1,4-glycosidic linkages -Because starch has a lot of branched regions allowing a greater surface area for easy digestion in humans

Water at 100oC

Which of the following has the highest entropy? -Same entropy for all -Water at -80oC -Water at 25oC -Water at 100oC

Hydrolysis of glycogen releases fructose, a sugar that is sweeter than glucose and thus gives off more stored energy.

Which of the following is FALSE about glycogen as a storage polysaccharide? -It is stored primarily in liver and muscle cells. -Glycogen stores are mainly replenished by food consumption. -Hydrolysis of glycogen releases fructose, a sugar that is sweeter than glucose and thus gives off more stored energy. -It has a highly branched structure, which allows rapid mobilization of its sugar units during metabolic need.

The ATP generated from anabolic reactions drives catabolic reactions.

Which of the following is FALSE about the relationship between catabolism and anabolism? -The ATP generated from anabolic reactions drives catabolic reactions. -Products of catabolic processes provide substrates for the anabolic processes, and vice versa. -Catabolism is exergonic, while anabolism is endergonic. -Both pathways involve enzymatic activities.

The two strands are parallel.

Which of the following is FALSE regarding the DNA double helix? -The two strands are parallel. -The two strands exhibit complementary base pairing. -The four nitrogenous bases found in it are A, T, C and G. -The two strands are stabilized by hydrogen bonds and base stacking interactions

Non-sister chromatids exchange DNA

Which of the following is NOT TRUE for mitosis? -Non-sister chromatids exchange DNA -It can be a method of reproduction -It produces genetically identical daughter cells -It is similar to meiosis

O2

Which of the following is NOT a compound? -O2 -HCl -None of these -C6H12O6 -NaCl -H2O

Store genetic information

Which of the following is NOT a function of a lipid? -Store genetic information -Component of cellular membranes -Long-term energy storage -Insulation from the environment -Building blocks for some hormone synthesis

O

Which of the following is NOT a molecule? -O -O2 -H2O -NaCl -C6H12O6 -None of these

movement via an electrogenic pump

Which of the following is NOT an example of facilitated diffusion? -movement via water channel proteins -movement via an electrogenic pump -all are examples of facilitated diffusion -movement via ion channels

Calcium

Which of the following is NOT one of the four major elements that make up biological macromolecules? -Hydrogen -Carbon -Oxygen -Calcium -Nitrogen

They easily dissolve in water.

Which of the following is NOT true about hydrocarbons? -They easily dissolve in water. -They are absent (without other bonds) in most living organisms. -They are only composed of hydrogens and carbons (but can make bonds with other compounds). -They have hydrophobic regions.

a single histone H1 is present in the nucleosome core

Which of the following is NOT true about nucleosomes? -A single Histone H1 is present in the nucleosome core. -A nucleosome core is composed of 8 histone proteins. -A nucleosome core is wrapped by DNA double helix. -Each nucleosome core is composed of 2 copies each of four different histone proteins.

A+T=C+G

Which of the following is NOT true for a double-stranded DNA molecule? -A/T=C/G -A+T=C+G -A+C=G+T -A+G=C+T

Replication of a chromosome begins at a single site called the 'origin of replication'.

Which of the following is NOT true for both bacterial and eukaryotic DNA replication? -Replication of a chromosome begins at a single site called the 'origin of replication'. -A replication fork is present at the end of a replication bubble. -At the end of replication two identical daughter DNA molecules are generated. -Replication proceeds in both directions from the origin.

Roughly 2% of the entire genome encodes exons that are translated into proteins.

Which of the following is a TRUE statement about the human genome? -It is comprised of 46 pairs of chromosomes. -Roughly 2% of the entire genome encodes exons that are translated into proteins. -As the most advanced organism, it has more DNA than any other known species. -It consists of a singular, long DNA molecule connected at the ends to form a circle. -ALL OF THE ABOVE ARE TRUE.

Chlorophyll

Which of the following is an example of a pigment? -Glucose -NADPH -Vitamin D -Chlorophyll -Carbon dioxide

Developing and implementing a successful vaccine against Covid-19.

Which of the following is an example of applied science? -Exploring and mapping out the phylogenetic history of Covid-19 (especially in relation to other corona viruses). -Determining which groups of people are more susceptible to severe complications due to Covid-19. -Tracking down "patient zero" for Covid-19. -Developing and implementing a successful vaccine against Covid-19.

all of the options

Which of the following is an example of post- transcriptional control of gene expression? -mRNA degradation -alternative splicing of exons -protein processing and degradation -all of the options

a molecule of glucose

Which of the following is an example of potential rather than kinetic energy? -water rushing over Niagara Falls -a molecule of glucose -a crawling beetle foraging for food -light flashes emitted by a firefly

The leading strand is synthesized as a series of segments called the Okazaki fragments.

Which of the following is false about the process of DNA replication? -The leading strand is synthesized as a series of segments called the Okazaki fragments. -DNA polymerase can only add nucleotides to the free 3' end of a growing DNA strand or a primer. -DNA ligase joins all the Okazaki fragments into a continuous DNA strand. -Both leading and lagging strands are elongated in 5' to 3' direction.

Crossing over between sister chromatids

Which of the following is not a source of genetic variation? -Engulfing DNA from other organisms -Independent assortment of chromosomes -Crossing over between sister chromatids -Crossing over between homologous chromosomes

A checkpoint will be activated if the spindle does not attach to a kinetochore.

Which of the following is not common to both prokaryotic and eukaryotic cell division? -Cleavage occurs to separate the cell in two. -The DNA is replicated. -Two genetically identical daughter cells are produced. -A checkpoint will be activated if the spindle does not attach to a kinetochore.

A checkpoint will be activated if the spindle does not attach to a kinetochore.

Which of the following is not common to both prokaryotic and eukaryotic cell division? -Two genetically identical daughter cells are produced. -A checkpoint will be activated if the spindle does not attach to a kinetochore. -The DNA is replicated. -Cleavage occurs to separate the cell in two.

A functional camera and access to Zoom

Which of the following is required for use in all of your exams?

one of the two bodies held together after DNA replication, each having an exact copy of the DNA

Which of the following is the best definition or description for "chromatid"? -a fiber composed of a DNA molecule and proteins making up chromosomes -one of the two bodies held together after DNA replication, each having an exact copy of the DNA -a type of organelle that is found in the membrane of animal cells -a bundle of ribosomes with DNA wrapped around it -the region where two bodies are held together after DNA replication

Offspring are genetically identical to parent.

Which of the following is true about asexual reproduction? -Siblings may have unique gene combinations. -Haploid gametes unite to give rise to diploid offspring. -It is found only in unicellular organisms. -Offspring are genetically identical to parent.

Are polymers made of smaller monomers.

Which of the following is true about macromolecules? -Are polymers made of smaller monomers. -Always have a molecular weight greater than 100,000 da. -Are not soluble in water. -Are always soluble in water. -Are monomers made of smaller polymers.

Enzymes increase the rate of chemical reaction by lowering the activation energy.

Which of the following is true of enzymes? -Without enzymes, reactions would never take place. -Enzyme function is increased if the 3-D structure or conformation of an enzyme is altered. -Enzymes increase the rate of chemical reaction by lowering the activation energy. -Enzymes increase the rate of chemical reaction by providing activation energy to the substrate.

all of the options

Which of the following is/are true for enhancer elements? -All of the options -They maybe located thousands of nucleotides upstream or downstream of a gene. -They maybe located thousands of nucleotides upstream or downstream of a gene, and there maybe multiple enhancers for a given gene. -They maybe located within an intron. -There maybe multiple enhancers for a given gene.

all of the above

Which of the following organisms perform aerobic cellular respiration? -animals -plants -fungi -bacteria -all of the above

Your correct UIN.

Which of the following pieces of information is absolutely required to be input in your Learning Catalytics account for you to received credit for participating in sessions? -Your correct UIN. -Your social security #. -Your bank account #. -Your TAMU email.

responding to the environment.

Which of the following properties or processes do we associate with living things? -sexual reproduction. -natural selection. -nucleated cells. -responding to the environment. -creating energy.

5' -TAGCTCGGA- 3'

Which of the following sequences is complementary to the DNA strand with sequence: 5' -TCCGAGCTA- 3'? (Hint: remember your 5' - 3' orientation rules.) -3' -TCCGAGCTA- 5' -3' -ATCGAGCCT- 5' -5' -TAGCTCGGA- 3' -5' -AGGCTCGAT- 3'

fructose, sucrose, chitin

Which of the following shows carbohydrates arranged according to increasing number of sugar units? -lactose, cellulose, galactose -fructose, sucrose, chitin -ribose, galactose, starch -glucose, glycogen, maltose

Dropping a pencil: potential energy→ kinetic energy

Which of the following shows the BEST example for the indicated energy transformation? -Dropping a pencil: potential energy→ kinetic energy -Burning charcoal to boil water: thermal energy → chemical energy -Climbing and finally reaching the mountain top: potential energy → kinetic energy -Food digestion to regulate body temperature: kinetic energy → chemical energy

Dropping a pencil: potential energy→ kinetic energy

Which of the following shows the BEST example for the indicated energy transformation? -Food digestion to regulating body temperature: kinetic energy → chemical energy -Burning charcoal to boil water: thermal energy → chemical energy -Dropping a pencil: potential energy→ kinetic energy -Climbing and finally reaching the mountain top: potential energy → kinetic energy

Hydrogen bonds are generally weak, yet they stabilize protein secondary structures because they are found throughout the polypeptide backbone.

Which of the following statements about proteins is TRUE? -α-helices make up most fibrous proteins such as the silk protein of a spider's web. -Hydrogen bonds are generally weak, yet they stabilize protein secondary structures because they are found throughout the polypeptide backbone. -A β-pleated sheet is a structure formed by hydrogen bonds between every fourth amino acid in a polypeptide chain. -Hydrogen bonds between amino acid side chains (R groups) are responsible for stabilizing a protein's secondary structure.

It introduces a premature stop codon into the mRNA.

Which of the following statements best describes the effect a nonsense mutation would have on a gene? -It alters the reading frame of the mRNA. -It changes an amino acid in the encoded protein. -It renders the gene completely useless/ineffective. -It introduces a premature stop codon into the mRNA. -It has no effect on the amino acid sequence of the encoded protein.

An isolated system cannot exchange either matter or energy with its surroundings

Which of the following statements is TRUE? -Organisms are isolated systems because they have their own machineries in the cells to supply all the matter and energy they need. -An isolated system cannot exchange either matter or energy with its surroundings. -Open systems are called as such because they do not absorb energy, but just openly release the energy to their surroundings. -Organisms are open systems when they are out of their habitats.

Autotrophs, but not heterotrophs, can nourish themselves beginning with CO2 and other nutrients that are inorganic.

Which of the following statements is a CORRECT distinction between autotrophs and heterotrophs? -Only heterotrophs require chemical compounds from the environment -Autotrophs, but not heterotrophs, can nourish themselves beginning with CO2 and other nutrients that are inorganic. -Only heterotrophs have mitochondria -Cellular respiration is unique to heterotrophs

all of these

Which of these could lead to conversion of a proto-oncogene into an oncogene? -All of these -Amplification of a proto-oncogene through gene duplication. -Translocation of proto-oncogenes near an active promoter. -A point mutation in proto-oncogene or its regulatory elements

heritable variation in the population

Which of these factors are required for biological evolution to occur? -variation in acquired traits among individuals in the population -natural selection -heritable variation in the population -many generations -a large population

All of these are essential elements

Which of these is NOT an essential element that makes up living matter? -Nitrogen -Iron -Carbon -Calcium -Oxygen -All of these are essential elements -Hydrogen

Amino acids

Which of these molecules, if radioactively labeled, will be incorporated into a newly made protein? -Amino acids -Monosaccharides -Glycerol and fatty acids -Nucleotides -Isoprene

Cannot determine with the information given.

Which organism has the most DNA? -An extremophile bacteria -A hippopotamus -A human -A California Redwood (tree) -Cannot determine with the information given.

The breading on the shrimp

Which part of fried shrimp provides the most energy in the form of glucose to help power cellular respiration? -The shrimp -The frying oil -The breading on the shrimp -Lemon/lemon juice squeezed on top

all of the options occur in a photosynthetic cell

Which process(es) is/are not found in a photosynthetic cell? -oxidative phosphorylation -glycolysis, the citric acid cycle, and oxidative phosphorylation -All of the options occur in a photosynthetic cell. -glycolysis -the citric acid cycle

redundancy

Which property of genetic code lowers the chances of a deleterious mutation in an individual? -Uracil instead of Thymine -Redundancy -Hydrogen bonding -All of them -Universality

Rosalind Franklin

Which scientist generated this image of DNA X-ray diffraction? -Watson & Crick -Francis Crick -Frederick Griffith -James Watson -Rosalind Franklin

F, Cl, As, Ba, Ne

Which series of elements below are ordered from high to low electronegativity? -F, Cl, As, Ba, Ne -F, As, Cl, Ne, Ba -Ne, Ba, As, Cl, F -Ne, F, Cl, As, Ba -Ba, As, Cl, F, Ne

All are true

Which statement about water's polarity is TRUE? -Water's polarity makes it a versatile solvent. -Water molecules can form up to 4 hydrogen bonds with other water molecules. -Water's polarity causes other polar molecules to be hydrophilic. -All are true -All are false

Polymers are made of monomers.

Which statement is correct? -Monomers are made of polymers. -Water is a polymer. -Polymers are made of monomers. -Water is a monomer. -Polymers and monomers are basically the same thing.

They insert their DNA into the host genome and can cause massive damage.

Why can certain types of viruses promote cancer in humans especially? -The body overcompensates for damaged organs and mass produces cells. -The viruses cause silent mutations in the host's genome. -They insert their DNA into the host genome and can cause massive damage. -The medicine used to treat the virus is what causes most cancers. -The virus can mutate an oncogene into a proto-oncogene.

One phenotype was completely dominant over another.

Why did the F1 offspring of Mendel's classic pea cross always look like one of the two parental varieties? -No genes interacted to produce the parental phenotype. -Each allele affected phenotypic expression. -The traits blended together during fertilization. -One phenotype was completely dominant over another. -Different genes interacted to produce the parental phenotype.

ATP levels decrease.

You can make a cell extract that is able to perform glycolysis in vitro (in a test tube) if glucose is added. Arsenate is a potent inhibitor of triose phosphate dehydrogenase, the enzyme required for the 6th step in glycolysis. If both arsenate and glucose are added to the cell extract, what happens? -Both ATP and pyruvate levels decrease. -Both ATP and pyruvate levels increase. -ATP levels decrease. -ATP levels increase.

10% are A

You discover a new organism and analyze its DNA. If you find 40% of nucleotides are G, which of the following is true: -10% are C -20% are C -10% are A -20% are A

10% are A

You discover a new organism and analyze its DNA. If you find 40% of nucleotides are G, which of the following is true: -20% are C -10% are A -10% are C -20% are A

A. Phagocytosis B. Pinocytosis C. Receptor-mediated endocytosis

match the following: phagocytosis pinocytosis receptor-mediated endocytosis A.Vesicle which pinches off does not have a coated pit B.Cell continually takes in droplets of extracellular fluid into vesicles C.Taking in cholesterol for membrane synthesis in humans

5.30 M

A 0.250 L (250 ml) sample of seawater contains 77.4g of NaCl, which has a molecular weight of 58.44 g/mol. What is the molar concentration of NaCl in the seawater? -5.30 M -1.0 M -0.631 M -310 M

DNA ligase

A biochemist isolates, purifies, and combines in a test tube a variety of molecules needed for DNA replication. When she adds some DNA to the mixture, replication occurs, but each DNA molecule consists of a normal strand paired with numerous segments of DNA a few hundred nucleotides long. What has she probably left out of the mixture? -DNA ligase -DNA polymerase -Okazaki fragments -Primase

6

A carbon-12 atom has 6 protons and 6 neutrons. How many electrons does a carbon-12 atom have? -4 -12 -Insufficient information has been given to answer this question. -6 -2

exergonic, endergonic

A chemical reaction that has a negative Δ G is best described as _____ while one with a positive Δ G is _____? -endergonic, exergonic -exocytic, endocytic -exergonic, endergonic -nonspontaneous, spontaneous

B

A father with blood type O and a mother with blood type AB have 2 children. One child has blood type A. Which of the following is a possible blood type of the other child? Type A is either AA or Ai Type B is either BB or Bi Type AB is only AB Type O is only ii -O -B -None of these -AB

light, CO2, H2O

A field full of weeds will compete for which resources required for photosynthesis? -H2O, O2, nitrogen -NADP+, CO2, O2 -Nitrogen, NADP+, CO2 -Light, CO2, H2O

an X chromosome linked disease.

A hereditary disease never passed from father to son is: -an X chromosome linked disease. -a Y chromosome linked disease. -an autosomal disease. -None of these

2.1 million

A mammalian stem cell line has a doubling time of 24 hours. If you start with 350,000 of these cells, approximately how many cells would be present after 60 hours of growth? -2.5 million -1.2 million -Insufficient information is given to answer this question -705,000 -2.1 million

the independent variable has no effect on the dependent variable

A null hypothesis states that: -the independent variable has no effect on the dependent variable -there is no hypothesis that can be made -there is no control group in this type of experiment -the dependent variable has no effect on the independent variable

they express different sets of genes

A pancreatic cell and a liver cell differ because -All of them -they have different sets of genes. -they have different number of genes. -they express different sets of genes.

The red blood cells are in danger of bursting because they were subjected to a hypotonic

A patient experienced great blood loss. In an attempt to quickly replenish body fluids, a volume of distilled water equal to the blood lost was introduced directly into a blood vein. What is the most likely result of this treatment? -The red blood cells should be fine because they were subjected to an isotonic environment. -The red blood cells are unaffected because distilled water shares the same pH with the intracellular region of red blood cells. -The red blood cells are in danger of bursting because they were subjected to a hypotonic environment. -The red blood cells are in danger of shrinking because they were subjected to a hypertonic environment.

false

A photosynthetic plant cell does not need mitochondria. (T/F)

128 million

A plant root cell has a doubling time of 12 hours. If you start with 125,000 of these cells, approximately how many cells would be present after 120 hours of growth? -Insufficient information is given to answer this question -1.28 million -640,000 -64 million -128 million

nonsense mutation

A point mutation that changes a codon for an amino acid to a stop codon is called: -Stop mutation -Frameshift mutation -Missense mutation -Nonsense mutation

Both mutations or gene flow could allow this to happen.

A population of plants is growing in a nice, moist rain forest. All of the plants have equally thin, broad leaves that lose water quickly (which is ideal in this environment). Which of the following could add a new heritable variation providing thicker, tougher leaves that would make the plants more drought-resistant? Environmental change: a drought could stress the plants, making them grow thicker leaves that they would pass to their offspring in order to survive. -Mutation: a change to DNA in a sperm or egg could produce a new gene that controls leaf thickness. -Gene flow: pollen from a nearby population of plants with thicker leaves could fertilize a flower and bring a new allele into the gene pool. -Natural selection: survival of the fittest could create a new genetic adaptation like thicker leaves if it was needed. -Both mutations or gene flow could allow this to happen.

Introns are present in the pre-mRNA and are spliced out during pre-mRNA processing.

A pre-mRNA 5000 nucleotides long makes a protein consisting of approximately 500 amino acids. This result is best explained by which of the following? -Several stretches of termination sequences occur within pre-mRNA. -The RNA polymerase enzyme breaks off and re-attaches to the DNA strand at intervals. -Introns are present in the pre-mRNA and are spliced out during pre-mRNA processing. -Ribosomes repeatedly pause and reinitiate translation after skipping several nucleotides. -There is redundancy in the genetic code.

Encoding mRNAs and subsequently proteins

A primary function of DNA in somatic cells is -Encoding mRNAs and subsequently proteins -Synthesizing membrane phospholipids -DNA has no function in somatic cells -Converting glucose to pyruvate

increase in gene expression

A researcher found a method she could use to manipulate and quantify methylation in embryonic cells in culture. In one set of experiments, she succeeded in increasing acetylation of histone tails in the chromatin of the cells. Which of the following results would she most likely see in these cells? -decrease in gene expression -increase in gene expression -delayed shortening of the telomeres -a new function for these genes -inactivation of the selected genes

is carefully-formulated proposition, based on observation, and supported by an accumulation of experimental data

A scientific "theory": Answers: -is a hypothesis that has yet to be subjected to experimentation. -may have been found to be false under some particular set of circumstances. -is a well-thought-out potential explanation for a phenomenon. -is a carefully-formulated proposition, based on observations, and supported by an accumulation of experimental data. -may incorporate explanations involving processes other than physical phenomena.

Cross to a true breeding short plant

A tall plant has been found, but its zygosity is unknown. Tall is dominant over short height. The following can be done to determine its zygosity: -Let it self fertilize then analyze the progeny -Cross to a heterozygous tall plant -Cross to a true breeding short plant -Cross to a true breeding tall plant

0%

A tortoiseshell cat mates with a white cat. What is the probability that the male offspring will be tortoiseshell? -25% -0% -50% -75%

9:3:3:1

A true breeding tall pea plant with purple flowers and round seeds is crossed with a true breeding short pea plant with white flowers and wrinkled seeds. The dominant alleles are tall, purple and round. What should be the phenotypic ratio in the F2 generation if the gene for flower color is tightly linked to the gene of seed coat type? -27:9:9:9:3:3:3:1 -1:2:2:1 -9:3:3:1 -1:2:2:4:1:2:1:2:1

The alleles have incomplete dominance.

A white mouse (bb) mates with a black (BB) mouse and all the babies are gray in color. Which of the following is true for the alleles responsible for coat color of the mice? -The alleles are influenced by epistasis. -The alleles have incomplete dominance. -Both alleles are codominant. -One allele is entirely dominant.