Biology Exam 3 Chapter 7 + 8

If "A" makes up 24% of RNA sample, what percentage is "T"?

0

Match stages of Transcription with what is happening in each stage 1. initiation 2. elongation 3. termination A. RNA polymerize reaches terminator and disassociates with DNA and newly made RNA ending the transcription B. nucleotides are added to growing RNA molecule C. RNA Polymerize bind to Promotor starting Transcription

1=C 2=B 3=A

If "A" makes up 30% of DNA segment, what is the percentage of C in that strand?

20

If "A" makes up 24% of DNA sample, what percentage is "G"? (just type in number)

26

Okazaki fragments made because DNA polymerase can only add nucleotides to

3' end

If DNA template strand is 5'-AACCTGCTA-3', what would be mRNA transcribed from it?

3'-UUGGACGAU-5'

If cell has total 4 chromosomes in G1 phase of Interphase, then it has __________ chromatids in this phase.

4

If following is mature mRNA being translated, how many amino acids will you see in this polypeptide?5'-UAAUGGGAUUUGGCUGACCGAAGUUU-3'

4

Cell mentioned in Q3 has _____ chromosomes and _____ chromatids in G2 stage.

4, 8

Cell mentioned in Q3 has _______ chromosomes and ________ chromatids in Metaphase.

4, 8

How many Amino acids will be in polypeptide coded my this mRNA: AAGGAUGGGAGAUUGGCCUUAC

6

Cell mentioned in Q3 has ________ chromosomes and ___________ chromatids in telophase.

8, 8

Cell mentioned in Q3 has _________ chromosomes and ________ chromatids at the end of Anaphase.

8, 8

Describe the structure and complementary base pairing of DNA.

A single strand of DNA is a polymer of nucleic acids joined covalently between the phosphate group of one and the deoxyribose sugar of the next to for a "backbone" from which the nitrogenous bases stick out. In its natural state, DNA has two strands wound around each other in a double helix. The bases on each strand are bonded to each other with hydrogen bonds. Only specific bases bond with each other; adenine bonds with thymine, and cytosine bonds with guanine.

Which one of these is part of Chargaff's rule?

A=T G=C

What is the sequence of START codon?

AUG

How can we get multiple polypeptides based on single gene A) By copying 2 different strands of DNA B) By cutting out different exons C) By cutting out different introns

By cutting out different introns

If "A" makes up 24% of RNA sample, what percentage is "G"?

Can't tell

Metaphase

Chromosomes line up in the middle of the cell

Which one of these is not true? A) DNA has double helix, and RNA has single strand B) DNA is larger than RNA C) DNA has U, and RNA has T D) DNA has deoxyribose, and RNA has ribose E) DNA is in nucleus, while most of RNA is located in cytoplasm

DNA has U, and RNA has T

S

DNA replication

The image at right shows a cell's DNA before replication. Which of the following best represents the newly created (red) DNA strands after replication is complete?

Each "daughter" DNA molecule is made out of one parental strand and one new strand

G1

Gap 1 (growth 1) stage= growth of the cell and replication of organelles

Which one of these is not correct? A) Gene is a continuous strand of nucleotides coding for mRNA B) Gene starts with Promotor C) Gene ends with Terminator D) Information from gene is copied into mRNA through translation

Information from gene is copied into mRNA through translation

Since Lactose can bind to repressor and remove it from Operon allowing the RNA polymerase to copy the genes, we would consider this to be A) Negative feedback B) Positive feedback

Negative feedback

Which one of these statements is NOT true? A) RNA strand is copied of the Template strand B) RNA is a copy of the Template strand C) RNA grows by adding nucleotides to 3' end of strand

RNA is a copy of the Template strand

Which one of these is NOT part of Lac Operon A) Promotor B) Operator C) Repressor gene D) 3 genes coding for 3 different polypeptides

Repressor gene

Chromosomes are duplicated during what portion of the cell cycle? A) phase B) S phase C) prophase D) prometaphase

S phase

If one DNA strand has AAGGCCTA sequence, what would be sequence of its complimentary strand

TTCCGGAT

Describe the organization of the eukaryotic chromosome.

The DNA is wound around proteins called histones. The histones then stack together in a compact form that creates a fiber that is 30-nm thick. The fiber is further coiled for greater compactness. During metaphase of mitosis, the chromosome is at its most compact to facilitate chromosome movement. During interphase, there are denser areas of chromatin, called heterochromatin, that contain DNA that is not expressed, and less dense euchromatin that contains DNA that is expressed.

Describe how controlling gene expression will alter the overall protein levels in the cell.

The cell controls which protein is expressed, and to what level that protein is expressed, in the cell. Prokaryotic cells alter the transcription rate to turn genes on or off. This method will increase or decrease protein levels in response to what is needed by the cell. Eukaryotic cells change the accessibility (epigenetic), transcription, or translation of a gene. This will alter the amount of RNA, and the lifespan of the RNA, to alter the amount of protein that exists. Eukaryotic cells also change the protein's translation to increase or decrease its overall levels. Eukaryotic organisms are much more complex and can manipulate protein levels by changing many stages in the process.

Transcribe and translate the following DNA sequence (nontemplate strand): 5'-ATGGCCGGTTATTAAGCA-3'

The mRNA would be: 5'-AUGGCCGGUUAUUAAGCA-3'. The polypeptide would have 4 Amino acids. Even though there are six codons, the fifth codon corresponds to a stop, so the sixth codon would not be translated.

True/False. Chromatin is made of nucleosomes

True

Which of these nucleotides in NOT found in DNA?

U

List one STOP codon

UAA

What would be the anti-codon on tRNA that carries Amino Acid Methionine

UAC

What is necessary for a cell to pass the checkpoint? A) cell has reached a sufficient size B) an adequate stockpile of nucleotides C) accurate and complete DNA replication D) proper attachment of mitotic spindle fibers to kinetochores

accurate and complete DNA replication

primase

adds short RNA primer to DNA template strand

In which stage of Mitosis do sister chromatids (identical copies of the chromosome) separate from each other

anaphase

Separation of the sister chromatids is a characteristic of which stage of mitosis? A) prometaphase B) metaphase C) anaphase D) telophase

anaphase

Why are Okazaki fragments necessary? A) because DNA strand can only grow from 3' end B) because DNA strand can only grow from 5' end C) because RNA strand can only grow from 3' end D) because RNA strand can only grow from 5' end

because DNA strand can only grow from 3' end

DNA polymerase

binds nucleotides to form new strands

What is the reason why plant cells cannot create cleavage furrow during cytokinesis?

cell wall

Mutations are _____ in DNA sequence.

changes

Prometaphase

chromosomes attach to mitotic spindle fibers

ligase

creates covalent bond between adjacent DNA segments (glues DNA pieces together)

Where does Translation occur?

cytoplasm

Cytokinesis

cytoplasm and cell membrane divide

M checkpoint

do kinetochores attach to spindle? are chromosomes aligned down equator?

Prokaryotes contain a _____ chromosome, and eukaryotes contain _____ chromosomes. A) single-stranded circular; single-stranded linear B) single-stranded linear; single-stranded circular C) double-stranded circular; double-stranded linear D) double-stranded linear; double-stranded circular

double-stranded circular; double-stranded linear

Control of gene expression in eukaryotic cells occurs at which level(s)? A) only the transcriptional level B) epigenetic and transcriptional levels C) epigenetic, transcriptional, and translational levels D) epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels

epigenetic, transcriptional, post-transcriptional, translational, and post-translational levels

Which one of these is not correct regarding mRNA processing A) PolyA tail is added B) cap is added C) exons are removed

exons are removed

______ are changes to the nucleotides in a segment of DNA that codes for a protein. A) Proto-oncogenes B) Tumor suppressor genes C) Gene mutations D) Negative regulators

gene mutations

An organism's traits are determined by the specific combination of inherited_______ A) cells B) genes C) proteins D) chromatids

genes

Which of the following does cytosine pair with?

guanine

During Binary fission cell divides into 2 ________ cells

identical

Portions of eukaryotic mRNA sequence that are removed during RNA processing are ____. A) exons B) caps C) poly-A tails D) introns

introns

G1 checkpoint

is DNA damaged

S checkpoint

is DNA replicating correctly

G2 checkpoint

is all DNA replicated and can mistakes be fixed; Is spindle-making machinery in place?

Which eukaryotic cell-cycle event is missing in binary fission? A) cell growth B) DNA duplication C) mitosis D) cytokinesis

mitosis

In which stage of Mitosis is DNA replicated

none

Early Prophase

nuclear envelopes start breaking apart and chromosomes are getting more visible

The RNA components of ribosomes are synthesized in the ______. A) cytoplasm B) nucleus C) nucleolus D) endoplasmic reticulum

nucleolus

The initial mechanism for repairing nucleotide errors in DNA is ______ A) mismatch repair B) DNA polymerase proofreading C) nucleotide excision repair D) thymine dimers

nucleotide excision repair

Where does DNA transcription occur?

nucleus

Because lagging strain is running 3' to 5' but nucleotides can only be added to the 3' end, this DNA strand is copied in small sections called

okazaki fragments

G2

production of enzymes needed in cell division

The individual chromosomes become visible with a light microscope during which stage of mitosis? A) prophase B) prometaphase C) metaphase D) anaphase

prophase

Which one of these are NOT part of Interphase? (choose all that apply) Multiple answers:You can select more than one option A) G0 B) G1 C) G2 D) S E) Prophase F) Mitosis

prophase and mitosis

A gene that codes for a positive cell cycle regulator is called a(n) ______ A) kinase inhibitor B) tumor suppressor gene C) proto-oncogene D) oncogene

proto-oncogene

Post-translational control refers to: A) regulation of gene expression after transcription B) regulation of gene expression after translation C) control of epigenetic activation D) period between transcription and translation

regulation of gene expression after transcription

Because newly made DNA molecule contains one "parental" strand, and second strand is newly synthesized, we say that DNA replication is______

semi-conservative

DNA replicates by which of the following models? A) conservative B) semiconservative C) dispersive D) none of the above

semiconservative

FtsZ proteins direct the formation of a ______ that will eventually form the new cell walls of the daughter cells. A) contractile ring B) cell plate C) cytoskeleton D) septum

septum

Anaphase

sister chromatids separate and move towards opposite sides of cell

Binding proteins

stabilize unwinded DNA strands

Nuclei contain single chromosomes in _____ and ______ stages of Mitosis

telophase and cytokinesis

True/False. One gene can code for multiple polypeptides because cell can remove different combinations of introns from mRNA during processing A) True B) False

true

A diploid cell has ________ the number of chromosomes as a haploid cell. A) one-fourth B) one-half C) twice D) four times

twice

Telephase

two new nuclear envelopes are formed around two sets of chromosomes

Helicase

unwinding DNA helix